The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_007761	Rhizobium etli CFN 42, complete sequence	4381608	812947	818705	4381608	transposase	Pseudomonas_phage(28.57%)	7	NA	NA
WP_011424133.1|812947_813295_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	63.6	4.4e-38
WP_011053348.1|813452_813836_+|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	51.1	5.4e-05
WP_011053349.1|813832_814177_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	31.6	5.0e-10
WP_011053350.1|814250_815843_+|transposase	IS66-like element ISRel15 family transposase	transposase	A0A218MNE7	uncultured_virus	33.1	1.3e-52
WP_011053350.1|816314_817907_-|transposase	IS66-like element ISRel15 family transposase	transposase	A0A218MNE7	uncultured_virus	33.1	1.3e-52
WP_011053349.1|817980_818325_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	31.6	5.0e-10
WP_011053348.1|818321_818705_-|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	51.1	5.4e-05
>prophage 2
NC_007761	Rhizobium etli CFN 42, complete sequence	4381608	1585514	1594734	4381608		Escherichia_phage(25.0%)	9	NA	NA
WP_011424840.1|1585514_1586813_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	50.8	5.4e-97
WP_003547190.1|1586822_1587299_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_011424841.1|1587302_1588610_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	39.1	6.5e-34
WP_011424842.1|1588609_1589221_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.4	2.6e-17
WP_011424843.1|1589339_1590209_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	59.2	2.2e-94
WP_011424844.1|1590218_1591106_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D8EQE2	Escherichia_phage	35.4	1.9e-29
WP_011424845.1|1591109_1592165_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.2	7.5e-97
WP_011424846.1|1592171_1592750_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A218MN57	uncultured_virus	44.3	1.2e-32
WP_042118210.1|1592739_1594734_-	hypothetical protein	NA	A0A0G2Y9S0	Acanthamoeba_polyphaga_mimivirus	27.0	6.1e-07
>prophage 3
NC_007761	Rhizobium etli CFN 42, complete sequence	4381608	1908774	1921866	4381608	tRNA	uncultured_Mediterranean_phage(90.91%)	13	NA	NA
WP_042119237.1|1908774_1909788_+	beta-N-acetylhexosaminidase	NA	A0A1B1IVS3	uncultured_Mediterranean_phage	42.6	1.6e-24
WP_041678867.1|1909806_1910664_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	35.2	4.7e-33
WP_020921130.1|1910660_1911365_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	47.0	2.1e-39
WP_011425113.1|1911547_1911739_+	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	72.1	6.8e-09
WP_011425114.1|1911789_1912410_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_020921132.1|1912406_1913234_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	45.7	1.2e-52
WP_011425116.1|1913330_1914614_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.7	7.0e-97
WP_011425117.1|1914618_1915392_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	30.2	3.1e-23
WP_011425118.1|1915388_1916042_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	34.7	5.2e-16
WP_011425119.1|1916181_1917771_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV24	Clostridium_phage	30.0	5.0e-12
WP_011425120.1|1917857_1918730_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011425121.1|1918933_1919281_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	38.0	9.2e-12
WP_011425122.1|1919325_1921866_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	48.2	2.4e-56
>prophage 4
NC_007761	Rhizobium etli CFN 42, complete sequence	4381608	2058009	2109424	4381608	protease,transposase,integrase	Faecalibacterium_phage(14.29%)	48	2049607:2049655	2113139:2113187
2049607:2049655	attL	CTGACTTTTAATCAGTAGGTCTCGGGTTCGAACCCCGACGCTCTCACCA	NA	NA	NA	NA
WP_011425248.1|2058009_2058906_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_042119242.1|2058896_2060600_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_166486899.1|2060797_2061898_-	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_042118388.1|2062505_2062703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011425251.1|2062702_2063347_+	DNA methyltransferase	NA	A0A2K9VH43	Faecalibacterium_phage	34.1	1.4e-29
WP_073990379.1|2063622_2063985_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_042118390.1|2064144_2064603_+	discoidin domain-containing protein	NA	NA	NA	NA	NA
WP_042118393.1|2064595_2065033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011425253.1|2065041_2066376_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	25.1	9.7e-17
