The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017297	Clostridium botulinum F str. 230613, complete genome	3993083	1733058	1741270	3993083		uncultured_phage(33.33%)	7	NA	NA
WP_012099656.1|1733058_1734003_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	31.6	1.4e-14
WP_012099657.1|1734626_1735622_+	2-hydroxyglutaryl-CoA dehydratase	NA	NA	NA	NA	NA
WP_011949100.1|1736518_1736950_+	6-carboxytetrahydropterin synthase QueD	NA	A0A1U9WRB3	Streptococcus_virus	32.4	4.0e-12
WP_012099659.1|1736951_1737617_+	putative 7-carboxy-7-deazaguanine synthase QueE	NA	S4TZT1	uncultured_phage	44.1	1.0e-38
WP_012099660.1|1737620_1738211_+	GTP cyclohydrolase I FolE	NA	S4U0J3	uncultured_phage	52.8	5.4e-44
WP_012099661.1|1738394_1739054_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	51.2	1.3e-59
WP_012099663.1|1740313_1741270_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	7.7e-16
>prophage 2
NC_017297	Clostridium botulinum F str. 230613, complete genome	3993083	1966595	2055534	3993083	portal,tail,terminase,capsid,integrase,head,protease	Clostridium_phage(51.43%)	80	2010013:2010030	2067214:2067231
WP_079991858.1|1966595_1967054_-|protease	hydrogenase maturation protease	protease	NA	NA	NA	NA
WP_012099821.1|1968562_1969435_-	hydrogenase small subunit	NA	NA	NA	NA	NA
WP_012099822.1|1969702_1970404_+	conjugal transfer protein TraX	NA	NA	NA	NA	NA
WP_012099823.1|1971666_1974873_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_012099824.1|1974900_1975950_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.6	5.2e-58
WP_003493683.1|1976466_1976634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012099827.1|1980084_1980810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014519279.1|1981209_1981794_-	DUF4263 domain-containing protein	NA	NA	NA	NA	NA
WP_012099830.1|1982967_1984074_+	hypothetical protein	NA	A0A2H4J496	uncultured_Caudovirales_phage	38.3	6.8e-16
WP_012099831.1|1984199_1985756_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.7e-52
WP_012099832.1|1986117_1987851_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_012099833.1|1987870_1989766_-	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_012099834.1|1989777_1990257_-	NADH-quinone oxidoreductase subunit NuoE	NA	NA	NA	NA	NA
WP_012099835.1|1990744_1991932_-	potassium transporter	NA	NA	NA	NA	NA
WP_012099836.1|1992190_1993069_-	ADP-ribosylglycohydrolase family protein	NA	G3M9X5	Bacillus_virus	39.5	5.2e-51
WP_003405456.1|1993310_1994405_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_012099837.1|1994517_1995654_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	30.8	8.5e-22
WP_012099838.1|1995837_1996350_+	DUF2953 domain-containing protein	NA	NA	NA	NA	NA
WP_003402816.1|1997492_1998239_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.8	3.0e-07
WP_012099839.1|1998213_1998804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099842.1|2001252_2002311_-	endonuclease	NA	NA	NA	NA	NA
WP_003402834.1|2002452_2002701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099843.1|2002807_2004112_-	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	56.1	3.5e-128
WP_012099844.1|2004397_2005213_-	purine-nucleoside phosphorylase	NA	Q5YFI9	Singapore_grouper_iridovirus	41.9	6.7e-61
WP_012099845.1|2005250_2006126_-	site-specific tyrosine recombinase XerD	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	26.5	3.0e-14
WP_003359007.1|2006177_2006405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099846.1|2006395_2007049_-	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_003362492.1|2007255_2007792_-	NUDIX hydrolase	NA	NA	NA	NA	NA
2010013:2010030	attL	TTTAGTTATAGTATGTAT	NA	NA	NA	NA
WP_012099849.1|2012517_2013096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099851.1|2014511_2015099_-	DUF4352 domain-containing protein	NA	A0A0A7RUM7	Clostridium_phage	32.8	2.5e-09
