The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_009494	Legionella pneumophila str. Corby, complete sequence	3576470	1018596	1025435	3576470		Acinetobacter_phage(42.86%)	9	NA	NA
WP_011945950.1|1018596_1019373_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	48.2	1.9e-57
WP_011945951.1|1019365_1020400_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	47.0	1.8e-74
WP_011945952.1|1020377_1020956_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	53.2	1.3e-55
WP_010946572.1|1020989_1021715_-	LPS export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	3.1e-17
WP_011215024.1|1021711_1022221_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_011945954.1|1022201_1022771_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_011945955.1|1022767_1023295_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	47.7	1.4e-27
WP_010946576.1|1023308_1024271_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	34.1	4.2e-38
WP_010946577.1|1024637_1025435_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.8	1.3e-21
>prophage 2
NC_009494	Legionella pneumophila str. Corby, complete sequence	3576470	1279687	1302783	3576470	transposase,integrase	Acidithiobacillus_phage(44.44%)	26	1287730:1287752	1302785:1302807
WP_011946163.1|1279687_1280869_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	29.7	5.9e-42
WP_011946164.1|1281588_1281774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011946165.1|1282053_1282479_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011946166.1|1282572_1283076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011946167.1|1283452_1284274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041931959.1|1284455_1285967_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	42.6	1.3e-113
WP_041931960.1|1285976_1286723_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	52.5	9.7e-67
WP_011946168.1|1286799_1287423_-	hypothetical protein	NA	R9TRQ8	Vibrio_phage	25.4	3.2e-07
1287730:1287752	attL	TTAACGTGAATTCGATATAACTG	NA	NA	NA	NA
WP_013101137.1|1287854_1288730_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_011946169.1|1288726_1289215_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_011946170.1|1289409_1291164_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	30.5	2.4e-55
WP_027264490.1|1291240_1291492_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_154219819.1|1291861_1292038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011946173.1|1292188_1292635_+	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	43.8	1.2e-24
WP_011946174.1|1292638_1293208_+	PIN domain-containing protein	NA	K4HZX4	Acidithiobacillus_phage	58.5	1.6e-53
WP_011946175.1|1293624_1294860_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0R6PHM8	Moraxella_phage	34.4	1.2e-56
WP_011946176.1|1295114_1296101_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	3.5e-32
WP_011946178.1|1296357_1296684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011946179.1|1296846_1297068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148220206.1|1297064_1297472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011946181.1|1297491_1297725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011946185.1|1299923_1300175_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011946186.1|1300568_1300781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011946187.1|1300888_1301155_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_011946188.1|1301147_1301429_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_013101137.1|1301907_1302783_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
1302785:1302807	attR	CAGTTATATCGAATTCACGTTAA	NA	NA	NA	NA
>prophage 3
NC_009494	Legionella pneumophila str. Corby, complete sequence	3576470	1315248	1367903	3576470	transposase	Acidithiobacillus_phage(25.0%)	41	NA	NA
WP_013101436.1|1315248_1316370_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_179110303.1|1316884_1317340_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011946201.1|1318040_1318709_+	HAD family phosphatase	NA	A0A1D8KNV9	Synechococcus_phage	26.2	3.1e-08
WP_011946202.1|1318828_1319068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011946203.1|1319215_1319674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011946204.1|1319796_1320399_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_011946205.1|1320898_1322875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011946206.1|1323118_1323535_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_115251546.1|1323661_1324830_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.3	4.8e-60
WP_032802361.1|1325745_1326609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027264513.1|1326913_1328125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011946212.1|1328168_1329161_-	phosphotransferase	NA	NA	NA	NA	NA
WP_011946213.1|1329359_1329863_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_011946214.1|1329961_1331224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011946215.1|1331555_1332854_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_011946216.1|1333048_1333468_-	EamA family transporter	NA	NA	NA	NA	NA
WP_011946217.1|1333653_1334535_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011946218.1|1334775_1336836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013101395.1|1337128_1337263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041931959.1|1337504_1339016_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	42.6	1.3e-113
WP_041931960.1|1339025_1339772_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	52.5	9.7e-67
WP_011946220.1|1339985_1340681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011946221.1|1340774_1341413_-	Dot/Icm T4SS effector RavN	NA	NA	NA	NA	NA
WP_011946222.1|1341628_1342339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011946223.1|1342710_1345095_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011946224.1|1345103_1345376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011946225.1|1345380_1347033_-	circadian clock protein KaiC	NA	NA	NA	NA	NA
WP_011947261.1|1347183_1348359_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	22.8	1.8e-14
WP_011946227.1|1348739_1351088_+	hypothetical protein	NA	A0A2K9L6L9	Tupanvirus	56.3	1.6e-115
WP_011946228.1|1351197_1351671_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011946229.1|1351762_1352878_-	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	27.6	1.4e-21
WP_011946230.1|1353145_1354210_+	histidine-type phosphatase	NA	NA	NA	NA	NA
WP_079995362.1|1354371_1355142_+	Dot/Icm T4SS effector Ceg19	NA	NA	NA	NA	NA
