The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_014225	Waddlia chondrophila WSU 86-1044, complete sequence	2116312	201186	267675	2116312	protease,tRNA,transposase	Catovirus(18.18%)	57	NA	NA
WP_013181285.1|201186_201465_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013181286.1|201461_202223_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	26.2	2.7e-16
WP_013181287.1|202397_203279_+|protease	serine protease	protease	W5SAB9	Pithovirus	33.5	3.5e-07
WP_013181289.1|203516_203996_+	PEGA domain-containing protein	NA	NA	NA	NA	NA
WP_013181290.1|204055_204943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013181291.1|205072_206713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013181292.1|206857_208063_+	tyrosine transporter	NA	NA	NA	NA	NA
WP_013181293.1|208059_209271_+	tyrosine transporter	NA	NA	NA	NA	NA
WP_013181294.1|209272_210319_+|tRNA	tryptophan--tRNA ligase	tRNA	A0A1V0S998	Catovirus	23.5	6.4e-08
WP_013181295.1|210315_212322_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_013181296.1|212383_213421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013181297.1|213424_214651_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_041941443.1|214860_216534_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_013181299.1|216517_217195_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_041941444.1|217224_217650_+	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_013181301.1|217659_217902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013181302.1|217894_218557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013181303.1|218622_219069_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_013181304.1|219068_219713_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_013181305.1|219699_222372_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_013181306.1|222544_222985_+	histone	NA	NA	NA	NA	NA
WP_041941668.1|223114_224557_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	28.0	1.6e-49
WP_013181308.1|224553_225651_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.0	8.6e-96
WP_041941446.1|225699_226065_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_013181310.1|226024_226720_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	45.5	1.2e-29
WP_013181311.1|226933_228247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013181312.1|228261_229368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013181313.1|229373_230636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013181314.1|230668_231910_-	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_013181315.1|231906_233571_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_013181316.1|233612_234875_-	sodium:proton antiporter NhaD	NA	NA	NA	NA	NA
WP_013181317.1|235018_236581_+	NTP/NDP exchange transporter	NA	NA	NA	NA	NA
WP_013181318.1|236577_238419_-	molecular chaperone HtpG	NA	A0A1V0SAD6	Catovirus	25.1	1.7e-51
WP_049767144.1|238612_239863_+	NADH:ubiquinone reductase (Na(+)-transporting) subunit F	NA	NA	NA	NA	NA
WP_013181320.1|239870_241505_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	31.9	7.3e-75
WP_041941447.1|241781_242246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143876332.1|242295_243477_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_013181324.1|243473_244067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013181325.1|244131_244608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013181326.1|244713_245802_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_013181327.1|245816_246647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013181328.1|246784_247291_-	thiol peroxidase	NA	NA	NA	NA	NA
WP_041941674.1|247418_248357_-	EF-P lysine aminoacylase GenX	NA	NA	NA	NA	NA
WP_013181331.1|248367_248937_-	elongation factor P	NA	NA	NA	NA	NA
WP_041941449.1|249058_249253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143876333.1|249249_249489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013181334.1|249541_250375_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_013181335.1|250335_251064_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_013181336.1|251060_254339_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_013181337.1|254338_256951_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.4	1.3e-78
WP_013181339.1|257271_258306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013181340.1|258324_258666_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_013181341.1|258667_260332_-	sulfate permease	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.2	6.8e-44
WP_013181342.1|260487_262524_+	transketolase	NA	NA	NA	NA	NA
WP_013181343.1|262524_263562_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_049767096.1|263566_264949_+	protoporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_013181345.1|265059_267675_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	34.5	9.5e-125
>prophage 2
NC_014225	Waddlia chondrophila WSU 86-1044, complete sequence	2116312	676860	686445	2116312	transposase	Pseudomonas_phage(33.33%)	10	NA	NA
WP_013181716.1|676860_677265_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_079891154.1|677240_677360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013181285.1|677408_677687_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013181286.1|677683_678445_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	26.2	2.7e-16
WP_063124745.1|678616_678937_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_143876344.1|678968_680098_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.5	1.8e-51
WP_041941491.1|680376_680745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013181720.1|681688_682189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013181723.1|684399_684957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013181107.1|685191_686445_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	47.2	9.8e-96
>prophage 3
NC_014225	Waddlia chondrophila WSU 86-1044, complete sequence	2116312	709096	759726	2116312	protease,tRNA,integrase,holin,transposase	Pseudomonas_phage(21.43%)	48	721440:721492	733990:734042