WP_012099852.1|2015227_2015986_-	SH3 domain-containing protein	NA	I1TJX3	Clostridium_phage	58.7	3.4e-51
WP_012099855.1|2016636_2016831_-	hypothetical protein	NA	A0A0A7RU02	Clostridium_phage	98.4	2.3e-28
WP_012099856.1|2017225_2017393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099857.1|2017433_2017649_-	hypothetical protein	NA	A0A2H4JGH3	uncultured_Caudovirales_phage	69.6	7.0e-10
WP_012099858.1|2017650_2018010_-	hypothetical protein	NA	A0A2H4J342	uncultured_Caudovirales_phage	54.3	4.3e-20
WP_012099859.1|2018025_2018613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099860.1|2018630_2019092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099861.1|2019088_2019910_-	hypothetical protein	NA	E2ELJ8	Clostridium_phage	56.1	5.7e-52
WP_012099862.1|2019916_2021074_-	hypothetical protein	NA	A0A0C5AMZ5	Paenibacillus_phage	36.4	6.3e-65
WP_012099863.1|2021077_2021947_-|tail	phage tail family protein	tail	E2ELJ6	Clostridium_phage	42.7	3.7e-49
WP_012099864.1|2021962_2025463_-|tail	phage tail tape measure protein	tail	A0A0A7RVT5	Clostridium_phage	51.5	7.1e-67
WP_012099866.1|2025479_2025659_-	hypothetical protein	NA	A0A0A7RUE3	Clostridium_phage	76.3	2.1e-20
WP_012099867.1|2025718_2026063_-	hypothetical protein	NA	A0A0A7RUF5	Clostridium_phage	69.7	2.8e-37
WP_014519284.1|2026124_2026727_-|tail	tail protein	tail	A0A0A7RUI3	Clostridium_phage	71.1	7.8e-75
WP_012099869.1|2026794_2027151_-	hypothetical protein	NA	A0A0A7S158	Clostridium_phage	83.6	7.9e-51
WP_012099870.1|2027161_2027521_-	hypothetical protein	NA	A0A0A7RUF1	Clostridium_phage	60.5	8.9e-34
WP_012099871.1|2027520_2027889_-|head	phage head closure protein	head	A0A0A7RUH8	Clostridium_phage	66.7	3.0e-37
WP_012099872.1|2027878_2028172_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0A7RWM0	Clostridium_phage	42.4	1.9e-13
WP_012099873.1|2028256_2029489_-|capsid	phage major capsid protein	capsid	Q0SPK4	Clostridium_phage	49.5	3.1e-94
WP_012099874.1|2029540_2030284_-|protease	Clp protease ClpP	protease	A0A0A7RUD3	Clostridium_phage	75.9	8.1e-98
WP_014519285.1|2030276_2031527_-|portal	phage portal protein	portal	A0A0A7RUE7	Clostridium_phage	79.9	2.4e-187
WP_012099876.1|2031570_2031753_-	hypothetical protein	NA	A0A0A7RUH2	Clostridium_phage	70.4	2.2e-12
WP_012099877.1|2031776_2033534_-|terminase	terminase large subunit	terminase	A6M948	Geobacillus_virus	43.2	3.1e-119
WP_012099878.1|2033534_2034020_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	41.4	1.5e-20
WP_012099879.1|2034167_2034635_-	HNH endonuclease	NA	Q0SPJ9	Clostridium_phage	44.7	1.7e-24
WP_012099880.1|2034727_2036521_-	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_012099881.1|2036507_2036759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099883.1|2037353_2037551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099884.1|2037580_2037826_-	hypothetical protein	NA	A0A2H4J8H2	uncultured_Caudovirales_phage	45.7	2.3e-09
WP_012099885.1|2037950_2038133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099886.1|2038183_2038396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099887.1|2038480_2038792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099888.1|2038821_2039010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099889.1|2039010_2039265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099890.1|2039339_2039894_-	nuclease	NA	NA	NA	NA	NA
WP_012099891.1|2040141_2040588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099892.1|2040638_2041316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099895.1|2045233_2046370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099896.1|2046415_2047357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099897.1|2047402_2048155_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_012099898.1|2048235_2048655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099900.1|2049326_2049992_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012099904.1|2050854_2051184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099905.1|2051334_2051664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099906.1|2051951_2052437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012099907.1|2052527_2052890_-	hypothetical protein	NA	A0A109QIR8	Bacillus_phage	61.9	4.9e-32
