The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_014216	Desulfurivibrio alkaliphilus AHT 2, complete sequence	3097763	1501226	1513233	3097763		Staphylococcus_phage(44.44%)	13	NA	NA
WP_157861428.1|1501226_1503530_-	DNA translocase FtsK 4TM domain-containing protein	NA	G1D482	Mycobacterium_virus	48.1	2.6e-86
WP_013163498.1|1503612_1504029_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_013163499.1|1504035_1504503_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	57.7	7.3e-36
WP_013163500.1|1504521_1505763_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	47.2	1.4e-94
WP_013163501.1|1505872_1506541_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	34.5	4.1e-24
WP_157861429.1|1506586_1507666_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	37.9	9.5e-47
WP_013163503.1|1507902_1508370_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_041719447.1|1508419_1508884_-	cytidine/deoxycytidylate deaminase family protein	NA	E3T5C5	Cafeteria_roenbergensis_virus	35.4	4.5e-22
WP_013163505.1|1508902_1510192_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.3	1.7e-95
WP_013163506.1|1510379_1510802_-	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_013163507.1|1510798_1512043_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_157861538.1|1512071_1512305_-	acyl carrier protein	NA	E3SMK8	Prochlorococcus_phage	66.7	1.5e-05
WP_013163509.1|1512486_1513233_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.2	3.9e-15
>prophage 2
NC_014216	Desulfurivibrio alkaliphilus AHT 2, complete sequence	3097763	1553998	1568005	3097763		Hokovirus(22.22%)	10	NA	NA
WP_013163544.1|1553998_1557928_+	DEAD/DEAH box helicase	NA	V9XTV7	Choristoneura_murinana_nucleopolyhedrovirus	27.3	1.8e-42
WP_157861542.1|1558016_1559657_+	DUF3365 domain-containing protein	NA	A0A1V0SGX0	Hokovirus	28.9	3.6e-13
WP_013163546.1|1559876_1560578_+	response regulator transcription factor	NA	A0A1J0GWE0	Alteromonas_phage	30.0	2.6e-05
WP_013163547.1|1560590_1561166_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_013163548.1|1561283_1561952_-	HAD hydrolase family protein	NA	A0A140XBD6	Dickeya_phage	45.9	4.8e-25
WP_041719454.1|1561973_1562810_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	47.6	4.6e-57
WP_013163550.1|1562820_1564500_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.0	2.9e-159
WP_157861543.1|1564852_1565677_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	57.1	3.4e-20
WP_013163552.1|1565990_1566950_+	DnaJ domain-containing protein	NA	A0A1V0SF83	Hokovirus	27.8	3.6e-21
WP_013163553.1|1566991_1568005_-	diguanylate cyclase	NA	W8CYM9	Bacillus_phage	31.2	6.2e-08
>prophage 3
NC_014216	Desulfurivibrio alkaliphilus AHT 2, complete sequence	3097763	2084042	2092888	3097763		Bacillus_phage(25.0%)	9	NA	NA
WP_162014302.1|2084042_2084699_+	metallophosphoesterase	NA	S5MD19	Sinorhizobium_phage	35.5	3.8e-30
WP_013164001.1|2084758_2085850_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.5	7.7e-20
WP_013164002.1|2085857_2086403_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	53.3	1.5e-48
WP_013164003.1|2086404_2087304_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	9.8e-98
WP_013164004.1|2087300_2088191_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D8EQE2	Escherichia_phage	34.7	2.9e-25
WP_013164005.1|2088296_2089355_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	46.7	7.8e-86
WP_013164006.1|2089491_2090499_-	NAD-dependent epimerase	NA	NA	NA	NA	NA
WP_013164007.1|2090516_2091830_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	39.1	8.5e-82
WP_013164008.1|2091826_2092888_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.7	2.1e-83
>prophage 4
NC_014216	Desulfurivibrio alkaliphilus AHT 2, complete sequence	3097763	2336093	2377961	3097763	transposase,tRNA,tail,integrase	Mycobacterium_phage(28.57%)	44	2338408:2338427	2381591:2381610
WP_157861383.1|2336093_2337572_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_013162572.1|2337587_2338373_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	35.6	1.4e-36
2338408:2338427	attL	GTGGCTCCATTAGCTGATCA	NA	NA	NA	NA
WP_162014303.1|2338444_2339620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013164217.1|2339610_2340930_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_013164218.1|2341028_2341535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013162619.1|2341505_2342756_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	47.4	5.8e-96
WP_013164219.1|2342884_2345518_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_013162619.1|2345612_2346863_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	47.4	5.8e-96
WP_013164220.1|2347113_2347602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013164221.1|2347673_2350886_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	28.1	8.8e-56
WP_013164222.1|2350845_2351619_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_013164223.1|2351630_2353103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157861465.1|2353128_2353278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083774413.1|2353478_2353643_-	acylphosphatase	NA	NA	NA	NA	NA
WP_013164225.1|2353844_2355563_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_083774415.1|2355590_2355719_-	acylphosphatase	NA	NA	NA	NA	NA
WP_157861466.1|2355777_2356341_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_049824400.1|2356327_2357368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013164226.1|2357795_2359577_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	27.4	1.2e-09
WP_013164227.1|2359695_2360961_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_157861467.1|2361171_2361630_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_013164229.1|2361798_2361993_+	CooT family nickel-binding protein	NA	NA	NA	NA	NA
WP_013164230.1|2362006_2362258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013164231.1|2362386_2362887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013164232.1|2362940_2363567_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_013164233.1|2363698_2365342_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_013164234.1|2365524_2365845_+	TusE/DsrC/DsvC family sulfur relay protein	NA	NA	NA	NA	NA
WP_013164235.1|2366278_2367541_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	43.9	5.3e-89
