The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_010554	Proteus mirabilis HI4320, complete genome	4063606	479796	491140	4063606		Mycobacterium_phage(25.0%)	12	NA	NA
WP_004246075.1|479796_480996_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
WP_012367584.1|481604_482573_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.0	5.9e-133
WP_004252248.1|482598_484725_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	1.5e-205
WP_004246072.1|484753_485158_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	3.7e-12
WP_004246071.1|485169_485394_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
WP_004246069.1|485675_486149_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004246068.1|486346_486556_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
WP_004246058.1|487013_487388_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
WP_004246057.1|487403_488369_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_004246056.1|488470_489115_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026090527.1|489466_489730_-	YbeD family protein	NA	NA	NA	NA	NA
WP_004246054.1|489928_491140_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.1	8.6e-105
>prophage 2
NC_010554	Proteus mirabilis HI4320, complete genome	4063606	527076	573949	4063606	lysis,tail,integrase	Proteus_phage(19.05%)	73	526990:527008	580859:580877
526990:527008	attL	CTGCTTATTGGATTATAGT	NA	NA	NA	NA
WP_012367594.1|527076_528078_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	44.0	3.7e-69
WP_012367595.1|528034_528280_-	excisionase	NA	NA	NA	NA	NA
WP_004247455.1|528276_528615_-	DUF2591 domain-containing protein	NA	A0A1P8DTH6	Proteus_phage	45.0	5.6e-14
WP_012367596.1|528607_528784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012367598.1|528990_529716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036908297.1|529744_530278_-	hypothetical protein	NA	J9Q748	Salmonella_phage	46.8	8.8e-38
WP_012367600.1|530287_530467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012367601.1|530494_530689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012367602.1|530728_530905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012367603.1|531419_532226_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	95.1	1.6e-139
WP_012367604.1|532218_533037_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A1P8DTH1	Proteus_phage	96.7	1.3e-157
WP_012367605.1|533033_533288_-	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	94.0	4.6e-37
WP_012367607.1|533555_533711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012367608.1|533799_534027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012367609.1|534149_534425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012367610.1|534592_534808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012367611.1|534804_535020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036972282.1|535179_535311_-	hypothetical protein	NA	A0A0N7C2P4	Escherichia_phage	59.5	5.3e-05
WP_012367613.1|535489_535768_-	hypothetical protein	NA	A0A1P8DTK1	Proteus_phage	76.3	5.6e-28
WP_012367614.1|536290_536596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012367615.1|536626_537328_-	helix-turn-helix transcriptional regulator	NA	G8C7L8	Escherichia_phage	46.7	2.6e-45
WP_012367616.1|537435_537621_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004247478.1|537741_538089_+	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	72.9	8.3e-37
WP_004251793.1|538184_538358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012367617.1|538354_539122_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	51.9	1.5e-22
WP_012367618.1|539121_540507_+	helicase	NA	Q716D2	Shigella_phage	47.7	1.0e-114
WP_012367619.1|540532_540982_+	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	32.2	3.7e-13
WP_012367620.1|541060_541351_+	DUF1364 domain-containing protein	NA	A0A2H4JIC4	uncultured_Caudovirales_phage	68.1	1.2e-33
WP_004245983.1|541347_541704_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	71.6	3.2e-44
WP_004247487.1|541703_542336_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	34.3	7.3e-23
WP_004247148.1|542646_543168_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_004247488.1|543326_543749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004251611.1|543802_544072_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	52.3	6.7e-18
WP_012367622.1|544071_544542_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	63.2	1.5e-49
WP_012367623.1|544523_544682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012367624.1|544684_545146_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	45.8	6.3e-24
WP_004247494.1|545493_546078_+	Bro-N domain-containing protein	NA	Q3LZN7	Bacteriophage	48.2	2.0e-22
WP_004245978.1|546277_546436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628804.1|546469_547072_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	68.5	2.1e-64
WP_012367627.1|547074_548562_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	89.0	5.9e-265
WP_012367628.1|548561_549932_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	48.8	9.0e-119
WP_012367629.1|549928_551050_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	51.0	6.7e-104
WP_012367630.1|551161_551923_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.3	2.0e-67
WP_012367631.1|551936_552890_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	71.2	5.3e-126
WP_107033975.1|552892_553177_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_012367632.1|553216_553696_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	47.7	3.8e-32
WP_004245967.1|553698_554049_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	45.1	3.8e-21
WP_004245966.1|554050_554632_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	51.6	1.0e-47
WP_004245963.1|554628_555030_+	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_004247505.1|555075_555732_+|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	57.7	8.6e-59
WP_004245960.1|555783_556089_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	55.4	6.6e-22
WP_049195199.1|556103_556391_+	DUF1799 domain-containing protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	49.3	6.9e-13
WP_012367634.1|556616_556850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012367635.1|556856_557666_+	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	33.3	1.8e-21
WP_012367636.1|557916_558750_-	phage antirepressor N-terminal domain-containing protein	NA	I6S627	Salmonella_phage	55.6	7.5e-68
WP_004245955.1|558819_558981_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_012367637.1|559094_559352_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_004245953.1|559452_560298_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	36.0	1.2e-31