WP_012099908.1|2052915_2053596_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_012099909.1|2053592_2053778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099910.1|2054041_2054542_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012099911.1|2054541_2055534_-|integrase	tyrosine-type recombinase/integrase	integrase	Q4ZE80	Staphylococcus_phage	22.0	2.7e-08
2067214:2067231	attR	TTTAGTTATAGTATGTAT	NA	NA	NA	NA
>prophage 3
NC_017297	Clostridium botulinum F str. 230613, complete genome	3993083	2528453	2588159	3993083	tail,terminase,protease,portal	Clostridium_phage(63.04%)	68	NA	NA
WP_012100293.1|2528453_2528696_+	helix-turn-helix transcriptional regulator	NA	A0A0A7RUJ5	Clostridium_phage	50.0	1.2e-13
WP_012100295.1|2529113_2529515_-	resolvase	NA	A0A2H4J078	uncultured_Caudovirales_phage	51.6	9.3e-24
WP_012100296.1|2529559_2529805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100297.1|2529810_2530002_-	hypothetical protein	NA	A0A0A7RTH9	Clostridium_phage	82.5	1.2e-16
WP_012100298.1|2530430_2531198_-	SH3 domain-containing protein	NA	A0A2H4J8A3	uncultured_Caudovirales_phage	64.3	8.7e-87
WP_041173229.1|2531242_2531437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100300.1|2531474_2531729_-	membrane protein	NA	NA	NA	NA	NA
WP_012100301.1|2531749_2532505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100302.1|2532666_2532849_-	hypothetical protein	NA	A0A0K2SUB6	Clostridium_phage	69.1	2.0e-13
WP_012100303.1|2532850_2533192_-	hypothetical protein	NA	A0A2H4J342	uncultured_Caudovirales_phage	64.0	9.3e-33
WP_012100304.1|2533203_2534385_-|tail	phage tail protein	tail	A0A2H4J039	uncultured_Caudovirales_phage	61.0	8.2e-68
WP_012100307.1|2536092_2536500_-	DUF2634 domain-containing protein	NA	A0A0A7RTH1	Clostridium_phage	76.9	7.0e-51
WP_014519348.1|2536502_2536814_-	DUF2577 domain-containing protein	NA	A0A0A7RTJ2	Clostridium_phage	68.9	1.6e-31
WP_012100309.1|2536850_2537825_-	hypothetical protein	NA	A0A0A7RTZ4	Clostridium_phage	84.0	1.1e-155
WP_012100311.1|2537840_2538518_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7RVP5	Clostridium_phage	76.8	1.7e-94
WP_012100312.1|2538517_2540677_-	hypothetical protein	NA	A0A0A7S091	Clostridium_phage	46.8	7.0e-134
WP_012100313.1|2540734_2541496_-	SHOCT domain-containing protein	NA	X5JB37	Clostridium_phage	42.4	2.2e-42
WP_012100314.1|2541732_2542146_-	hypothetical protein	NA	A0A0A7RTN3	Clostridium_phage	76.3	1.4e-54
WP_012100315.1|2542163_2542628_-|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	74.7	7.6e-62
WP_012100316.1|2542631_2543942_-	hypothetical protein	NA	A0A0A7S087	Clostridium_phage	84.6	1.0e-212
WP_079992187.1|2544103_2544577_-	hypothetical protein	NA	A0A0A7RTI2	Clostridium_phage	75.4	4.7e-51
WP_012100320.1|2544721_2545213_-	HK97 gp10 family phage protein	NA	A0A0A7RTT0	Clostridium_phage	76.5	3.3e-63
WP_012100321.1|2545212_2545596_-	hypothetical protein	NA	A0A0A7S083	Clostridium_phage	82.7	6.3e-54
WP_012100322.1|2545597_2545942_-	hypothetical protein	NA	A0A0A7RTX9	Clostridium_phage	77.2	5.3e-44
WP_012100323.1|2545955_2546921_-	hypothetical protein	NA	A0A0A7RVZ1	Clostridium_phage	77.9	2.4e-142
WP_012100324.1|2546940_2547546_-	scaffold protein	NA	A0A0A7RW68	Clostridium_phage	40.8	4.2e-20
WP_012100325.1|2547566_2547830_-	hypothetical protein	NA	A0A0K2FMK5	Brevibacillus_phage	54.8	8.2e-21
WP_012100326.1|2547846_2548215_-	hypothetical protein	NA	A0A2H4J4N9	uncultured_Caudovirales_phage	63.9	8.2e-35
WP_012100327.1|2548245_2548440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100328.1|2548456_2549488_-	primosomal protein	NA	A0A0A7RVY7	Clostridium_phage	76.7	8.2e-149