WP_013164236.1|2367970_2368159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013164237.1|2368155_2368338_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_013164238.1|2368442_2369105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013164239.1|2369236_2369515_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_013164240.1|2369511_2369853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013164241.1|2370161_2370500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013164242.1|2370531_2370804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013164243.1|2370808_2371405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013164244.1|2371401_2374122_+	DUF927 domain-containing protein	NA	A0A193GYG9	Enterobacter_phage	38.2	1.7e-31
WP_013164245.1|2374118_2374649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157861585.1|2374942_2375149_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_013164247.1|2375231_2375819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013164248.1|2375889_2376675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013164249.1|2376933_2377245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013164250.1|2377258_2377513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013164251.1|2377625_2377961_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
2381591:2381610	attR	TGATCAGCTAATGGAGCCAC	NA	NA	NA	NA
>prophage 5
NC_014216	Desulfurivibrio alkaliphilus AHT 2, complete sequence	3097763	2400466	2409245	3097763	transposase	Acidithiobacillus_phage(33.33%)	10	NA	NA
WP_013164267.1|2400466_2401537_-	tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.9	2.6e-28
WP_174259456.1|2401561_2401753_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_013164269.1|2402208_2402793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013164270.1|2402785_2403667_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013164271.1|2403763_2404522_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	50.4	1.5e-62
WP_049824403.1|2404515_2405745_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	52.7	1.2e-117
WP_013164272.1|2405867_2407391_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	30.7	1.3e-20
WP_013163745.1|2407377_2408118_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.7	5.3e-41
WP_157861468.1|2408068_2408518_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_049824404.1|2408744_2409245_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	39.2	1.2e-20
>prophage 6
NC_014216	Desulfurivibrio alkaliphilus AHT 2, complete sequence	3097763	2506520	2553235	3097763	transposase,protease,integrase,terminase	Escherichia_phage(15.38%)	39	2540926:2540977	2559196:2559247
WP_013164339.1|2506520_2507750_+|integrase	site-specific integrase	integrase	G9L697	Escherichia_phage	29.9	4.3e-43
WP_013164340.1|2507815_2508400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013164341.1|2508508_2508700_+	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	50.9	2.0e-08
WP_083774476.1|2509820_2511215_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_157861471.1|2511211_2511676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013164343.1|2511686_2512274_+|terminase	terminase small subunit	terminase	A0A2K9V3C4	Faecalibacterium_phage	35.9	8.0e-08
WP_013164344.1|2512368_2512914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013164345.1|2512932_2514987_-|protease	BREX system Lon protease-like protein BrxL	protease	NA	NA	NA	NA
WP_013164346.1|2514986_2517326_-	BREX-1 system phosphatase PglZ type B	NA	NA	NA	NA	NA
WP_013164347.1|2517356_2517998_-	DUF4276 family protein	NA	NA	NA	NA	NA
WP_013164348.1|2517994_2519077_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	27.4	8.4e-19
WP_013164349.1|2519073_2522694_-	restriction endonuclease subunit M	NA	NA	NA	NA	NA
WP_013164350.1|2522795_2524520_-	putative DNA binding domain-containing protein	NA	NA	NA	NA	NA
WP_013164351.1|2524529_2527967_-	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_013164352.1|2527994_2528546_-	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_013164353.1|2528532_2529324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083774427.1|2529304_2529514_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	60.7	1.7e-16
WP_013164354.1|2529731_2530457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013164355.1|2530440_2531229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013162619.1|2531539_2532790_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	47.4	5.8e-96
WP_013164356.1|2533478_2534921_-	TIGR04283 family arsenosugar biosynthesis glycosyltransferase	NA	NA	NA	NA	NA
WP_013164357.1|2534958_2535723_-	S-methyl-5'-thioadenosine phosphorylase	NA	NA	NA	NA	NA
WP_157861472.1|2535727_2536891_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_013164359.1|2537236_2538307_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_013164360.1|2538600_2538891_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	54.3	1.3e-22
WP_013164361.1|2538955_2540611_+	chaperonin GroEL	NA	A0A240F766	uncultured_virus	58.2	1.7e-167
2540926:2540977	attL	GCCTTCTAAGCCGTAGGTCGCAGGTTCGAATCCTGCCGGGCGCGCCAGAAAA	NA	NA	NA	NA
WP_083774429.1|2541541_2541958_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_083774431.1|2542097_2542373_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013164362.1|2542376_2543231_+	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	59.4	1.1e-26
WP_013164363.1|2543324_2544236_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_013164364.1|2544800_2545358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013164365.1|2545314_2545896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013164366.1|2546038_2546374_-	type II toxin-antitoxin system HicB family antitoxin	NA	R4JJS9	Burkholderia_phage	48.1	4.9e-26
WP_013164367.1|2546370_2546625_-	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	58.3	2.6e-19
WP_157861591.1|2547101_2548184_+	DNA (cytosine-5-)-methyltransferase	NA	A0A0R6PG08	Moraxella_phage	51.5	1.4e-95
WP_013164369.1|2548173_2549838_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_013164370.1|2549981_2550581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013162572.1|2550955_2551741_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	35.6	1.4e-36
WP_157861383.1|2551756_2553235_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
2559196:2559247	attR	GCCTTCTAAGCCGTAGGTCGCAGGTTCGAATCCTGCCGGGCGCGCCAGAAAA	NA	NA	NA	NA
