The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_014136	Leuconostoc kimchii IMSNU 11154, complete sequence	2002721	22274	60008	2002721	transposase,holin,protease,integrase	Pectobacterium_phage(14.29%)	34	40844:40875	43695:43726
WP_013102175.1|22274_24173_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A1L2CUT6	Pectobacterium_phage	31.9	2.9e-59
WP_013102176.1|24169_24652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013102177.1|24665_26933_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_013102178.1|26919_27186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010006596.1|27642_28011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013102179.1|28014_28359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013102180.1|28369_28741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013102181.1|28727_28940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013102182.1|29315_29537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002814575.1|29536_29980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013102183.1|29972_30185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013102184.1|30195_30414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013102185.1|30860_31091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013102186.1|31071_31395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013102188.1|31800_32055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013102189.1|32051_32420_-	hypothetical protein	NA	E3W8I0	Leuconostoc_phage	40.4	4.7e-14
WP_013102190.1|32412_33735_-	Y-family DNA polymerase	NA	Q6DMX4	Streptococcus_phage	39.3	9.1e-84
WP_013102191.1|33956_34061_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_176608530.1|34358_36431_-|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_013102192.1|36483_39012_-	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_148215504.1|39094_41308_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
40844:40875	attL	AATTATTACTTCCGTGAAGCAATAACCTGGTC	NA	NA	NA	NA
WP_013102194.1|41300_42383_+|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	39.4	4.7e-62
WP_013102195.1|42439_45991_-	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
43695:43726	attR	GACCAGGTTATTGCTTCACGGAAGTAATAATT	NA	NA	NA	NA
WP_013102196.1|46052_49637_-	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_013102197.1|49654_50233_-	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_013102198.1|50236_50836_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_083774968.1|51302_51872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041773482.1|52107_52743_+	DUF4230 domain-containing protein	NA	NA	NA	NA	NA
WP_003643772.1|53716_55048_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013102204.1|55125_56097_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	2.3e-23
WP_002814535.1|56097_57624_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_011679766.1|57861_58308_+	ribonuclease H	NA	NA	NA	NA	NA
WP_041773551.1|59012_59720_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.7	1.2e-26
WP_004912700.1|59765_60008_-|transposase	transposase	transposase	Q6J1X3	Lactobacillus_phage	36.1	4.0e-06
>prophage 2
NC_014136	Leuconostoc kimchii IMSNU 11154, complete sequence	2002721	285068	383727	2002721	portal,integrase,capsid,terminase,head,protease,tRNA,tail	Lactobacillus_phage(25.58%)	103	303154:303176	383849:383871
WP_013102440.1|285068_286784_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_013102441.1|286857_288111_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_013102442.1|288116_288911_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_013102443.1|288914_289691_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.3	2.9e-21
WP_013102444.1|289802_291608_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	36.0	7.8e-86
WP_013102445.1|291812_293468_+	adenine deaminase	NA	NA	NA	NA	NA
WP_013102446.1|293470_293983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013102447.1|294033_296442_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	47.0	2.7e-81
WP_013102448.1|296717_297230_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_013102449.1|297226_298393_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_013102450.1|298582_299533_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_013102451.1|299525_300551_+	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_013102452.1|300553_301609_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_013102453.1|301628_302984_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
303154:303176	attL	GGGCGAATTATCGCGGTACCACC	NA	NA	NA	NA
WP_013102455.1|303484_304048_-	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	35.4	8.5e-15
WP_013102456.1|304044_305340_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.7	2.0e-19
WP_013102457.1|305581_306799_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_013102458.1|306968_307772_-	esterase family protein	NA	NA	NA	NA	NA