WP_011425254.1|2066372_2067086_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011425255.1|2067096_2068452_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_042118396.1|2068471_2069320_+	EamA family transporter	NA	NA	NA	NA	NA
WP_011425257.1|2069513_2069810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011425259.1|2071624_2072701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166486900.1|2072863_2073004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011425260.1|2072997_2073300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011425261.1|2073296_2074172_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_011425262.1|2075175_2075688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166486901.1|2076165_2076678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042118403.1|2077469_2077670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011425264.1|2077666_2078002_+	DUF3768 domain-containing protein	NA	L7TKV8	Rhizobium_phage	42.1	1.3e-15
WP_011425265.1|2078074_2078833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042118405.1|2078983_2079343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011425266.1|2079351_2079666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042118409.1|2079764_2080004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011425267.1|2080279_2080837_+	recombinase family protein	NA	NA	NA	NA	NA
WP_042118412.1|2081071_2085139_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_042118415.1|2085356_2086772_-	SAVED domain-containing protein	NA	NA	NA	NA	NA
WP_011425270.1|2086768_2087230_-	Mov34/MPN/PAD-1 family protein	NA	NA	NA	NA	NA
WP_011425271.1|2087204_2088893_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_166486902.1|2088889_2089906_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_011425273.1|2090222_2090729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042118420.1|2090885_2091749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011425275.1|2091765_2092512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166486903.1|2092637_2092814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011425276.1|2093046_2094999_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_166486904.1|2095633_2096098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011425278.1|2096192_2096582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082239844.1|2096647_2098312_-	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_011425280.1|2098670_2098907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011425281.1|2099071_2099368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011425282.1|2099718_2102832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166486905.1|2103377_2104748_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	NA	NA	NA	NA
WP_011053348.1|2104913_2105297_+|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	51.1	5.4e-05
WP_011053349.1|2105293_2105638_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	31.6	5.0e-10
WP_011053350.1|2105711_2107304_+|transposase	IS66-like element ISRel15 family transposase	transposase	A0A218MNE7	uncultured_virus	33.1	1.3e-52
WP_187331724.1|2107291_2107453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011425284.1|2107858_2109424_-|transposase	IS66-like element ISRel19 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	44.4	9.4e-112
2113139:2113187	attR	CTGACTTTTAATCAGTAGGTCTCGGGTTCGAACCCCGACGCTCTCACCA	NA	NA	NA	NA
>prophage 5
NC_007761	Rhizobium etli CFN 42, complete sequence	4381608	2205656	2215824	4381608		uncultured_Mediterranean_phage(83.33%)	9	NA	NA
WP_011425373.1|2205656_2208578_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	62.1	0.0e+00
WP_011425374.1|2208862_2209378_+	single-stranded DNA-binding protein	NA	R9TP78	Rhizobium_phage	72.9	5.5e-45
WP_011425375.1|2209460_2210108_-	MarC family protein	NA	NA	NA	NA	NA
WP_011425376.1|2210345_2213171_+	DNA gyrase subunit A	NA	A0A1B1IVS2	uncultured_Mediterranean_phage	41.9	5.1e-76
WP_166486907.1|2213506_2213662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041678644.1|2213755_2214103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011425379.1|2214192_2214687_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	36.5	1.1e-23
WP_011425380.1|2214713_2215286_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	54.7	7.5e-43
WP_011425381.1|2215314_2215824_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	58.8	9.3e-45
>prophage 6