WP_012100329.1|2549468_2550920_-|portal	phage portal protein	portal	A0A0A7S074	Clostridium_phage	87.9	6.2e-235
WP_012100330.1|2550932_2552342_-|terminase	phage terminase large subunit	terminase	A0A0A7RTS1	Clostridium_phage	87.4	1.4e-212
WP_012100331.1|2552334_2552922_-|terminase	terminase small subunit	terminase	A0A0A0RSW5	Bacillus_phage	40.2	7.2e-25
WP_012100332.1|2553144_2553696_-	hypothetical protein	NA	S5MNT8	Brevibacillus_phage	29.9	2.1e-13
WP_012100333.1|2553682_2554060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100334.1|2554068_2555433_-	DEAD/DEAH box helicase	NA	A0A1S7FYY5	Listeria_phage	62.0	3.3e-161
WP_012100336.1|2555595_2555877_-	VRR-NUC domain-containing protein	NA	A0A0A7RTE1	Clostridium_phage	78.3	1.2e-20
WP_154018630.1|2556031_2556184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100338.1|2556137_2558561_-	virulence-associated protein E	NA	A0A0A7RTG3	Clostridium_phage	88.2	0.0e+00
WP_012100339.1|2558607_2559633_-	nucleoid-associated protein	NA	J9QE81	Clostridium_phage	32.6	1.1e-44
WP_012100340.1|2559675_2559960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100341.1|2559998_2560229_-	hypothetical protein	NA	A0A2D1GQA7	Lysinibacillus_phage	51.5	1.2e-10
WP_012100342.1|2560277_2561708_-	DNA methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	46.1	5.9e-113
WP_012100344.1|2563745_2563925_-	DUF3797 domain-containing protein	NA	A0A0H3UYX0	Geobacillus_virus	53.8	1.1e-11
WP_012100345.1|2563955_2564126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100347.1|2564840_2565986_-	DUF2800 domain-containing protein	NA	A0A0A7S066	Clostridium_phage	88.7	9.0e-197
WP_012100349.1|2566149_2566596_-	hypothetical protein	NA	A0A0A7RTD8	Clostridium_phage	47.5	2.6e-06
WP_012100350.1|2566641_2566896_-	hypothetical protein	NA	A0A0A7RTF9	Clostridium_phage	68.6	2.4e-25
WP_012100351.1|2566895_2567147_-	hypothetical protein	NA	A0A0A7RTK9	Clostridium_phage	70.0	1.5e-27
WP_012100352.1|2567210_2567762_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0A0RUJ6	Bacillus_phage	28.7	3.0e-12
WP_012100354.1|2568121_2568973_-	ORF6N domain-containing protein	NA	X5JAW6	Clostridium_phage	51.5	1.0e-67
WP_014519351.1|2569272_2569470_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012100357.1|2569761_2570139_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J076	uncultured_Caudovirales_phage	50.8	3.4e-20
WP_041173165.1|2571707_2572970_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012100360.1|2573020_2574451_-	adenylosuccinate lyase	NA	NA	NA	NA	NA
WP_003395736.1|2574688_2574910_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_003362134.1|2574937_2575195_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_012100361.1|2575305_2576499_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_004440581.1|2576643_2577000_-	EamA family transporter	NA	NA	NA	NA	NA
WP_004440270.1|2576996_2578280_-	membrane protein	NA	NA	NA	NA	NA
WP_004440805.1|2578298_2579165_-	decaprenyl-phosphate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003362540.1|2579328_2579589_-	stage V sporulation protein S	NA	J9PTX7	Bacillus_phage	39.8	1.6e-08
WP_012100362.1|2579727_2581269_-	ribonuclease Y	NA	NA	NA	NA	NA
WP_012100363.1|2581503_2582562_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	63.5	1.4e-119
WP_003362543.1|2582709_2583294_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_012100364.1|2583277_2584615_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_003388321.1|2584709_2586986_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.7	1.8e-87
WP_003388341.1|2587466_2588159_-|protease	Clp protease	protease	NA	NA	NA	NA
>prophage 4
NC_017297	Clostridium botulinum F str. 230613, complete genome	3993083	3093288	3102891	3993083		Synechococcus_phage(28.57%)	8	NA	NA
WP_012100665.1|3093288_3094788_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase PurH	NA	Q58MG4	Prochlorococcus_phage	47.5	1.2e-68
