The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_010943	Stenotrophomonas maltophilia K279a, complete genome	4851126	291568	345473	4851126	portal,tRNA,holin,terminase,integrase,tail,capsid,head,plate	Stenotrophomonas_phage(85.37%)	67	286979:287003	345512:345536
286979:287003	attL	TGGTAGTGCCGGCCGCTGGCCGGCA	NA	NA	NA	NA
WP_044569375.1|291568_292600_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_005407693.1|292813_293188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004136763.1|293261_293945_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_032953760.1|293970_295395_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_099470490.1|295995_296787_-	zinc-dependent peptidase	NA	NA	NA	NA	NA
WP_044569378.1|296753_297032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012478821.1|297176_298145_+	bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor	NA	NA	NA	NA	NA
WP_005407698.1|298141_298873_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_012478822.1|298882_299731_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_012478823.1|299948_301127_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	86.9	1.3e-201
WP_012478824.1|301126_301351_-	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	94.6	5.9e-36
WP_012478826.1|302178_302604_-	hypothetical protein	NA	V9IQL6	Stenotrophomonas_phage	87.2	2.8e-58
WP_012478828.1|302955_305652_-	toprim domain-containing protein	NA	V9IQW5	Stenotrophomonas_phage	84.1	0.0e+00
WP_044569385.1|305762_306023_-	hypothetical protein	NA	V9IQH4	Stenotrophomonas_phage	69.8	3.7e-21
WP_087944440.1|306022_306331_-	hypothetical protein	NA	V9IQM8	Stenotrophomonas_phage	50.5	2.0e-18
WP_044569393.1|306327_306570_-	hypothetical protein	NA	V9IQX5	Stenotrophomonas_phage	86.2	2.3e-33
WP_012478830.1|306893_307100_-	hypothetical protein	NA	V9IQL4	Stenotrophomonas_phage	88.2	3.6e-24
WP_044569396.1|307168_307513_-	ogr/Delta-like zinc finger family protein	NA	V9IQW3	Stenotrophomonas_phage	77.9	2.7e-48
WP_012478832.1|307509_307842_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_148272153.1|307956_308343_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_049886002.1|308668_309400_+	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_012478835.1|309585_310977_+	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_012478836.1|310973_311966_-	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	74.1	1.2e-128
WP_012478837.1|311962_312361_-|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	91.7	1.3e-62
WP_012478838.1|312372_315237_-|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	64.1	2.4e-283
WP_012478839.1|315262_315379_-|tail	GpE family phage tail protein	tail	V9IQH2	Stenotrophomonas_phage	86.5	7.0e-09
WP_012478840.1|315387_315714_-|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	58.9	4.3e-27
WP_012478841.1|315769_316279_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	94.7	4.4e-87
WP_012478842.1|316299_317469_-|tail	phage tail sheath protein	tail	E5FFG9	Burkholderia_phage	66.6	8.7e-147
WP_012478843.1|317484_317835_-	GPW/gp25 family protein	NA	V9IQW0	Stenotrophomonas_phage	67.2	5.8e-38
WP_012478844.1|317831_318380_-|plate	phage baseplate assembly protein V	plate	V9IQH1	Stenotrophomonas_phage	58.3	9.1e-38
WP_012478845.1|318466_318748_-	hypothetical protein	NA	A0A088FV63	Escherichia_phage	46.2	5.5e-15
WP_012478846.1|318757_319990_-|tail	tail fiber protein	tail	V9IQX0	Stenotrophomonas_phage	47.7	1.7e-55
WP_012478847.1|319994_320546_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	57.1	1.6e-58
WP_012478848.1|320538_321429_-|plate	baseplate J/gp47 family protein	plate	V9IQV9	Stenotrophomonas_phage	64.9	2.3e-107
WP_012478849.1|321515_321977_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	75.2	3.3e-57
WP_012478850.1|321973_322459_-|tail	phage tail protein	tail	V9IQM0	Stenotrophomonas_phage	68.5	3.0e-53
WP_012478851.1|322455_322980_-	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	73.6	1.1e-53
WP_012478852.1|322979_323615_-	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	87.5	1.0e-77
WP_012478853.1|323616_323892_-|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	91.2	2.2e-40
WP_012478854.1|323884_324238_-	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	94.0	1.2e-51
WP_012478855.1|324240_324456_-|tail	tail protein X	tail	V9IQL8	Stenotrophomonas_phage	73.2	1.1e-20
WP_012478856.1|324455_324923_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	75.5	1.8e-55
WP_012478857.1|325027_325735_-|terminase	terminase	terminase	V9IQK3	Stenotrophomonas_phage	72.7	2.4e-59
WP_012478858.1|325738_326755_-|capsid	phage major capsid protein, P2 family	capsid	V9IQV7	Stenotrophomonas_phage	79.5	1.6e-149
WP_148272144.1|326788_327703_-|capsid	GPO family capsid scaffolding protein	capsid	V9IQG8	Stenotrophomonas_phage	80.9	1.5e-98
WP_044569400.1|327806_329564_+|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	93.2	0.0e+00