NC_007761	Rhizobium etli CFN 42, complete sequence	4381608	3169970	3232107	4381608	protease,transposase,tRNA,holin	Bacillus_phage(20.0%)	55	NA	NA
WP_011426268.1|3169970_3170693_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_011426270.1|3171120_3171432_-|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
WP_011426271.1|3171754_3172858_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_011426272.1|3172873_3173947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020921911.1|3174139_3174631_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_011426274.1|3174627_3175095_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_020921912.1|3175113_3175656_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.8	2.3e-33
WP_011426276.1|3175770_3176655_-	cytochrome c1	NA	NA	NA	NA	NA
WP_011426277.1|3176680_3177961_-	cytochrome b N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_011426278.1|3177975_3178554_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_011426279.1|3178840_3179773_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_011426280.1|3179728_3181642_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.0	3.0e-27
WP_011426281.1|3181804_3182035_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_011426282.1|3182126_3183983_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.9	9.3e-34
WP_011426283.1|3184367_3184829_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_011426284.1|3185026_3186673_+	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_011426285.1|3186676_3186937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011426286.1|3187457_3188369_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_011426287.1|3188471_3188735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011426288.1|3188848_3189034_+	DUF1059 domain-containing protein	NA	NA	NA	NA	NA
WP_042118840.1|3189104_3190358_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	K4JS34	Caulobacter_phage	34.8	6.1e-45
WP_011426290.1|3190354_3191005_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_011426291.1|3191001_3191625_-	DUF1285 domain-containing protein	NA	NA	NA	NA	NA
WP_041678717.1|3191782_3192793_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_020921924.1|3192806_3193727_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_011426294.1|3193723_3196537_+	DUF4159 domain-containing protein	NA	NA	NA	NA	NA
WP_011426295.1|3196538_3198611_+	membrane protein	NA	NA	NA	NA	NA
WP_011053350.1|3198808_3200401_-|transposase	IS66-like element ISRel15 family transposase	transposase	A0A218MNE7	uncultured_virus	33.1	1.3e-52
WP_011053349.1|3200474_3200819_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	31.6	5.0e-10
WP_011053348.1|3200815_3201199_-|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	51.1	5.4e-05
WP_073990388.1|3201537_3202080_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011426298.1|3202317_3203304_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_020921929.1|3203310_3203811_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_042118845.1|3203860_3204769_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_011426301.1|3204927_3205488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011426302.1|3205672_3206182_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_042118846.1|3206183_3207023_+	anti-sigma factor	NA	NA	NA	NA	NA
WP_042118852.1|3207365_3209084_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_011426305.1|3209421_3210651_-	benzoate/H(+) symporter BenE family transporter	NA	NA	NA	NA	NA
WP_011426306.1|3210801_3211386_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	38.4	3.3e-30
WP_011426307.1|3211617_3212379_+	DUF2076 domain-containing protein	NA	NA	NA	NA	NA
WP_011426308.1|3212511_3212976_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	48.8	1.5e-28
WP_011426309.1|3212975_3213890_-	CDF family cation efflux transporter EmfA	NA	NA	NA	NA	NA
WP_011426310.1|3214086_3214758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011426311.1|3214772_3215012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011426312.1|3215234_3217424_-	anthranilate synthase	NA	NA	NA	NA	NA
WP_011426313.1|3217692_3219951_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_011426314.1|3221470_3223150_-	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_042118858.1|3223738_3225418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011426316.1|3225724_3226450_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011426318.1|3226976_3228107_-	DUF2333 family protein	NA	NA	NA	NA	NA