WP_012100666.1|3095001_3095619_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	3.4e-25
WP_014519379.1|3095765_3096743_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	M4QRQ6	Synechococcus_phage	42.9	5.7e-67
WP_012100668.1|3096914_3098363_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.1	7.2e-58
WP_012100669.1|3098454_3099159_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SLB8	Cyanophage	43.7	3.0e-41
WP_012100670.1|3099158_3099638_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	49.4	3.7e-27
WP_041173178.1|3100165_3100300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079992192.1|3100320_3102891_-	selenium-dependent xanthine dehydrogenase	NA	A0A0P0IVM8	Acinetobacter_phage	33.1	5.8e-10
>prophage 5
NC_017297	Clostridium botulinum F str. 230613, complete genome	3993083	3253962	3275563	3993083		Clostridium_phage(85.71%)	27	NA	NA
WP_012100764.1|3253962_3255048_-	hypothetical protein	NA	A0A0A7RU66	Clostridium_phage	69.8	1.5e-140
WP_012100765.1|3255059_3256058_-	hypothetical protein	NA	A0A0A7RW91	Clostridium_phage	71.4	7.5e-139
WP_003360052.1|3256069_3256324_-	hypothetical protein	NA	A0A0A7S0T0	Clostridium_phage	81.0	1.1e-33
WP_012100766.1|3256329_3258225_-	hypothetical protein	NA	A0A0A7RU09	Clostridium_phage	51.5	4.6e-113
WP_012100767.1|3258239_3259493_-	hypothetical protein	NA	A0A0A7RU28	Clostridium_phage	78.9	1.1e-192
WP_012100768.1|3259515_3260484_-	hypothetical protein	NA	A0A0A7RU61	Clostridium_phage	60.5	3.0e-108
WP_012100769.1|3260485_3261835_-	caspase family protein	NA	A0A0A7RW86	Clostridium_phage	74.1	2.3e-74
WP_012100770.1|3261849_3262191_-	hypothetical protein	NA	A0A0A7S0S4	Clostridium_phage	57.1	7.2e-17
WP_012100771.1|3262203_3263289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100772.1|3263275_3263710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100773.1|3263722_3265126_-	membrane protein	NA	A0A0A7RU22	Clostridium_phage	42.0	7.8e-33
WP_012100774.1|3265201_3265369_-	hypothetical protein	NA	A0A0A7RW80	Clostridium_phage	68.5	4.3e-15
WP_012100775.1|3265403_3265820_-	hypothetical protein	NA	A0A0A7S0S0	Clostridium_phage	68.2	1.7e-44
WP_012100776.1|3265834_3266722_-	hypothetical protein	NA	A0A0A7RTZ9	Clostridium_phage	74.7	2.6e-119
WP_003403551.1|3266726_3267146_-	hypothetical protein	NA	A0A0A7RU17	Clostridium_phage	72.7	6.0e-58
WP_012100777.1|3267151_3267499_-	hypothetical protein	NA	A0A0A7RU51	Clostridium_phage	58.0	4.7e-32
WP_012100778.1|3267503_3267869_-	hypothetical protein	NA	A0A0A7RW73	Clostridium_phage	57.0	2.2e-32
WP_012100779.1|3267868_3268153_-	hypothetical protein	NA	A0A0A7S0R4	Clostridium_phage	59.2	2.3e-24
WP_012100780.1|3268656_3269178_-	hypothetical protein	NA	A0A0A7RVS1	Clostridium_phage	50.0	1.4e-35
WP_003483819.1|3269291_3269612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046665300.1|3269668_3270517_-	ATP-binding protein	NA	A0A2K9V3L7	Faecalibacterium_phage	34.8	4.0e-32
WP_012100782.1|3270458_3271364_-	hypothetical protein	NA	A8ASN4	Listeria_phage	38.7	9.4e-40
WP_072570747.1|3271457_3271691_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012100783.1|3271731_3271941_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003360073.1|3272132_3272543_+	helix-turn-helix domain-containing protein	NA	A0A0A7RUJ5	Clostridium_phage	56.2	1.0e-09
WP_003403583.1|3272844_3272994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012100784.1|3274075_3275563_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	37.8	6.2e-65
>prophage 6
NC_017297	Clostridium botulinum F str. 230613, complete genome	3993083	3378914	3462532	3993083	bacteriocin,holin,tail,terminase,capsid,tRNA,integrase,head,protease	Clostridium_phage(54.05%)	85	3416520:3416539	3451774:3451793
WP_012100841.1|3378914_3380822_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	39.0	1.1e-138
WP_012100842.1|3381169_3382069_-	putative sporulation protein YtxC	NA	NA	NA	NA	NA