WP_012478861.1|329563_330574_+|portal	phage portal protein	portal	V9IQW4	Stenotrophomonas_phage	86.5	2.8e-157
WP_080047722.1|330576_330828_+	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	85.2	8.1e-34
WP_012478862.1|330745_331456_+	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	93.6	2.2e-129
WP_044569402.1|331522_332011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049886003.1|332896_333241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012478865.1|333315_334077_-	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	60.7	2.7e-80
WP_012478867.1|334914_335202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012478868.1|335567_336692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012478869.1|336719_337319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012478870.1|337552_337840_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	45.3	1.3e-19
WP_012478871.1|337898_338201_+	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	39.3	1.9e-08
WP_012478872.1|338258_338582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044569408.1|338661_339069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012478874.1|339662_340433_+	DUF3011 domain-containing protein	NA	NA	NA	NA	NA
WP_012478875.1|340492_341437_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_005407709.1|341541_342462_+	arginase	NA	A0A0N9R043	Chrysochromulina_ericina_virus	33.6	6.4e-28
WP_005407710.1|342622_342760_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_004153772.1|342967_343189_+	CsbD family protein	NA	NA	NA	NA	NA
WP_012478876.1|343262_344072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012478877.1|344180_345473_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
345512:345536	attR	TGCCGGCCAGCGGCCGGCACTACCA	NA	NA	NA	NA
>prophage 2
NC_010943	Stenotrophomonas maltophilia K279a, complete genome	4851126	663604	674734	4851126		Enterobacteria_phage(42.86%)	8	NA	NA
WP_012479083.1|663604_664660_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	46.2	2.4e-79
WP_012479084.1|664674_665562_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.9	9.7e-98
WP_012479085.1|665558_666116_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	51.1	5.4e-46
WP_012479086.1|666112_667018_+	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	36.2	4.1e-27
WP_143568537.1|667210_668506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012479088.1|668558_669962_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	28.1	2.9e-40
WP_012479089.1|669973_671320_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.6	2.2e-29
WP_012479090.1|671416_674734_-	DEAD/DEAH box helicase	NA	A0A0P0YNJ0	Yellowstone_lake_phycodnavirus	34.7	1.1e-45
>prophage 3
NC_010943	Stenotrophomonas maltophilia K279a, complete genome	4851126	1036107	1150530	4851126	plate,transposase,protease,tail	Escherichia_phage(17.86%)	106	NA	NA
WP_004154600.1|1036107_1037397_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.0	2.9e-135
WP_012479268.1|1037540_1039988_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.0	1.5e-220
WP_005408270.1|1040205_1040478_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	62.9	4.5e-22
WP_005408271.1|1041318_1043274_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_044569572.1|1043486_1044686_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_012479270.1|1044682_1045447_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_012479271.1|1045458_1046109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005408275.1|1046122_1046575_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	53.4	1.0e-42
WP_012479272.1|1046579_1047311_+	DNA polymerase III subunit epsilon	NA	A0A1B2LRV5	Wolbachia_phage	42.4	3.8e-07
WP_005408277.1|1047422_1048127_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_044569573.1|1048789_1051801_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_005408281.1|1052092_1052497_+	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.3	1.3e-17
WP_012479274.1|1052574_1053621_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_012479275.1|1053641_1054391_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_005408284.1|1054390_1055158_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_012479276.1|1055154_1055544_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_005408286.1|1056019_1056337_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_012479277.1|1056695_1067600_+	autotransporter-associated beta strand repeat-containing protein	NA	NA	NA	NA	NA
WP_012479278.1|1067656_1068100_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_049442234.1|1068859_1069990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012479281.1|1070067_1071207_-	DNA adenine methylase	NA	NA	NA	NA	NA
WP_012479282.1|1071792_1073826_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	41.4	2.1e-47
