The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_010688	Xanthomonas campestris pv. campestris, complete genome	5079002	629054	691361	5079002	plate,transposase	Leptospira_phage(50.0%)	49	NA	NA
WP_087942062.1|629054_629852_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012437231.1|631613_632696_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	48.9	2.8e-83
WP_173376891.1|633139_633898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011038672.1|634062_635577_-	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_012437233.1|635744_637922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012437234.1|638295_640752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012437235.1|640962_641880_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_012437236.1|641879_642398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011038677.1|642873_643383_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_012437238.1|643395_644421_+	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_012437240.1|644954_647483_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_012437241.1|647514_649137_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_012437242.1|649133_649454_+	DUF3649 domain-containing protein	NA	NA	NA	NA	NA
WP_016945020.1|649441_649801_+	DUF3325 domain-containing protein	NA	NA	NA	NA	NA
WP_012437244.1|649990_652804_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_029217124.1|652886_653600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012437246.1|654991_655549_-	VUT family protein	NA	A0A2I7SAW6	Vibrio_phage	31.8	4.6e-13
WP_011038686.1|655777_656281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012437247.1|656277_657138_-	DUF2145 domain-containing protein	NA	NA	NA	NA	NA
WP_011038688.1|657184_658132_-	mitochondrial fission ELM1 family protein	NA	NA	NA	NA	NA
WP_011038689.1|658267_658858_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_012437248.1|658948_659671_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_011038691.1|659894_660683_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_012437249.1|660796_661330_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011038693.1|661527_663174_+	malonate decarboxylase subunit alpha	NA	NA	NA	NA	NA
WP_011038694.1|663183_663501_+	malonate decarboxylase acyl carrier protein	NA	NA	NA	NA	NA
WP_029217125.1|663940_664837_+	biotin-independent malonate decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_012437250.1|664833_665538_+	biotin-independent malonate decarboxylase subunit gamma	NA	NA	NA	NA	NA
WP_011038697.1|665540_666182_+	malonate decarboxylase holo-[acyl-carrier-protein] synthase	NA	NA	NA	NA	NA
WP_011038698.1|666505_667345_+	triphosphoribosyl-dephospho-CoA synthase MdcB	NA	NA	NA	NA	NA
WP_012437252.1|667508_668429_+	malonate decarboxylase subunit epsilon	NA	NA	NA	NA	NA
WP_012437253.1|668518_669874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011038701.1|669953_670673_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011038702.1|671889_672513_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011038703.1|672605_673025_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011038704.1|673021_673453_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_012437255.1|673453_675514_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_029216812.1|675640_676300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012437257.1|676296_677613_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_012437258.1|678000_679002_+	glycosyl hydrolase 53 family protein	NA	NA	NA	NA	NA
WP_012437259.1|679378_682066_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_011038710.1|682290_683985_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_012437260.1|684240_685449_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_157382676.1|685493_686571_+|transposase	IS3-like element IS1404 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.4e-44
WP_087942064.1|686598_687731_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	3.7e-49
WP_043890231.1|687887_688352_+	DUF4411 family protein	NA	NA	NA	NA	NA
WP_012437263.1|688396_689611_-|transposase	IS4-like element IS1481A family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	31.5	3.5e-50
WP_087942065.1|689885_690993_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.9	2.9e-43
WP_011038664.1|690950_691361_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
>prophage 2
NC_010688	Xanthomonas campestris pv. campestris, complete genome	5079002	2743332	2817405	5079002	protease,transposase	Leptospira_phage(33.33%)	54	NA	NA
WP_087942079.1|2743332_2744131_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012438430.1|2744361_2745753_-	alginate export family protein	NA	NA	NA	NA	NA
WP_012438431.1|2745759_2746650_-	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_011037215.1|2746949_2747258_-	XapX domain-containing protein	NA	NA	NA	NA	NA
WP_043890335.1|2748888_2750997_+	CHASE3 domain-containing protein	NA	NA	NA	NA	NA
WP_012438434.1|2751521_2751890_-	response regulator	NA	NA	NA	NA	NA
WP_012438435.1|2751964_2753290_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_012438436.1|2753362_2753647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012438437.1|2753693_2754395_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016944917.1|2754382_2756086_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_012438442.1|2758129_2758981_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_012438443.1|2759294_2762255_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_012438445.1|2763415_2764471_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_012438446.1|2764794_2765070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016944913.1|2765066_2767316_-	MCP four helix bundle domain-containing protein	NA	NA	NA	NA	NA
WP_012438450.1|2768503_2768728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129589014.1|2768724_2769078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012438451.1|2769074_2769797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012438452.1|2769845_2770496_-	conjugal transfer protein TrbP	NA	A0A077JBM8	Xanthomonas_phage	49.8	1.0e-48