WP_013102459.1|307817_309482_-	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_013102460.1|309575_310820_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_013102461.1|310989_311451_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_013102462.1|311516_313043_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.9	1.2e-68
WP_013102463.1|313039_313630_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.0	6.6e-26
WP_013102464.1|313623_314661_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FZ01	Synechococcus_phage	41.7	6.1e-59
WP_013102465.1|314657_316268_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.3	3.1e-49
WP_013102466.1|316249_318472_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.7	7.0e-137
WP_013102467.1|318515_319184_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_013102468.1|319180_319447_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_013102469.1|319458_320202_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	38.2	1.1e-38
WP_013102470.1|320167_321304_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_013102471.1|321300_321786_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	45.6	6.2e-22
WP_013102472.1|322090_323566_-	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_013102473.1|324142_324535_-	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_049762265.1|324610_325183_-	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_013102475.1|325232_327410_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_013102476.1|327433_328048_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	32.7	1.9e-20
WP_013102477.1|328177_328573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013102478.1|328633_329371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013102479.1|329483_330320_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013102480.1|330461_330773_+	helix-turn-helix transcriptional regulator	NA	A8ASM2	Listeria_phage	46.2	9.5e-08
WP_013102481.1|331134_331314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013102482.1|331493_332153_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_013102483.1|332301_332607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013102484.1|332619_333711_-	lysozyme M1 (1,4-beta-N-acetylmuramidase)	NA	E3W8H6	Leuconostoc_phage	81.8	9.6e-172
WP_013102485.1|333736_334036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013102486.1|334022_334424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013102487.1|334433_336884_-	hypothetical protein	NA	Q6SEC0	Lactobacillus_prophage	43.3	3.4e-07
WP_013102488.1|336892_337873_-	hypothetical protein	NA	A0A060AGT0	Cronobacter_phage	26.4	1.3e-05
WP_083774971.1|337894_339019_-|tail	phage tail protein	tail	A0A0M7RDS2	Lactobacillus_phage	41.8	3.0e-67
WP_013102490.1|339026_339779_-|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	28.8	4.2e-17
WP_013102491.1|339875_345509_-|tail	phage tail tape measure protein	tail	Q8LTK2	Lactococcus_phage	39.8	5.1e-184
WP_013102493.1|345718_346129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013102494.1|346206_346848_-|tail	phage tail protein	tail	A0A286QNY3	Streptococcus_phage	34.0	6.7e-24
WP_013102495.1|346851_347226_-	DUF806 family protein	NA	NA	NA	NA	NA
WP_013102496.1|347225_347639_-	HK97 gp10 family phage protein	NA	A8YQJ5	Lactobacillus_phage	41.8	8.4e-20
WP_013102497.1|347628_348000_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_013102498.1|347992_348319_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6J1Y1	Lactobacillus_phage	53.3	7.1e-22
WP_013102499.1|348329_349493_-|capsid	phage major capsid protein	capsid	Q6J1Y2	Lactobacillus_phage	64.9	2.0e-135
WP_013102500.1|349506_350196_-|protease	Clp protease ClpP	protease	Q6J1Y3	Lactobacillus_phage	51.8	5.8e-58
WP_013102501.1|350192_351335_-|portal	phage portal protein	portal	Q6J1Y4	Lactobacillus_phage	50.4	9.0e-96
WP_013102502.1|351338_351527_-	DUF1056 family protein	NA	NA	NA	NA	NA
WP_013102503.1|351523_353407_-|terminase	terminase large subunit	terminase	A8YQI8	Lactobacillus_phage	63.6	8.6e-237
WP_041773569.1|353390_353912_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_013102506.1|354480_355014_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_013102507.1|355020_355524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013102508.1|355529_355790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013102509.1|355804_356140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013102510.1|356142_356340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013102511.1|356824_357244_-	DUF722 domain-containing protein	NA	A0A097BYG4	Leuconostoc_phage	36.5	1.6e-13
WP_013102513.1|357343_357556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013102514.1|357552_357825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187286361.1|357827_357980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013102517.1|358047_358359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013102518.1|358342_358564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013102519.1|358572_359637_-|integrase	site-specific integrase	integrase	B4XYR4	Lactobacillus_phage	28.3	4.1e-18