WP_005408298.1|1073832_1074153_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_005408299.1|1074264_1074864_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_005408300.1|1074931_1075291_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_005408301.1|1075368_1075896_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_012479283.1|1075892_1077842_-	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_043033683.1|1077834_1078779_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_005408304.1|1078781_1079735_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012479285.1|1079777_1081619_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_012479286.1|1081848_1082418_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_012479287.1|1082531_1083041_+	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_005408308.1|1083148_1083343_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_005408309.1|1083434_1084412_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_005408310.1|1084490_1085273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012479288.1|1085529_1086474_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_012479289.1|1086556_1087300_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.3	6.2e-13
WP_005408313.1|1087452_1087692_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	4.6e-10
WP_012479290.1|1087835_1089098_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_012479291.1|1089312_1090677_+	aminodeoxychorismate synthase component I	NA	NA	NA	NA	NA
WP_012479292.1|1090874_1091936_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_005412450.1|1091932_1092598_+	dTMP kinase	NA	W8D0J5	Erwinia_phage	34.9	5.5e-21
WP_012479293.1|1092594_1093551_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_005412452.1|1093547_1093901_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_005408320.1|1094320_1094701_+	tautomerase family protein	NA	NA	NA	NA	NA
WP_049397149.1|1094731_1095805_-|tail	phage tail protein	tail	D5LGY1	Escherichia_phage	51.9	2.5e-95
WP_005408322.1|1095795_1096011_-|tail	tail protein X	tail	A0A193GYC8	Enterobacter_phage	54.3	1.6e-14
WP_005408323.1|1095994_1096462_-|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	35.2	1.1e-15
WP_012479295.1|1096464_1098912_-|tail	phage tail tape measure protein	tail	A0A1W6JT50	Escherichia_phage	22.7	2.2e-27
WP_012479296.1|1099032_1099323_-|tail	phage tail assembly protein	tail	A0A193GYZ8	Enterobacter_phage	57.3	5.5e-18
WP_012479297.1|1099403_1099907_-|tail	phage major tail tube protein	tail	A0A193GYM4	Enterobacter_phage	50.3	5.2e-40
WP_012479298.1|1099909_1101112_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A088FVH5	Escherichia_phage	54.2	6.1e-127
WP_012479299.1|1101218_1101878_-	hypothetical protein	NA	V9IQM3	Stenotrophomonas_phage	32.9	6.2e-17
WP_012479300.1|1101879_1103847_-|tail	tail fiber domain-containing protein	tail	V9IQX0	Stenotrophomonas_phage	38.8	1.8e-104
WP_012479301.1|1103854_1104634_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	51.1	7.1e-44
WP_012479302.1|1104626_1105523_-|plate	baseplate J/gp47 family protein	plate	V9IQV9	Stenotrophomonas_phage	53.1	1.9e-80
WP_005408332.1|1105525_1105864_-	GPW/gp25 family protein	NA	A0A193GYY8	Enterobacter_phage	62.2	7.8e-32
WP_012479303.1|1105916_1106507_-|plate	phage baseplate assembly protein V	plate	A0A193GYL5	Enterobacter_phage	38.2	1.9e-25
WP_012479304.1|1106503_1107058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158079763.1|1107183_1107327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012479305.1|1107411_1107789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012479306.1|1107785_1108271_-	glycoside hydrolase family 104 protein	NA	D5LH07	Escherichia_phage	55.6	5.4e-42
WP_012479307.1|1108267_1108618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005408338.1|1108614_1109064_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005408339.1|1109398_1109782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012479309.1|1109934_1110573_-	hypothetical protein	NA	A0A2H4J8A1	uncultured_Caudovirales_phage	38.8	5.8e-20
WP_005412468.1|1110614_1110842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012479310.1|1110916_1111192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012479311.1|1111192_1113529_-	toprim domain-containing protein	NA	D5LH15	Escherichia_phage	43.3	3.7e-136
WP_005408344.1|1114015_1114240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012479313.1|1114251_1114506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005412471.1|1114717_1115104_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_012479315.1|1115233_1117372_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012479316.1|1117383_1118889_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_012479317.1|1118898_1120032_-	MFS transporter	NA	NA	NA	NA	NA