WP_012100843.1|3382223_3382931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012100844.1|3383121_3384693_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003405920.1|3386166_3387057_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_003405923.1|3387094_3387835_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003361573.1|3387920_3388193_-	small, acid-soluble spore protein, alpha/beta type	NA	NA	NA	NA	NA
WP_012100846.1|3388492_3389452_-	ATP-binding cassette domain-containing protein	NA	Q6GZ03	Mycoplasma_phage	35.2	2.2e-10
WP_012100847.1|3389451_3390471_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.7	8.2e-16
WP_012100848.1|3390484_3391402_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003405928.1|3391417_3392347_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003357473.1|3394595_3395588_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_012100852.1|3395610_3396489_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_012100853.1|3396711_3397467_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_012100855.1|3399434_3400145_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
WP_003357563.1|3400260_3400962_-	single-stranded DNA-binding protein	NA	A0A2H4J8K3	uncultured_Caudovirales_phage	50.2	6.0e-50
WP_012100856.1|3401039_3401537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100858.1|3402652_3403180_+	DUF4364 family protein	NA	NA	NA	NA	NA
WP_003357551.1|3403182_3404067_-	YncE family protein	NA	NA	NA	NA	NA
WP_003357396.1|3404206_3404467_+	TIGR03905 family TSCPD domain-containing protein	NA	NA	NA	NA	NA
WP_012100859.1|3404475_3405765_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_012100860.1|3406340_3408986_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	43.3	4.8e-177
WP_012100861.1|3409006_3409513_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012100862.1|3410099_3411344_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_003405994.1|3411343_3411628_-	peptide maturation system acyl carrier-related protein	NA	NA	NA	NA	NA
WP_012100864.1|3412408_3413524_-	TIGR04066 family peptide maturation system protein	NA	NA	NA	NA	NA
WP_012100865.1|3413564_3414971_-	Cys-rich peptide radical SAM maturase CcpM	NA	NA	NA	NA	NA
WP_003405999.1|3415060_3415258_-|bacteriocin	CLI_3235 family bacteriocin precursor	bacteriocin	NA	NA	NA	NA
WP_012100866.1|3415378_3417175_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.3	6.4e-40
3416520:3416539	attL	TATTTCTCATAATTTTTTTT	NA	NA	NA	NA
WP_003406003.1|3417795_3418452_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	27.1	4.6e-12
WP_012100868.1|3421500_3421746_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012100870.1|3422235_3422472_+	helix-turn-helix transcriptional regulator	NA	A0A0A7RUG5	Clostridium_phage	67.9	3.9e-22
WP_012100871.1|3422543_3422825_+	helix-turn-helix transcriptional regulator	NA	A0A0A7S0F1	Clostridium_phage	88.0	6.1e-38
WP_012100872.1|3422845_3423319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100873.1|3423395_3423545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100874.1|3423522_3424431_-	recombinase	NA	NA	NA	NA	NA
WP_012100875.1|3424421_3426047_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_012100876.1|3426920_3427322_-	recombinase family protein	NA	A0A2H4J078	uncultured_Caudovirales_phage	57.0	7.4e-29
WP_012100877.1|3427367_3427613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100878.1|3427625_3427808_-	hypothetical protein	NA	A0A0A7RTH9	Clostridium_phage	86.0	7.7e-18
WP_012100879.1|3428428_3429166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100880.1|3429318_3430221_-	SH3 domain-containing protein	NA	A0A0A7RVQ3	Clostridium_phage	54.7	3.4e-42
WP_012100881.1|3430360_3430777_-|holin	phage holin family protein	holin	M9Q253	Clostridium_phage	56.6	1.2e-34
WP_012100882.1|3430873_3430996_-	XkdX family protein	NA	A0A0A7S0E7	Clostridium_phage	62.5	6.9e-07