WP_013102520.1|359617_360280_-	SAM-dependent DNA methyltransferase	NA	A0A097BYG1	Leuconostoc_phage	48.4	2.2e-54
WP_013102522.1|360533_360932_-	dTDP-glucose pyrophosphorylase	NA	A0A0P0IJF8	Lactobacillus_phage	54.3	6.4e-25
WP_013102523.1|361073_361247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013102524.1|361233_361923_-	hypothetical protein	NA	A0A097BYG8	Leuconostoc_phage	80.2	1.1e-104
WP_013102525.1|362046_362688_-	ERF family protein	NA	A0A2H4J439	uncultured_Caudovirales_phage	33.6	1.7e-06
WP_013102526.1|362687_363584_-	DUF1351 domain-containing protein	NA	NA	NA	NA	NA
WP_013102527.1|363597_363783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013102528.1|363877_364027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013102529.1|364023_364797_-	ATP-binding protein	NA	E9LUM7	Lactobacillus_phage	39.3	6.0e-35
WP_013102530.1|364800_365592_-	conserved phage C-terminal domain-containing protein	NA	D7RWG1	Brochothrix_phage	67.9	1.0e-82
WP_013102531.1|365594_365801_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013102532.1|365897_366446_+	hypothetical protein	NA	C9E2Q0	Enterococcus_phage	30.2	4.5e-13
WP_013102534.1|366552_366726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013102535.1|366736_366997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013102536.1|367053_367797_-	phage antirepressor KilAC domain-containing protein	NA	E3W8C2	Leuconostoc_phage	84.6	6.0e-109
WP_013102537.1|367887_368148_+	hypothetical protein	NA	E9LUL8	Lactobacillus_phage	46.8	3.7e-05
WP_013102538.1|368239_368476_-	DUF739 family protein	NA	NA	NA	NA	NA
WP_013102539.1|368645_369338_+	LexA family transcriptional regulator	NA	A0A097BY95	Leuconostoc_phage	52.8	2.6e-58
WP_013102541.1|370549_371620_+|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	28.3	5.9e-33
WP_013102542.1|371684_373232_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.7	2.0e-13
WP_013102543.1|373285_374266_-	IMP dehydrogenase	NA	NA	NA	NA	NA
WP_013102544.1|374289_375462_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.0	7.9e-39
WP_013102545.1|375893_376787_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_013102546.1|376786_377335_-	LemA family protein	NA	NA	NA	NA	NA
WP_013102547.1|377409_378327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013102548.1|378330_379182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013102549.1|379302_381249_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_013102550.1|381315_383727_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	65.6	0.0e+00
383849:383871	attR	GGGCGAATTATCGCGGTACCACC	NA	NA	NA	NA
>prophage 4
NC_014136	Leuconostoc kimchii IMSNU 11154, complete sequence	2002721	748641	759898	2002721	portal,integrase,capsid,terminase,head,protease,tail	Lactococcus_phage(36.36%)	15	741562:741576	762659:762673
741562:741576	attL	AACAAAATGAAGATG	NA	NA	NA	NA
WP_013102921.1|748641_749898_+	virulence protein E	NA	A0A2P0ZLC4	Lactobacillus_phage	46.1	1.2e-88
WP_013102922.1|750168_750360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013102923.1|750363_750777_+	DUF722 domain-containing protein	NA	NA	NA	NA	NA
WP_013102924.1|750852_751353_+	HNH endonuclease	NA	Q9AZM8	Lactococcus_phage	60.8	2.8e-54
WP_013102925.1|751669_752146_+|terminase	phage terminase small subunit P27 family	terminase	A0A0M7REI3	Lactobacillus_phage	37.6	3.3e-20
WP_013102926.1|752142_753978_+|terminase	terminase large subunit	terminase	Q9AZM6	Lactococcus_phage	60.0	5.1e-210
WP_013102927.1|753990_754155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013102928.1|754151_755225_+|portal	phage portal protein	portal	Q9AZM4	Lactococcus_phage	54.1	1.2e-105
WP_013102929.1|755221_755791_+|head,protease	HK97 family phage prohead protease	head,protease	Q9AZM3	Lactococcus_phage	54.7	8.0e-45
WP_013102930.1|755802_756945_+|capsid	phage major capsid protein	capsid	A0A2H4J7D0	uncultured_Caudovirales_phage	40.2	9.7e-50
WP_013102931.1|757000_757300_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_013102932.1|757292_757637_+|head	phage head closure protein	head	Q6J1Y0	Lactobacillus_phage	33.9	5.6e-09
WP_013102933.1|757651_757840_+	hypothetical protein	NA	A0A097BYD9	Leuconostoc_phage	79.3	2.4e-22
WP_013102934.1|757948_759076_+|integrase	site-specific integrase	integrase	A0A097BYJ7	Leuconostoc_phage	82.4	3.4e-180
WP_013102935.1|759238_759898_-	GIY-YIG nuclease family protein	NA	A0A097BYI4	Leuconostoc_phage	81.7	3.0e-104
762659:762673	attR	AACAAAATGAAGATG	NA	NA	NA	NA
>prophage 5
NC_014136	Leuconostoc kimchii IMSNU 11154, complete sequence	2002721	1356651	1364659	2002721		Streptococcus_phage(66.67%)	10	NA	NA
WP_013103516.1|1356651_1357296_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	50.0	3.8e-51