WP_012479318.1|1120043_1120820_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_044569588.1|1120977_1121625_+	Qnr family pentapeptide repeat protein	NA	NA	NA	NA	NA
WP_012479320.1|1121628_1122303_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_044569589.1|1122390_1123089_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_012479322.1|1123204_1124149_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012479323.1|1124087_1125467_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_012479324.1|1125600_1126464_+	DMT family transporter	NA	NA	NA	NA	NA
WP_012479325.1|1126503_1127439_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	21.2	5.8e-08
WP_044569590.1|1127546_1129064_+	MFS transporter	NA	NA	NA	NA	NA
WP_033834825.1|1129343_1129748_-	GFA family protein	NA	NA	NA	NA	NA
WP_044569600.1|1129919_1130897_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_012479329.1|1130893_1132915_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012479330.1|1133003_1134425_-	MFS transporter	NA	NA	NA	NA	NA
WP_012479331.1|1134454_1134889_+	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_012479332.1|1134961_1135564_-	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_012479333.1|1135662_1136538_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012479334.1|1136714_1137536_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_012479335.1|1137554_1138232_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_004147099.1|1138319_1139357_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_005408369.1|1139457_1140600_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_005412488.1|1140807_1141791_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_005412489.1|1141838_1142738_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012479096.1|1142966_1143881_-|transposase	IS110-like element ISStma7 family transposase	transposase	Q75QL1	Wolbachia_phage	33.8	8.7e-25
WP_012479336.1|1144286_1144499_+	DUF4287 domain-containing protein	NA	NA	NA	NA	NA
WP_024956077.1|1144609_1145317_+	YitT family protein	NA	NA	NA	NA	NA
WP_012479338.1|1145400_1145946_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_044569607.1|1145942_1147730_-	DUF4153 domain-containing protein	NA	NA	NA	NA	NA
WP_005408377.1|1147821_1148388_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_005408378.1|1148380_1148875_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_005412492.1|1148890_1149841_+	aspartate carbamoyltransferase catalytic subunit	NA	NA	NA	NA	NA
WP_005408380.1|1150038_1150530_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_010943	Stenotrophomonas maltophilia K279a, complete genome	4851126	1896445	1938041	4851126	portal,tRNA,terminase,capsid,tail,head,transposase	Acidithiobacillus_phage(37.84%)	54	NA	NA
WP_087944428.1|1896445_1897586_+|transposase	IS3-like element ISStma9 family transposase	transposase	U5P429	Shigella_phage	60.6	7.4e-90
WP_148272145.1|1897698_1898142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012479804.1|1898134_1899376_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_148272146.1|1899863_1900670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012479806.1|1900666_1901125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080047724.1|1901197_1901437_-	glycoside hydrolase family protein	NA	K4I410	Acidithiobacillus_phage	77.0	2.0e-18
WP_012479807.1|1901438_1901939_-	hypothetical protein	NA	A0A077K9R7	Ralstonia_phage	50.0	1.7e-27
WP_012479808.1|1901935_1902439_-	lysozyme	NA	A0A0A8KXN5	Burkholderia_phage	40.6	2.3e-19
WP_044569883.1|1902435_1902663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012479809.1|1902659_1902962_-	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	70.2	7.0e-24
WP_012479810.1|1903025_1903376_-	DUF2793 domain-containing protein	NA	A0A172PZV5	Pseudomonas_phage	62.9	2.4e-36
WP_012479811.1|1903375_1905649_-|tail	tail assembly protein	tail	A0A1L2C8W7	Pseudomonas_phage	38.8	4.2e-137
WP_012479812.1|1905648_1905861_-	hypothetical protein	NA	A0A1X9IAJ5	Xanthomonas_phage	54.8	9.6e-12
WP_009518720.1|1905857_1906085_-	hypothetical protein	NA	A0A2K8HRJ9	Pseudomonas_phage	65.9	2.5e-10
WP_012479813.1|1906104_1906893_-	phage BR0599 family protein	NA	A0A0A1IX16	Pseudomonas_phage	33.1	1.5e-28
WP_044569890.1|1906895_1908458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012479815.1|1908454_1909513_-	hypothetical protein	NA	K4JSI9	Caulobacter_virus	24.4	2.0e-09
WP_012479816.1|1909518_1912215_-|tail	tail protein	tail	A0A0F7L9V3	uncultured_marine_virus	35.3	4.7e-26
WP_012479817.1|1912214_1912856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153305628.1|1912860_1913019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044569892.1|1913045_1913435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012479819.1|1913446_1914199_-	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	49.6	2.7e-56