WP_011426319.1|3228245_3229319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011426320.1|3229391_3229994_-	thymidine kinase	NA	G9I9I2	Pseudomonas_phage	55.9	6.5e-53
WP_011426321.1|3230230_3231187_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_011426322.1|3231261_3232107_+|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
>prophage 7
NC_007761	Rhizobium etli CFN 42, complete sequence	4381608	3933041	3943057	4381608		Mycobacterium_phage(25.0%)	9	NA	NA
WP_011426921.1|3933041_3933752_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2P1JXV3	Rhodococcus_phage	46.9	2.5e-48
WP_020922355.1|3933751_3934108_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_011426923.1|3934104_3934833_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	37.9	1.1e-41
WP_011426924.1|3934838_3936062_-	adenylate/guanylate cyclase domain-containing protein	NA	M1HLN3	Pelagibacter_phage	29.3	1.2e-13
WP_011426925.1|3936161_3937136_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	75.1	2.1e-138
WP_042119041.1|3937311_3939516_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	51.1	3.1e-209
WP_011426927.1|3939494_3939899_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A249Y1D6	Staphylococcus_phage	33.1	2.1e-07
WP_010068756.1|3939915_3940137_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	52.1	1.8e-16
WP_011426928.1|3940810_3943057_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	37.2	9.6e-126
>prophage 1
NC_007762	Rhizobium etli CFN 42 plasmid p42a, complete sequence	194229	10792	103386	194229	transposase	Enterobacteria_phage(20.0%)	57	NA	NA
WP_011427313.1|10792_12319_-|transposase	IS21-like element ISRel16 family transposase	transposase	K4I413	Acidithiobacillus_phage	44.2	7.2e-117
WP_166486932.1|12687_13545_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_042119506.1|13931_14207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011427315.1|14214_15201_-	caspase family protein	NA	NA	NA	NA	NA
WP_042119579.1|15201_15573_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_176539351.1|15775_15913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011427318.1|16292_17837_-	E2 ligase fold family C protein	NA	NA	NA	NA	NA
WP_063503095.1|17840_18272_-	Mov34/MPN/PAD-1 family protein	NA	NA	NA	NA	NA
WP_011427320.1|18325_18943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011427321.1|18939_19245_-	DUF2604 domain-containing protein	NA	NA	NA	NA	NA
WP_166486933.1|19619_21344_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_165779395.1|21379_21610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165779394.1|21837_22311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011427324.1|22280_23771_-	FGGY-family carbohydrate kinase	NA	NA	NA	NA	NA
WP_042119508.1|23981_24968_-	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011427326.1|25122_26454_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_086005040.1|28300_29026_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011427331.1|30218_32267_+	bifunctional aldolase/short-chain dehydrogenase	NA	NA	NA	NA	NA
WP_042119512.1|34929_35160_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_011427337.1|35960_37169_+	plasmid partitioning protein RepA	NA	A0A240F4U1	Ochrobactrum_phage	45.1	2.0e-90
WP_011427339.1|38448_39711_+	plasmid replication protein RepCa2	NA	L7TKN6	Rhizobium_phage	25.4	1.1e-14
WP_042119516.1|40647_40932_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_011427344.1|43909_44521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133118182.1|44865_45126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011427346.1|45178_47689_+	two-component system VirA-like sensor kinase	NA	A0A1V0SGX0	Hokovirus	25.3	2.0e-07
WP_011427347.1|47888_48626_+	type IV secretion system lytic transglycosylase VirB1	NA	NA	NA	NA	NA
WP_011427348.1|48765_49092_+	type IV secretion system protein VirB3	NA	NA	NA	NA	NA
WP_011427349.1|49091_51461_+	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
WP_011427350.1|51477_52140_+	pilin minor subunit VirB5	NA	NA	NA	NA	NA
WP_011427351.1|52238_53126_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_011427352.1|53155_53323_+	type IV secretion system lipoprotein VirB7	NA	NA	NA	NA	NA
WP_042119589.1|53309_54023_+	type IV secretion system protein VirB8	NA	NA	NA	NA	NA
WP_011427354.1|54019_54901_+	P-type conjugative transfer protein VirB9	NA	NA	NA	NA	NA
WP_011427355.1|54897_56001_+	type IV secretion system protein VirB10	NA	NA	NA	NA	NA
WP_011427356.1|56041_57076_+	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