WP_012100883.1|3430988_3431384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100884.1|3431397_3433062_-	hypothetical protein	NA	E2ELJ8	Clostridium_phage	53.0	4.7e-77
WP_079992194.1|3433068_3434088_-	hypothetical protein	NA	E2ELJ7	Clostridium_phage	59.4	2.4e-116
WP_012100886.1|3434139_3435009_-|tail	phage tail family protein	tail	E2ELJ6	Clostridium_phage	69.7	2.9e-110
WP_012100890.1|3440775_3441063_-	hypothetical protein	NA	E2ELJ2	Clostridium_phage	48.4	1.5e-15
WP_012100891.1|3441098_3441680_-|tail	tail protein	tail	E2ELJ1	Clostridium_phage	59.6	6.9e-60
WP_154018643.1|3441786_3442029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012100893.1|3442023_3442407_-	HK97 gp10 family phage protein	NA	E2ELI9	Clostridium_phage	51.4	1.4e-29
WP_012100894.1|3442399_3442726_-|head	phage head closure protein	head	E2ELI7	Clostridium_phage	33.3	3.5e-05
WP_012100895.1|3442706_3443036_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	33.0	6.1e-05
WP_012100896.1|3443052_3443208_-	termination factor Rho	NA	NA	NA	NA	NA
WP_012100897.1|3443227_3444355_-|capsid	phage major capsid protein	capsid	A0A1B1P7R4	Bacillus_phage	62.1	3.6e-121
WP_012100898.1|3444347_3445148_-|protease	Clp protease ClpP	protease	A0A0A7RTN2	Clostridium_phage	67.6	1.7e-88
WP_012100900.1|3446393_3448091_-|terminase	terminase large subunit	terminase	A6M948	Geobacillus_virus	60.9	6.4e-199
WP_041173254.1|3448087_3448552_-|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	61.9	6.7e-50
WP_012100902.1|3448818_3449292_-	hypothetical protein	NA	A0A0A7RUV1	Clostridium_phage	37.8	4.6e-14
WP_012100903.1|3449291_3449585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100904.1|3449618_3449960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100905.1|3449997_3450273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100906.1|3450426_3450972_-|integrase	site-specific integrase	integrase	E2ELN7	Clostridium_phage	60.7	2.5e-56
WP_012100907.1|3450973_3451207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100908.1|3451415_3451802_-	nitroreductase	NA	A0A0A7RTL7	Clostridium_phage	70.9	2.0e-47
3451774:3451793	attR	TATTTCTCATAATTTTTTTT	NA	NA	NA	NA
WP_012100912.1|3452368_3453418_-	nucleoid-associated protein	NA	J9QE81	Clostridium_phage	29.7	3.9e-37
WP_012100915.1|3453839_3454025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100916.1|3454062_3454335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100917.1|3454368_3454590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100918.1|3454625_3454988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100919.1|3455020_3456037_-	DNA (cytosine-5-)-methyltransferase	NA	A0A0A8WIK9	Clostridium_phage	52.9	1.0e-103
WP_012100920.1|3456065_3456524_-	methyltransferase	NA	A0A0E3Y6D6	Fusobacterium_phage	73.3	5.1e-66
WP_012100921.1|3456569_3457313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100922.1|3457349_3457637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100923.1|3457627_3458143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100924.1|3458145_3458688_-	hypothetical protein	NA	A0A2K9V2Y3	Faecalibacterium_phage	28.6	1.1e-08
WP_012100925.1|3458688_3459525_-	hypothetical protein	NA	A0A1S5SFJ6	Streptococcus_phage	63.5	8.1e-46
WP_012100926.1|3459634_3459856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100927.1|3459871_3460054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100928.1|3460117_3460324_+	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	52.2	1.3e-10
WP_041173183.1|3460367_3460610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100930.1|3460632_3461391_-	hypothetical protein	NA	A0A288WG93	Bacillus_phage	45.9	1.1e-52
WP_012100933.1|3461723_3461957_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012100934.1|3462166_3462532_+	helix-turn-helix transcriptional regulator	NA	A0A1L2BY72	Clostridium_phage	48.6	1.3e-08