WP_012479820.1|1914201_1914390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044569895.1|1914397_1914823_-	hypothetical protein	NA	F4YCS3	Synechococcus_phage	28.8	6.9e-09
WP_044571268.1|1914833_1915115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012479822.1|1915117_1916122_-|capsid	major capsid protein	capsid	Q9JMM2	Wolbachia_phage	71.4	7.3e-142
WP_012479823.1|1916124_1916502_-|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	54.0	6.9e-29
WP_012479824.1|1916503_1917712_-	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	40.9	3.2e-67
WP_012479825.1|1917722_1919210_-|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	56.6	1.8e-149
WP_012479826.1|1919211_1919433_-	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	57.5	5.3e-13
WP_012479827.1|1919432_1919825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012479828.1|1919824_1920313_-	hypothetical protein	NA	A0A0F6WCR7	Sinorhizobium_phage	47.7	7.1e-26
WP_044569900.1|1920324_1922274_-|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	87.7	0.0e+00
WP_012479830.1|1922350_1922935_-	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	56.7	9.4e-49
WP_012479831.1|1923045_1923252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012479832.1|1923358_1923877_+	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	72.0	6.6e-30
WP_012479833.1|1923972_1924338_+	hypothetical protein	NA	A0A2H4JI44	uncultured_Caudovirales_phage	81.5	1.8e-53
WP_044569905.1|1924337_1924544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087944431.1|1924747_1926320_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	5.1e-09
WP_148272147.1|1926511_1926910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012479837.1|1926923_1928171_-	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	88.2	2.8e-215
WP_044569908.1|1928167_1929583_-	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	62.8	6.2e-171
WP_044569912.1|1929929_1930358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012479840.1|1930350_1930560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012479841.1|1930561_1931038_-	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	77.5	3.8e-64
WP_012479842.1|1931169_1933470_-	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	72.4	0.0e+00
WP_012479843.1|1933466_1933721_-	hypothetical protein	NA	K4I1D6	Acidithiobacillus_phage	69.1	4.4e-19
WP_012479844.1|1933717_1934455_-|tRNA	isoleucyl-tRNA synthetase	tRNA	K4HZA0	Acidithiobacillus_phage	75.4	3.0e-108
WP_044571296.1|1934465_1934942_-	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	70.7	5.1e-61
WP_012479846.1|1935021_1935663_-	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	70.2	6.6e-80
WP_044569915.1|1935668_1936523_-	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	69.9	7.6e-108
WP_012479848.1|1936522_1937284_-	hypothetical protein	NA	K4I1D2	Acidithiobacillus_phage	67.5	3.0e-87
WP_044569917.1|1937289_1937766_-	hypothetical protein	NA	K4HZ96	Acidithiobacillus_phage	65.2	1.5e-52
WP_012479850.1|1937777_1938041_-	hypothetical protein	NA	K4I3X3	Acidithiobacillus_phage	60.9	2.3e-23
>prophage 5
NC_010943	Stenotrophomonas maltophilia K279a, complete genome	4851126	1941863	1950516	4851126	integrase	Acidithiobacillus_phage(62.5%)	11	1942717:1942731	1951527:1951541
WP_044569920.1|1941863_1942055_+	hypothetical protein	NA	K4HZ94	Acidithiobacillus_phage	79.4	2.6e-16
WP_012479855.1|1942054_1942510_+	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	66.0	4.6e-51
WP_012479856.1|1942506_1943877_+	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	78.0	1.0e-207
1942717:1942731	attL	CCGGGCTTGAAGCGC	NA	NA	NA	NA
WP_012479857.1|1943873_1944242_+	hypothetical protein	NA	K4HZX2	Acidithiobacillus_phage	70.8	2.0e-41
WP_012479858.1|1944253_1944733_+	hypothetical protein	NA	K4I1C7	Acidithiobacillus_phage	42.0	8.2e-27
WP_099497841.1|1945570_1946305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012479860.1|1946294_1947431_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	27.9	5.5e-29
WP_005409154.1|1947487_1948663_-|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	48.5	1.2e-90
WP_005409155.1|1948605_1948884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005409158.1|1949459_1949687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005409159.1|1949778_1950516_-	hypothetical protein	NA	A0A249XQ08	Mycobacterium_phage	33.0	5.3e-25
1951527:1951541	attR	CCGGGCTTGAAGCGC	NA	NA	NA	NA
>prophage 6
NC_010943	Stenotrophomonas maltophilia K279a, complete genome	4851126	2446088	2508751	4851126	transposase,integrase	uncultured_Caudovirales_phage(45.45%)	59	2444491:2444506	2510845:2510860
2444491:2444506	attL	GGCGGTATCCGCACTC	NA	NA	NA	NA
WP_012480192.1|2446088_2447429_-|transposase	ISL3-like element ISStma11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	38.9	7.8e-75
WP_087944433.1|2448184_2449307_+|transposase	IS3-like element ISStma13 family transposase	transposase	S5WIU1	Leptospira_phage	40.4	7.6e-47