WP_011427357.1|57173_57914_+	response regulator	NA	NA	NA	NA	NA
WP_011427358.1|57995_58613_-	conjugal transfer protein VirC2	NA	NA	NA	NA	NA
WP_011427359.1|58615_59311_-	conjugal transfer ATPase VirC1	NA	A0A0A8IL09	Aurantimonas_phage	26.7	1.9e-08
WP_011427363.1|64326_64524_+	type IV secretion system effector chaperone VirE1	NA	NA	NA	NA	NA
WP_011427364.1|64527_66195_+	type IV secretion system single-stranded DNA binding effector VirE2	NA	NA	NA	NA	NA
WP_011427365.1|66260_68216_+	virulence VirE3 protein	NA	NA	NA	NA	NA
WP_166486934.1|68247_68526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011427368.1|71658_72105_+	T-DNA border endonuclease subunit VirD1	NA	NA	NA	NA	NA
WP_011427369.1|72132_73377_+	T-DNA border endonuclease VirD2	NA	NA	NA	NA	NA
WP_011427370.1|75278_77279_+	type IV secretion system ATPase VirD4	NA	NA	NA	NA	NA
WP_042119525.1|77703_78849_-|transposase	IS4-like element ISRel1 family transposase	transposase	NA	NA	NA	NA
WP_003563080.1|80246_81128_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	46.3	3.6e-52
WP_003563080.1|86868_87750_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	46.3	3.6e-52
WP_009996987.1|90836_91199_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_009996986.1|91195_91543_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	53.9	4.6e-27
WP_009996985.1|91615_93181_+|transposase	IS66-like element ISRel19 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	44.4	2.5e-112
WP_011427378.1|93362_94322_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011427379.1|96240_97719_+	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_011427380.1|98215_99271_+	NAD/NADP octopine/nopaline dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011427381.1|100325_100631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086005037.1|101210_102312_+|transposase	IS3-like element ISRel21 family transposase	transposase	A0A1B1P773	Bacillus_phage	29.0	2.7e-12
WP_011427384.1|102549_103386_+|transposase	IS5-like element ISRel20 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_007762	Rhizobium etli CFN 42 plasmid p42a, complete sequence	194229	107425	149093	194229	transposase	Stx2-converting_phage(42.86%)	26	NA	NA
WP_009996985.1|107425_108991_-|transposase	IS66-like element ISRel19 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	44.4	2.5e-112
WP_009996986.1|109063_109411_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	53.9	4.6e-27
WP_166486935.1|109407_109752_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011427389.1|109975_111610_-|transposase	IS66-like element ISRel24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	43.1	1.8e-97
WP_011427391.1|112018_112426_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011427392.1|112941_114840_+	potassium transporter Kup	NA	A7J6G4	Paramecium_bursaria_Chlorella_virus	28.9	1.8e-64
WP_165779457.1|117413_117587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011427397.1|117734_118640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_183741011.1|119260_119437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011427400.1|119917_120226_+	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_165779456.1|120548_120713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042119538.1|121041_121533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011427403.1|122541_124221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011427406.1|126661_127819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103671223.1|128362_129940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037145433.1|131835_132033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011427411.1|132022_134086_+	recombinase family protein	NA	E9P5U5	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	24.0	5.2e-09
WP_011053446.1|134451_135711_+|transposase	IS110-like element ISRel25 family transposase	transposase	A0A1S7J231	Thermus_phage	34.0	2.3e-12
WP_166486931.1|136966_137434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077991700.1|138284_138650_+	pilin major subunit VirB2	NA	NA	NA	NA	NA
WP_183740805.1|138646_138844_+	type IV secretion system protein VirB3	NA	NA	NA	NA	NA
WP_183740826.1|138746_139334_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_011427416.1|139727_140234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011427421.1|144049_144502_+	RICIN domain-containing protein	NA	NA	NA	NA	NA
WP_011427422.1|146217_147591_+|transposase	ISNCY-like element ISRel26 family transposase	transposase	A1YTJ2	Porcine_endogenous_retrovirus	26.4	1.8e-05