WP_012438453.1|2770623_2772417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012438454.1|2772430_2773030_-	NfuA family Fe-S biogenesis protein	NA	NA	NA	NA	NA
WP_012438455.1|2773122_2773479_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_012438456.1|2773475_2773898_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011037238.1|2774025_2774844_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_012438457.1|2775224_2776208_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_012438458.1|2776610_2780195_+	ribonuclease E	NA	NA	NA	NA	NA
WP_011037241.1|2780760_2781408_-	response regulator	NA	NA	NA	NA	NA
WP_012438460.1|2781623_2782385_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_012438461.1|2782418_2782784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016944902.1|2782844_2783276_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_012438463.1|2783287_2784541_+	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_012438464.1|2784524_2785817_-	nucleotide sugar dehydrogenase	NA	M1HEP0	Acanthocystis_turfacea_Chlorella_virus	30.1	2.7e-24
WP_102650941.1|2786297_2787400_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.2e-43
WP_074038421.1|2788945_2789593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012438467.1|2789683_2791021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011037256.1|2791259_2792225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011037257.1|2792311_2793493_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_016944204.1|2793485_2795591_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_087942069.1|2798040_2799172_+|transposase	IS3-like element IS476 family transposase	transposase	S5WIU1	Leptospira_phage	44.1	3.8e-54
WP_015471948.1|2799505_2799718_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_012438469.1|2799764_2800640_+	ParA family protein	NA	NA	NA	NA	NA
WP_012438470.1|2800623_2800884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012438471.1|2800876_2802520_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_011269741.1|2802535_2803096_+	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
WP_012438472.1|2803099_2804326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011269739.1|2804647_2805403_+	TIGR03761 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_012438473.1|2805399_2805933_+	DUF3158 family protein	NA	NA	NA	NA	NA
WP_012438474.1|2806006_2806447_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_012438475.1|2806726_2808739_+	DNA topoisomerase III	NA	A0A0G2Y787	Acanthamoeba_polyphaga_mimivirus	23.6	5.8e-13
WP_012438478.1|2810603_2811263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029217090.1|2811289_2812468_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_012438480.1|2812529_2813573_-	sulfotransferase	NA	NA	NA	NA	NA
WP_012438481.1|2813565_2814432_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_087942071.1|2816260_2817405_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	58.8	1.8e-88
>prophage 3
NC_010688	Xanthomonas campestris pv. campestris, complete genome	5079002	3028922	3070169	5079002	integrase,transposase	Ralstonia_phage(33.33%)	35	3056795:3056816	3070171:3070192
WP_012438608.1|3028922_3030113_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A077KET4	Ralstonia_phage	48.4	6.3e-92
WP_029217188.1|3030285_3030492_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_012438610.1|3030488_3030869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012438611.1|3030872_3034397_+	hypothetical protein	NA	Q6R4V1	Vibrio_virus	25.4	1.9e-27
WP_012438612.1|3034623_3035124_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_029217187.1|3035961_3036690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012438615.1|3036689_3037067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016945205.1|3037311_3037791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012438617.1|3037787_3038027_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_012438618.1|3038429_3039230_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_012438619.1|3039431_3040112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012438620.1|3040286_3040628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012438621.1|3040680_3042276_-	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_157382685.1|3042543_3042717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012438063.1|3042769_3043750_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.7e-98
WP_087942069.1|3045396_3046529_-|transposase	IS3-like element IS476 family transposase	transposase	S5WIU1	Leptospira_phage	44.1	3.8e-54
WP_012438623.1|3046579_3046888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005989438.1|3046884_3047874_+	caspase family protein	NA	NA	NA	NA	NA
WP_012438624.1|3048380_3049031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005997387.1|3053130_3053790_-	DUF1629 domain-containing protein	NA	NA	NA	NA	NA
WP_005995347.1|3054636_3054885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011035783.1|3055329_3056697_-|transposase	IS5-like element IS1478 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	63.6	2.8e-80
3056795:3056816	attL	GGGGGTTTTTCAGGGGCGACTA	NA	NA	NA	NA
WP_012438629.1|3057276_3057591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012438630.1|3057645_3058407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029217050.1|3058515_3058869_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016945350.1|3058908_3060249_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_012438633.1|3060245_3061202_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_012438634.1|3061416_3062817_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_005997165.1|3063366_3063963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029217237.1|3063962_3064592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005997167.1|3065327_3065969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005997168.1|3066389_3066614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005991142.1|3067013_3067493_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_005991140.1|3067563_3067764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011035783.1|3068801_3070169_+|transposase	IS5-like element IS1478 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	63.6	2.8e-80