WP_012480196.1|2449349_2450396_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012480197.1|2450459_2450807_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012480198.1|2450838_2452062_-	MFS transporter	NA	NA	NA	NA	NA
WP_012480199.1|2452092_2452512_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	63.7	3.6e-42
WP_012480200.1|2452508_2453249_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.5	4.3e-83
WP_012480201.1|2453290_2453605_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012480202.1|2453632_2454124_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	41.7	1.1e-23
WP_012480203.1|2454144_2455203_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_012480204.1|2455206_2456193_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.7	1.0e-63
WP_026070021.1|2456217_2457291_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	58.7	3.8e-88
WP_012480206.1|2457541_2457985_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012480207.1|2458228_2458624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012480208.1|2458697_2460002_+	TolC family protein	NA	NA	NA	NA	NA
WP_012480209.1|2459998_2461513_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005413407.1|2461509_2464650_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_012480210.1|2464754_2465585_-	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_005995736.1|2465611_2466001_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005413410.1|2465969_2466176_+	arginase family protein	NA	NA	NA	NA	NA
WP_005995733.1|2466205_2466757_-	DUF305 domain-containing protein	NA	NA	NA	NA	NA
WP_005413412.1|2466831_2467107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100437323.1|2467135_2469220_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.2	2.8e-87
WP_012480212.1|2469518_2470460_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_005413416.1|2470470_2470854_-	copper homeostasis periplasmic binding protein CopC	NA	NA	NA	NA	NA
WP_012480213.1|2471032_2471383_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_019184727.1|2471453_2471819_-	DUF411 domain-containing protein	NA	NA	NA	NA	NA
WP_005995720.1|2471992_2472547_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_019184728.1|2472521_2473274_-	cytochrome c	NA	NA	NA	NA	NA
WP_005413421.1|2473304_2474573_-	copper-binding protein CopB	NA	NA	NA	NA	NA
WP_012480217.1|2474569_2476438_-	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_012480218.1|2476551_2476971_-	transcriptional regulator CopL	NA	NA	NA	NA	NA
WP_043033515.1|2477145_2477496_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012480222.1|2478398_2479451_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_012480223.1|2479725_2481306_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_012480224.1|2481283_2482381_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_019184735.1|2482396_2482672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019184736.1|2482668_2485860_-	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
WP_012480226.1|2485868_2486819_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012480227.1|2486815_2488093_-	TolC family protein	NA	NA	NA	NA	NA
WP_012480228.1|2488148_2488505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005413376.1|2488501_2489119_-	cation transporter	NA	NA	NA	NA	NA
WP_012480229.1|2489143_2491102_-	FTR1 family protein	NA	NA	NA	NA	NA
WP_012480230.1|2491192_2491606_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005413373.1|2491602_2492874_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012480231.1|2492898_2495892_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	26.4	2.4e-76
WP_012480232.1|2496035_2496236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012480233.1|2496679_2497138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012480234.1|2497188_2499114_-	DUF4209 domain-containing protein	NA	NA	NA	NA	NA
WP_012480235.1|2499091_2499565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012480236.1|2499551_2499989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012480237.1|2499985_2500930_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_044570177.1|2501035_2502115_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_012480239.1|2502268_2505232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080047726.1|2505233_2505848_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_080047727.1|2506008_2506545_+	DUF1508 domain-containing protein	NA	A0A2P1N580	Mycobacterium_phage	57.5	6.9e-06
WP_012480241.1|2506713_2507349_+	hypothetical protein	NA	A0A2H4J137	uncultured_Caudovirales_phage	45.4	5.6e-47
WP_148272149.1|2507345_2507621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087944427.1|2507594_2508751_-|transposase	IS3-like element ISStma5 family transposase	transposase	NA	NA	NA	NA
2510845:2510860	attR	GAGTGCGGATACCGCC	NA	NA	NA	NA