WP_011053406.1|147926_149093_-|transposase	IS110-like element ISRel9 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NC_004041	Rhizobium etli CFN 42 plasmid p42d, complete sequence	371254	79461	140519	371254	protease,transposase	Staphylococcus_phage(14.29%)	45	NA	NA
WP_004675992.1|79461_80562_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.0	1.1e-37
WP_008534300.1|80676_81363_-	TRSP domain-containing protein	NA	NA	NA	NA	NA
WP_029875549.1|84984_86496_+	tyrosinase family protein	NA	NA	NA	NA	NA
WP_011053334.1|86527_86983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004668604.1|87465_88995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011053336.1|89656_92047_+	DUF3141 domain-containing protein	NA	NA	NA	NA	NA
WP_026188835.1|92756_93092_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004668612.1|93688_94369_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011053340.1|94683_95568_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	29.2	1.1e-21
WP_004668619.1|95645_96074_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004668622.1|96151_96535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004668623.1|96531_97428_+	alpha/beta hydrolase	NA	G1JV20	Mycobacterium_phage	29.4	2.3e-06
WP_008534334.1|97453_98620_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011053341.1|98711_100265_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.1	8.1e-15
WP_008534336.1|100261_101236_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004668632.1|101247_102267_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_008534338.1|102290_103778_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004668636.1|104062_104248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076612137.1|105959_106907_+|transposase	IS630-like element ISRel6 family transposase	transposase	S5VXX4	Leptospira_phage	23.0	1.1e-09
WP_011053346.1|107229_109239_+	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	82.4	8.9e-06
WP_004673279.1|109760_109946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008534360.1|110016_111051_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011053348.1|111485_111869_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011053349.1|111865_112210_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_011053350.1|112283_113876_+|transposase	IS66-like element ISRel15 family transposase	transposase	A0A218MNE7	uncultured_virus	33.1	1.3e-52
WP_011053351.1|114752_115502_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011053352.1|115713_118227_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	3.6e-12
WP_008534366.1|118411_119611_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004673285.1|120042_122601_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	34.8	3.4e-26
WP_011053353.1|122953_123838_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004673287.1|123850_124978_+	zinc-dependent alcohol dehydrogenase family protein	NA	A0A0K0KVL7	Prochlorococcus_phage	30.1	1.7e-30
WP_004673291.1|125892_126582_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008534369.1|126711_127941_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004671535.1|129657_130425_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	36.1	2.8e-24
WP_008534378.1|130559_131069_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_004671531.1|131141_131549_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_011053356.1|131609_132731_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004671529.1|132854_134024_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_026188837.1|134101_135319_+	LL-diaminopimelate aminotransferase	NA	NA	NA	NA	NA
WP_010029274.1|135330_135729_+	GFA family protein	NA	NA	NA	NA	NA
WP_004671524.1|136089_136608_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004671523.1|136624_137905_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.7	4.5e-96
WP_011053358.1|138181_138568_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	37.1	1.9e-05
WP_011053359.1|138564_138918_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_011053360.1|138986_140519_+|transposase	IS66-like element ISRel8 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	39.5	5.4e-96
>prophage 2
NC_004041	Rhizobium etli CFN 42 plasmid p42d, complete sequence	371254	204822	276866	371254	transposase	Paenibacillus_phage(11.11%)	53	NA	NA
WP_011053406.1|204822_205989_+|transposase	IS110-like element ISRel9 family transposase	transposase	NA	NA	NA	NA