WP_013103517.1|1357301_1357631_+	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_013103518.1|1357630_1358557_+	DNA polymerase III subunit delta	NA	M1NSC1	Streptococcus_phage	33.3	5.0e-12
WP_013103519.1|1358559_1359441_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	56.2	5.3e-80
WP_013103520.1|1359492_1360230_+	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_013103521.1|1360270_1361263_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	37.1	3.4e-51
WP_013103522.1|1361653_1362277_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_013103523.1|1362358_1363120_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_013103524.1|1363190_1363832_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	46.2	1.1e-50
WP_013103525.1|1363891_1364659_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	30.9	7.5e-22
>prophage 6
NC_014136	Leuconostoc kimchii IMSNU 11154, complete sequence	2002721	1863052	1918682	2002721	portal,integrase,capsid,terminase,tRNA,tail	Leuconostoc_phage(23.81%)	75	1878994:1879010	1919985:1920001
WP_013104004.1|1863052_1864177_+|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
WP_004899901.1|1864287_1864473_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_013104005.1|1864555_1865002_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	37.7	1.8e-15
WP_013104006.1|1865094_1865961_+	S1 RNA-binding protein	NA	NA	NA	NA	NA
WP_013104007.1|1865960_1866857_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	34.9	2.1e-44
WP_013104008.1|1866896_1867265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013104009.1|1867231_1868008_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	32.8	1.5e-09
WP_013104010.1|1868000_1868603_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.3	1.8e-15
WP_013104011.1|1868595_1869345_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_013104012.1|1869593_1870181_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_013104013.1|1870257_1870815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013104014.1|1870828_1871506_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_013104015.1|1871601_1872789_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_013104016.1|1872892_1874206_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_010385704.1|1874399_1874675_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	69.7	1.8e-26
WP_013104017.1|1874942_1876208_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_013104019.1|1876311_1877523_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	51.2	2.5e-43
WP_013104020.1|1877509_1878025_+	dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	36.4	1.1e-21
WP_013104021.1|1878017_1878869_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	42.5	1.7e-14
1878994:1879010	attL	CTGCCCAGGATAAAAAA	NA	NA	NA	NA
WP_013104022.1|1879048_1880104_-|integrase	site-specific integrase	integrase	E3W8I1	Leuconostoc_phage	38.1	9.0e-50
WP_013104023.1|1880367_1881078_-	DUF4352 domain-containing protein	NA	O21991	Streptococcus_virus	44.4	2.1e-10
WP_013104024.1|1881124_1881403_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_013104025.1|1881415_1881754_-	helix-turn-helix transcriptional regulator	NA	R4IDX0	Listeria_phage	44.0	9.3e-17
WP_013104026.1|1882018_1882243_+	hypothetical protein	NA	E3W8C0	Leuconostoc_phage	90.5	3.7e-30
WP_013104027.1|1882255_1882960_+	ORF6C domain-containing protein	NA	A0A1S5SEX2	Streptococcus_phage	40.8	1.8e-38
WP_013104029.1|1883171_1883399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013104030.1|1883525_1884326_+	ORF6C domain-containing protein	NA	A0A0M5M1L9	Bacillus_phage	38.5	1.0e-45
WP_148215511.1|1884348_1884582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013104032.1|1884591_1884807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013104033.1|1884818_1884992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013104034.1|1884996_1885158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013104035.1|1885138_1885552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013104036.1|1885714_1885921_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IJY1	Lactobacillus_phage	46.0	6.5e-05
WP_013104037.1|1885923_1886733_+	conserved phage C-terminal domain-containing protein	NA	A0A0K0MX39	Streptococcus_phage	54.3	8.9e-66
WP_013104038.1|1886736_1887510_+	ATP-binding protein	NA	E9LUM7	Lactobacillus_phage	38.8	1.7e-34
WP_013104039.1|1887506_1887656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013104040.1|1887750_1887987_+	hypothetical protein	NA	A0A097BYE5	Leuconostoc_phage	55.8	1.2e-15
WP_013104041.1|1887987_1888389_+	hypothetical protein	NA	A0A097BYE9	Leuconostoc_phage	78.9	6.0e-55
WP_013104042.1|1888416_1889046_+	ERF family protein	NA	A0A1P8BKZ7	Lactococcus_phage	45.8	2.4e-18
WP_013104043.1|1889168_1889870_+	hypothetical protein	NA	E3W8D3	Leuconostoc_phage	63.1	4.4e-85
WP_013104044.1|1889872_1890304_+	RusA family crossover junction endodeoxyribonuclease	NA	D7RWN7	Brochothrix_phage	39.1	1.5e-19