3070171:3070192	attR	GGGGGTTTTTCAGGGGCGACTA	NA	NA	NA	NA
>prophage 4
NC_010688	Xanthomonas campestris pv. campestris, complete genome	5079002	3236494	3255393	5079002	integrase,transposase	Leptospira_phage(50.0%)	17	3228601:3228617	3262364:3262380
3228601:3228617	attL	TCCGCCCACCTCCACCA	NA	NA	NA	NA
WP_011036647.1|3236494_3237643_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012438743.1|3237927_3239460_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_012438744.1|3239476_3241360_+	DUF4209 domain-containing protein	NA	NA	NA	NA	NA
WP_012438745.1|3241417_3242386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012438746.1|3242378_3242636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087942073.1|3242634_3243766_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.4e-48
WP_012438749.1|3245949_3246765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012438750.1|3246931_3248518_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_029216811.1|3248773_3249070_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012438752.1|3249241_3249553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012438753.1|3249592_3249985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012438754.1|3250049_3250772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012438755.1|3250908_3251133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087942074.1|3251439_3252548_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.7	4.5e-44
WP_012438758.1|3252804_3253131_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_087942063.1|3253159_3254304_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	58.8	3.1e-88
WP_012438063.1|3254412_3255393_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.7e-98
3262364:3262380	attR	TCCGCCCACCTCCACCA	NA	NA	NA	NA
>prophage 5
NC_010688	Xanthomonas campestris pv. campestris, complete genome	5079002	3763459	3803303	5079002	protease,head,transposase	Bacillus_phage(25.0%)	33	NA	NA
WP_012439024.1|3763459_3764323_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_011036250.1|3764322_3765465_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_011036249.1|3766430_3766817_-	response regulator	NA	W8CYM9	Bacillus_phage	31.8	7.4e-10
WP_012439025.1|3767133_3768042_-	DnaJ domain-containing protein	NA	F2Y2Y5	Organic_Lake_phycodnavirus	45.2	1.4e-06
WP_011036247.1|3768184_3768661_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_011036246.1|3768821_3769304_+	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	39.5	4.9e-27
WP_011036245.1|3769346_3769907_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_029629024.1|3770534_3772889_-	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_011036243.1|3773062_3773902_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_012439027.1|3773971_3774919_-	glycerophosphodiester phosphodiesterase family protein	NA	A0A0S2MYI4	Enterococcus_phage	36.8	5.8e-08
WP_012439028.1|3775022_3778127_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011036240.1|3778328_3778796_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011036240.1|3779168_3779636_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_029217072.1|3779990_3784907_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_012439032.1|3785674_3786676_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_012439033.1|3786749_3788966_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012439034.1|3789220_3790420_-	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_012439035.1|3790513_3790831_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_019237897.1|3790827_3791070_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_012439037.1|3791156_3793751_-	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_011036232.1|3793963_3795118_-	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_012439038.1|3795193_3796090_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_011036230.1|3796235_3797837_+	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
WP_014506900.1|3797933_3798263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016944827.1|3798470_3798677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139145255.1|3799153_3799372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016944826.1|3799414_3799699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012439043.1|3799752_3800040_-	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_016944825.1|3800264_3800429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016944824.1|3800651_3800888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012439046.1|3800880_3801315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012439047.1|3801328_3801796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172973905.1|3802631_3803303_+|head	head decoration protein	head	NA	NA	NA	NA
>prophage 6
NC_010688	Xanthomonas campestris pv. campestris, complete genome	5079002	4230200	4236583	5079002		Enterobacteria_phage(50.0%)	6	NA	NA
WP_012439274.1|4230200_4231547_+	phosphohexose mutase	NA	A0A127AWJ1	Bacillus_phage	26.6	3.1e-31
WP_012439275.1|4231592_4232996_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.1	5.0e-48
WP_012439276.1|4233117_4234026_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	33.6	3.7e-28
WP_011035866.1|4234022_4234580_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	49.4	4.3e-43
WP_012439277.1|4234576_4235464_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	57.8	1.2e-95
WP_012439278.1|4235527_4236583_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.6	4.0e-82