WP_013181737.1|709096_709363_-|holin	bacteriophage holin	holin	NA	NA	NA	NA
WP_013181738.1|709375_710068_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_013181739.1|710199_711270_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_013181740.1|711396_711582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013181741.1|711583_712366_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_013181742.1|712368_712926_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_013181743.1|712894_713503_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	44.0	3.5e-22
WP_013181744.1|713695_715150_+	catalase	NA	A0A2K9L572	Tupanvirus	40.2	6.1e-89
WP_013181745.1|715592_716846_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	46.5	6.4e-95
WP_013181746.1|716973_717651_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_013181286.1|718368_719130_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	26.2	2.7e-16
WP_013181641.1|719126_719405_-|transposase	transposase	transposase	NA	NA	NA	NA
721440:721492	attL	CGGAAGAGGAGGGATTCGAACCCCCGGACCCTTGCAGGTCTTCTGTTTTCAAG	NA	NA	NA	NA
WP_041941493.1|721638_722127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013181751.1|722312_723401_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_013181752.1|723725_723956_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013181753.1|724180_724771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013181754.1|724798_725089_+	HNH endonuclease	NA	G4KNP8	Staphylococcus_phage	34.7	3.1e-05
WP_143876397.1|725199_725565_+|protease	membrane protease subunit	protease	T1S9H7	Salmonella_phage	63.6	7.9e-30
WP_013181756.1|725586_726495_+	hypothetical protein	NA	H2BD70	Pseudomonas_phage	31.9	5.8e-21
WP_013181758.1|727052_728552_-	hypothetical protein	NA	A0A2H4IZT4	uncultured_Caudovirales_phage	45.7	6.2e-121
WP_041941494.1|728532_728964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049767111.1|729165_730989_-	AAA family ATPase	NA	M4QSC1	Salicola_phage	27.9	3.0e-29
WP_041941495.1|731014_731272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169302730.1|731681_732650_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_013181762.1|732738_733842_-|integrase	site-specific integrase	integrase	A0A192Y6Q1	Salmonella_phage	28.2	3.1e-21
WP_013181763.1|734236_736462_+	hypothetical protein	NA	NA	NA	NA	NA
733990:734042	attR	CGGAAGAGGAGGGATTCGAACCCCCGGACCCTTGCAGGTCTTCTGTTTTCAAG	NA	NA	NA	NA
WP_013181764.1|736429_737983_-	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_013181765.1|737998_740440_-	bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase	NA	NA	NA	NA	NA
WP_013181766.1|740448_741534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013181767.1|741555_742635_-	YjgP/YjgQ family permease	NA	NA	NA	NA	NA
WP_013181768.1|742638_743754_-	YjgP/YjgQ family permease	NA	NA	NA	NA	NA
WP_079891158.1|743834_744173_+	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_013181770.1|744173_745490_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_013181771.1|745676_748439_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5EQ50	Micromonas_sp._RCC1109_virus	43.5	1.2e-101
WP_013181772.1|748499_749591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013181773.1|749655_751752_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_013181774.1|751925_752195_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_013181775.1|752320_752566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143876398.1|752681_753146_+	nucleoside deaminase	NA	A0A2H4PQS8	Staphylococcus_phage	28.5	1.7e-05
WP_013181777.1|753123_753354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143876345.1|753380_753899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162268155.1|754077_754986_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_013181780.1|755129_755393_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_013181781.1|755413_756478_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	43.5	3.6e-06
WP_013181782.1|756474_757326_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_013181783.1|757381_758710_+	signal recognition particle protein	NA	D6PHS7	uncultured_phage	29.3	2.6e-06
WP_013181784.1|758700_759030_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_013181785.1|759039_759726_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 4
NC_014225	Waddlia chondrophila WSU 86-1044, complete sequence	2116312	1472531	1533664	2116312	tRNA,protease,transposase	Staphylococcus_phage(12.5%)	58	NA	NA
WP_063124707.1|1472531_1473488_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_013182443.1|1473668_1474658_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_013182444.1|1474667_1475057_-	single-stranded DNA-binding protein	NA	A0A1W6JP64	Staphylococcus_phage	39.5	6.9e-16
WP_013182445.1|1475167_1475494_-	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_013182446.1|1475533_1476304_-	FtsQ-type POTRA domain-containing protein	NA	NA	NA	NA	NA
WP_013182447.1|1476304_1477648_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_013182448.1|1477644_1478694_-	UDP-N-acetylglucosamine--N-acetylmuramyl- (pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase	NA	NA	NA	NA	NA
WP_079891191.1|1478686_1479793_-	cell division protein FtsW	NA	NA	NA	NA	NA
WP_013182450.1|1479798_1480497_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013182451.1|1480509_1481757_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_013182452.1|1481762_1482968_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_013182453.1|1483090_1484224_+	fatty acid desaturase	NA	F2NZ38	Diadromus_pulchellus_ascovirus	28.2	1.5e-26
WP_013182454.1|1484577_1485393_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	40.6	2.0e-49
WP_013182455.1|1485429_1486686_+	long-chain fatty acid transporter	NA	NA	NA	NA	NA
WP_013182456.1|1486766_1487621_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_013182457.1|1487666_1489262_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	50.8	9.5e-144
WP_162268160.1|1489322_1490555_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013182459.1|1490556_1491573_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_013182460.1|1491565_1492303_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.2	2.4e-17