WP_011946232.1|1355343_1355796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011946233.1|1356005_1357334_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_011946234.1|1357459_1358221_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011946235.1|1358456_1359047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011946236.1|1359328_1360024_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011946237.1|1360207_1363639_+	cation-transporting P-type ATPase	NA	NA	NA	NA	NA
WP_011946238.1|1363898_1365593_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_011946243.1|1366868_1367903_-|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	79.5	2.1e-160
>prophage 4
NC_009494	Legionella pneumophila str. Corby, complete sequence	3576470	1421352	1431087	3576470		Staphylococcus_phage(42.86%)	9	NA	NA
WP_011946288.1|1421352_1422681_+	sigma-54-dependent Fis family transcriptional regulator	NA	W8CYM9	Bacillus_phage	28.1	4.3e-09
WP_011213531.1|1423109_1423355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011946289.1|1423651_1425088_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011946290.1|1425150_1426224_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	28.1	2.8e-30
WP_011946291.1|1426208_1426823_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	37.9	1.0e-21
WP_011946292.1|1426819_1428028_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.5	1.6e-98
WP_010946914.1|1428035_1428503_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.1	9.2e-23
WP_010946915.1|1428628_1430266_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.3	3.6e-154
WP_010946916.1|1430262_1431087_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	43.9	1.8e-53
>prophage 5
NC_009494	Legionella pneumophila str. Corby, complete sequence	3576470	2201208	2256068	3576470	transposase,tRNA,integrase	Escherichia_phage(22.22%)	49	2237733:2237750	2264124:2264141
WP_021437098.1|2201208_2201424_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_042637163.1|2201608_2202661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011946789.1|2202901_2203405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011946790.1|2203667_2204147_+	YchJ family protein	NA	NA	NA	NA	NA
WP_011946791.1|2204166_2205972_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_072368774.1|2206013_2206928_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_011946793.1|2206924_2207875_+	membrane protein	NA	NA	NA	NA	NA
WP_011946794.1|2207874_2209863_+	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_011946795.1|2209944_2211132_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_010946556.1|2211246_2211540_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_011946798.1|2212250_2212577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011946799.1|2212841_2212991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011946800.1|2213022_2213925_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011946801.1|2213954_2214857_-	DMT family transporter	NA	NA	NA	NA	NA
WP_011946802.1|2215113_2216253_+	multidrug DMT transporter permease	NA	NA	NA	NA	NA
WP_011946803.1|2216257_2216791_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_011946804.1|2216801_2218607_-	lpg1907 family Dot/Icm T4SS effector	NA	NA	NA	NA	NA
WP_011946805.1|2218931_2219537_-	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_011946806.1|2219733_2220729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011946807.1|2220769_2222032_-	serine hydrolase	NA	A0A2K9VHZ2	Mycobacterium_phage	27.0	2.4e-17
WP_011946808.1|2222278_2223691_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011946809.1|2223789_2226522_+	response regulator	NA	A0A1V0SGX0	Hokovirus	32.6	7.7e-53
WP_011946810.1|2226619_2227864_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_011946811.1|2227860_2228274_-	pilin	NA	NA	NA	NA	NA
WP_011946812.1|2228475_2228889_-	pilin	NA	NA	NA	NA	NA
WP_011946813.1|2229191_2229509_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_011946814.1|2229583_2231005_+	amino acid permease	NA	NA	NA	NA	NA
WP_011946815.1|2231135_2232566_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_011946816.1|2232811_2233564_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_010947637.1|2233560_2233740_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_011946817.1|2233732_2234404_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_011946818.1|2234381_2236340_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.6	9.0e-88
WP_013101580.1|2236327_2236663_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_011946820.1|2236945_2239738_+	lpg1924 family Dot/Icm T4SS effector	NA	NA	NA	NA	NA
2237733:2237750	attL	ATAATCTGGAAGAAATTG	NA	NA	NA	NA
WP_011946821.1|2240053_2242702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011214178.1|2242777_2243335_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_010947644.1|2243410_2243680_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_011214179.1|2243691_2244618_+	pseudouridine-5'-phosphate glycosidase	NA	NA	NA	NA	NA
WP_148220210.1|2244803_2244875_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011946822.1|2244911_2246087_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	21.9	1.5e-13
WP_011946823.1|2246360_2246624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011946824.1|2246826_2247021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011946826.1|2247374_2248169_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	54.3	9.3e-76
WP_077383491.1|2248165_2249188_-|transposase	IS21-like element ISLpn12 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	48.0	2.0e-83
WP_011946829.1|2250353_2251163_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_011946830.1|2251262_2253008_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	33.4	1.3e-66
WP_011946831.1|2253078_2253351_-	helix-turn-helix domain-containing protein	NA	A0A0N7IRE8	Acinetobacter_phage	37.9	8.6e-05
WP_011946832.1|2254038_2254674_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_011946833.1|2254826_2256068_-|integrase	integrase family protein	integrase	A0A0P0IKP2	Acinetobacter_phage	32.3	7.6e-48
2264124:2264141	attR	CAATTTCTTCCAGATTAT	NA	NA	NA	NA
>prophage 6
NC_009494	Legionella pneumophila str. Corby, complete sequence	3576470	2372669	2382792	3576470		Bacillus_phage(16.67%)	7	NA	NA
WP_011946921.1|2372669_2374358_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.4	8.0e-16
WP_011946922.1|2374489_2375497_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011946923.1|2375620_2376946_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	31.2	1.8e-47
WP_011214269.1|2376964_2378113_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	7.6e-127
WP_011946924.1|2378321_2379434_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.2	5.0e-51
WP_010947740.1|2379529_2380669_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.9	1.6e-23
WP_011946925.1|2380857_2382792_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.6	1.3e-147