WP_013104045.1|1890313_1890571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013104046.1|1890570_1891233_+	SAM-dependent DNA methyltransferase	NA	A0A097BYG1	Leuconostoc_phage	48.8	4.9e-54
WP_148215509.1|1891518_1891725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187286359.1|1891729_1891879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013104049.1|1891882_1892299_+	DUF722 domain-containing protein	NA	A0A097BYG4	Leuconostoc_phage	28.6	1.1e-06
WP_013104050.1|1892560_1893148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013104051.1|1893480_1893618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013104052.1|1893649_1894507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013104053.1|1894490_1894991_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_013104054.1|1895187_1895358_+	hypothetical protein	NA	A0A097BYC4	Leuconostoc_phage	78.6	1.6e-17
WP_013104055.1|1895357_1896575_+	hypothetical protein	NA	A0A097BYC5	Leuconostoc_phage	85.0	1.4e-203
WP_013104056.1|1896584_1896881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013104057.1|1896877_1897393_+|terminase	terminase small subunit	terminase	A0A097BYC9	Leuconostoc_phage	68.5	1.6e-44
WP_013104058.1|1897367_1898666_+|terminase	PBSX family phage terminase large subunit	terminase	A8ASJ2	Listeria_phage	54.0	1.6e-128
WP_013104059.1|1898725_1900240_+|portal	phage portal protein	portal	O03928	Lactobacillus_phage	48.3	2.8e-121
WP_013104060.1|1900236_1901376_+|capsid	phage capsid protein	capsid	O03929	Lactobacillus_phage	54.9	7.8e-92
WP_013104061.1|1901463_1902093_+	phage scaffolding protein	NA	Q9T1B8	Listeria_phage	43.8	6.8e-29
WP_013104062.1|1902096_1903056_+|capsid	N4-gp56 family major capsid protein	capsid	A8ASJ6	Listeria_phage	53.6	2.5e-75
WP_013104063.1|1903072_1903498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041773540.1|1903475_1903844_+|capsid	phage capsid protein	capsid	O03932	Lactobacillus_phage	54.4	2.4e-26
WP_013104065.1|1903843_1904203_+	hypothetical protein	NA	O03933	Lactobacillus_phage	43.9	6.0e-14
WP_013104066.1|1904202_1904598_+|capsid	phage capsid protein	capsid	NA	NA	NA	NA
WP_013104067.1|1904601_1905078_+	hypothetical protein	NA	O03972	Lactobacillus_phage	59.0	4.0e-42
WP_013104068.1|1905157_1905571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013104069.1|1905570_1906197_+	hypothetical protein	NA	U3PFU8	Lactobacillus_phage	32.4	7.3e-15
WP_187286383.1|1907225_1911353_+	C40 family peptidase	NA	A0A2P0VJB7	Streptococcus_phage	36.1	3.7e-83
WP_013104071.1|1911342_1912182_+|tail	phage tail family protein	tail	D2KRB8	Lactobacillus_phage	42.8	3.3e-55
WP_013104072.1|1912181_1913291_+|tail	phage tail protein	tail	O03938	Lactobacillus_phage	33.7	1.8e-48
WP_013104073.1|1913293_1914259_+	hypothetical protein	NA	A0A060AGT0	Cronobacter_phage	29.2	2.8e-05
WP_013104074.1|1914267_1916718_+	hypothetical protein	NA	Q6SEC0	Lactobacillus_prophage	42.4	2.2e-06
WP_013104075.1|1916727_1917129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013104076.1|1917115_1917415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013104077.1|1917438_1917777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013104078.1|1917779_1918682_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MY35	Enterococcus_phage	71.0	1.4e-67
1919985:1920001	attR	CTGCCCAGGATAAAAAA	NA	NA	NA	NA
>prophage 1
NC_014131	Leuconostoc kimchii IMSNU 11154 plasmid LkipL4701, complete sequence	21055	0	4313	21055	transposase	uncultured_virus(25.0%)	6	NA	NA
WP_012304814.1|977_1634_+	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_012304815.1|1673_1994_+	thiol reductase thioredoxin	NA	A0A218MMB7	uncultured_virus	30.1	3.5e-05
WP_013102081.1|2118_2499_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_013102082.1|2503_3058_+	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	42.9	8.3e-31
WP_167524327.1|3218_4025_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	3.8e-32
WP_012304818.1|4070_4313_-|transposase	transposase	transposase	Q6J1X3	Lactobacillus_phage	37.3	1.8e-06
>prophage 2
NC_014131	Leuconostoc kimchii IMSNU 11154 plasmid LkipL4701, complete sequence	21055	8526	19703	21055	holin	Erysipelothrix_phage(60.0%)	8	NA	NA
WP_013102087.1|8526_11721_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2B9	Erysipelothrix_phage	42.2	7.8e-222
WP_013102088.1|11721_12279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013102089.1|12282_14142_+	site-specific DNA-methyltransferase	NA	A0A2K5B255	Erysipelothrix_phage	32.9	1.9e-79
WP_013102090.1|14176_17293_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	34.2	8.9e-130
WP_080514236.1|17725_17863_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_013102092.1|18103_18415_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	35.7	6.1e-15
WP_012304810.1|18439_18766_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_012304811.1|18773_19703_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	48.1	2.8e-79