WP_011053407.1|206380_207118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011053408.1|207124_208546_-|transposase	ISNCY-like element ISRel10 family transposase	transposase	NA	NA	NA	NA
WP_008536571.1|208719_208923_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_042120140.1|209597_210326_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_011053410.1|210933_211866_-	cation transporter	NA	NA	NA	NA	NA
WP_086005066.1|212448_213212_-|transposase	IS5-like element ISRel11 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	41.7	2.0e-19
WP_008536565.1|213383_213878_-	nitrogen fixation protein NifX	NA	NA	NA	NA	NA
WP_011053414.1|213874_215230_-	nitrogenase iron-molybdenum cofactor biosynthesis protein NifN	NA	NA	NA	NA	NA
WP_011053415.1|215239_216730_-	nitrogenase iron-molybdenum cofactor biosynthesis protein NifE	NA	NA	NA	NA	NA
WP_004677342.1|216788_218330_-	nitrogenase molybdenum-iron protein subunit beta	NA	NA	NA	NA	NA
WP_011053416.1|218453_219956_-	nitrogenase molybdenum-iron protein alpha chain	NA	NA	NA	NA	NA
WP_004675840.1|220063_220957_-	nitrogenase iron protein	NA	NA	NA	NA	NA
WP_164736476.1|226446_226713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011053426.1|228438_229029_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_004678571.1|229196_229451_-	ferredoxin	NA	NA	NA	NA	NA
WP_042120111.1|229471_230650_-	cytochrome P450	NA	NA	NA	NA	NA
WP_010009909.1|230956_231130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011053428.1|231726_232443_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_004678566.1|233325_233865_+	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	63.7	3.9e-49
WP_011053429.1|233940_235392_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_004678546.1|235920_236238_+	iron-sulfur cluster assembly accessory protein	NA	NA	NA	NA	NA
WP_004678544.1|237207_238404_+	cysteine desulfurase NifS	NA	H7BUW1	unidentified_phage	34.9	2.1e-34
WP_004678534.1|238743_239127_+	nitrogenase stabilizing/protective protein NifW	NA	NA	NA	NA	NA
WP_004678528.1|239303_240152_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_004678527.1|240167_241277_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_008536548.1|241286_242594_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_004678523.1|242606_242906_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_011053431.1|243126_244815_+	nif-specific transcriptional activator NifA	NA	NA	NA	NA	NA
WP_011053432.1|245028_246507_+	nitrogenase cofactor biosynthesis protein NifB	NA	NA	NA	NA	NA
WP_008536545.1|246541_246748_+	4Fe-4S binding protein	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	51.6	3.7e-08
WP_008536544.1|246812_247130_+	nitrogen fixation protein NifZ	NA	NA	NA	NA	NA
WP_004678514.1|247134_247347_+	putative nitrogen fixation protein NifT	NA	NA	NA	NA	NA
WP_008536543.1|247377_248316_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_008536542.1|248760_249864_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_004671987.1|251179_251686_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_166486966.1|252196_253072_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	31.7	5.4e-08
WP_010069248.1|253589_254093_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011053437.1|256721_258791_+	recombinase family protein	NA	A0A1B2LRQ3	Wolbachia_phage	24.3	7.7e-05
WP_016737501.1|260292_260643_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	53.3	2.7e-27
WP_011053439.1|260639_261047_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_008536527.1|261018_261309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008536526.1|261341_261458_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_008536525.1|262522_263452_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_011053440.1|263640_264774_-	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_008536520.1|264793_265696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011053441.1|265692_267246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011053442.1|268021_269365_-	cytochrome P450	NA	NA	NA	NA	NA
WP_011053443.1|269364_270207_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.2	1.2e-15
WP_011053444.1|270193_271795_-	cytochrome P450	NA	NA	NA	NA	NA
WP_011053445.1|271800_273081_-	cytochrome P450	NA	NA	NA	NA	NA
WP_170964898.1|273149_273413_-	cytochrome	NA	NA	NA	NA	NA
WP_011053446.1|275606_276866_-|transposase	IS110-like element ISRel25 family transposase	transposase	A0A1S7J231	Thermus_phage	34.0	2.3e-12