WP_143876366.1|1492387_1493803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013182462.1|1493833_1493995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143876367.1|1494173_1495202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041941575.1|1495440_1495803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013182466.1|1496040_1497423_-	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_013182468.1|1497659_1498439_+	Mrp/NBP35 family ATP-binding protein	NA	NA	NA	NA	NA
WP_013182469.1|1498429_1500163_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	39.3	9.1e-100
WP_049767160.1|1500146_1501265_-	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	31.1	6.4e-46
WP_013182471.1|1501469_1501907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013182472.1|1501985_1502852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041941576.1|1502841_1503639_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013182474.1|1503619_1505791_-	HDIG domain-containing protein	NA	NA	NA	NA	NA
WP_143876407.1|1506019_1506991_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	36.4	1.2e-51
WP_013182477.1|1507069_1507765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013181649.1|1507767_1507983_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_013182478.1|1507889_1508240_-|transposase	transposase	transposase	A0A0U2RK18	Escherichia_phage	50.9	5.9e-06
WP_013181286.1|1508435_1509197_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	26.2	2.7e-16
WP_013181641.1|1509193_1509472_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013182479.1|1509520_1509781_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013182480.1|1509861_1510332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013182481.1|1510372_1511731_+	DNA polymerase III subunit gamma/tau	NA	D9ZNI9	Clostridium_phage	32.5	1.0e-45
WP_013182482.1|1511737_1512052_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_013182484.1|1513831_1514101_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_013182485.1|1514072_1515047_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_013182486.1|1515047_1515857_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_013182487.1|1515970_1516600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013182488.1|1516583_1518023_+	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_013182489.1|1518153_1518933_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_041941876.1|1518938_1521371_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	44.3	3.6e-78
WP_013182491.1|1521392_1522169_+	MBL fold metallo-hydrolase	NA	A8ATK9	Listeria_phage	28.0	4.3e-17
WP_013182492.1|1522263_1523412_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	30.5	9.2e-32
WP_013182494.1|1523606_1523780_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_013182495.1|1523852_1524494_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_013182496.1|1524487_1525669_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_013182497.1|1525696_1527865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013182498.1|1527940_1529434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013182499.1|1529509_1532002_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	36.6	3.5e-137
WP_013182500.1|1532004_1532523_+	adenylyltransferase/cytidyltransferase family protein	NA	Q58M46	Prochlorococcus_phage	31.5	9.0e-11
WP_013182501.1|1532500_1533664_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 5
NC_014225	Waddlia chondrophila WSU 86-1044, complete sequence	2116312	2007317	2041559	2116312	tRNA,transposase	Escherichia_phage(22.22%)	26	NA	NA
WP_013182905.1|2007317_2008529_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	39.3	2.0e-32
WP_013182906.1|2008590_2010339_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	38.4	2.3e-58
WP_013182907.1|2010352_2011429_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_013182908.1|2011428_2013189_+	PAS domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.7	2.3e-10
WP_079891195.1|2013337_2014222_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_013182910.1|2014218_2015100_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_013182911.1|2015096_2016101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041941613.1|2016110_2016329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143876412.1|2016690_2017446_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_143876377.1|2018064_2019795_+	alpha-glucan family phosphorylase	NA	NA	NA	NA	NA
WP_013182917.1|2019799_2021749_+	alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase	NA	NA	NA	NA	NA
WP_143876378.1|2021752_2024986_+	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
WP_013182919.1|2024982_2026875_+	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_013182920.1|2026849_2028061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013181718.1|2028525_2028789_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013182922.1|2028782_2029484_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_013181833.1|2029594_2030371_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	54.2	2.7e-75
WP_169302731.1|2030367_2031330_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	46.6	9.3e-70
WP_013182923.1|2031389_2031653_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	64.4	3.5e-11
WP_013182924.1|2031772_2032219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041941614.1|2032312_2032984_-	uracil-DNA glycosylase	NA	A0A0A7D9F8	Equid_alphaherpesvirus	42.2	2.3e-43
WP_013182926.1|2033148_2033400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013182927.1|2033918_2035880_-	zinc-ribbon domain-containing protein	NA	A0A1B1P7Q7	Bacillus_phage	26.8	3.2e-24
WP_013182928.1|2035884_2038518_-	zinc-ribbon domain-containing protein	NA	A0A1B1P7Q7	Bacillus_phage	34.2	4.5e-42
WP_143876379.1|2038655_2040233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143876332.1|2040377_2041559_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