WP_012367638.1|560284_560704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012367639.1|560696_561365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012367640.1|561462_562116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012367641.1|562175_565115_+|tail	phage tail tape measure protein	tail	A0A2P0WA05	Enterobacter_phage	34.6	6.2e-141
WP_004247512.1|565137_565350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247513.1|565389_565680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245944.1|565699_565900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012367642.1|566043_566385_+|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	48.2	7.7e-27
WP_012367643.1|566381_567125_+|tail	phage minor tail protein L	tail	K7PJS0	Enterobacterial_phage	59.4	8.4e-87
WP_012367644.1|567121_567832_+	C40 family peptidase	NA	A0A1P8DTI6	Proteus_phage	60.8	5.8e-85
WP_004245938.1|567828_568416_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	59.9	1.4e-57
WP_012367645.1|568467_572661_+	DUF1983 domain-containing protein	NA	F1C571	Cronobacter_phage	54.5	1.0e-301
WP_004245936.1|572654_573023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012367646.1|573024_573639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247524.1|573688_573949_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	57.4	1.9e-17
580859:580877	attR	CTGCTTATTGGATTATAGT	NA	NA	NA	NA
>prophage 3
NC_010554	Proteus mirabilis HI4320, complete genome	4063606	748837	827369	4063606	protease,tRNA,plate	Bacillus_phage(23.53%)	57	NA	NA
WP_004244558.1|748837_749152_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.1	1.5e-13
WP_004244559.1|749182_751477_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	1.3e-170
WP_004244560.1|751596_751815_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_012367702.1|752134_752827_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_012367703.1|752828_754580_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	22.8	6.8e-18
WP_012367704.1|754582_756352_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.5	5.0e-21
WP_004247618.1|756493_757453_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.8	1.2e-64
WP_004244566.1|757995_758490_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_012367705.1|758617_762421_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.3	1.7e-90
WP_004244569.1|762533_763139_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_012367706.1|763149_764499_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	1.8e-79
WP_004244571.1|764632_765922_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.2	4.1e-97
WP_004244572.1|766101_766434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012367707.1|766834_767884_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_004244574.1|767956_768862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244575.1|769219_769960_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.0	2.3e-20
WP_004244576.1|770067_772350_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.6	1.0e-159
WP_004244577.1|772404_773259_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_012367708.1|773929_775687_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_004244579.1|775914_776952_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_012367709.1|777026_778295_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012367710.1|778431_779862_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	24.4	1.7e-06
WP_004244582.1|779998_781087_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.0	5.7e-84
WP_012367711.1|781283_782570_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_004244585.1|782858_783536_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_004244586.1|783717_785391_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_004244587.1|785455_785743_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.0	8.4e-11
WP_012367712.1|786164_788534_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	29.3	2.7e-22
WP_004244589.1|788570_790316_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.9	8.4e-61
WP_012367713.1|790312_791314_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004247631.1|791809_792025_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004244593.1|792439_792619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244594.1|792623_793385_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_004244595.1|793508_794339_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_004244596.1|794718_795492_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_004244597.1|795501_796824_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_004247634.1|796804_797536_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_012367715.1|797532_801990_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_004244601.1|802272_802926_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	79.0	1.0e-99
WP_004247637.1|803331_804045_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_012367716.1|804394_806110_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_004244605.1|806447_806996_+	YcbK family protein	NA	NA	NA	NA	NA
WP_012367717.1|807045_807696_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004244607.1|807788_808262_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_012367718.1|808352_810089_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_012367719.1|810081_811437_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004244610.1|811474_815023_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_012367720.1|815025_816489_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004244612.1|816494_817145_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_004244614.1|817146_817935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012367721.1|817938_820650_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.7	4.9e-84
WP_004244617.1|820658_821414_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004247647.1|821406_822765_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004244619.1|822766_823318_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_012367722.1|823319_824588_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_004244621.1|824592_825630_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_012367723.1|825593_827369_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 4
NC_010554	Proteus mirabilis HI4320, complete genome	4063606	980552	1041227	4063606	protease,terminase,tRNA,capsid,lysis,tail,integrase,portal,transposase,head	Morganella_phage(17.07%)	75	1028741:1028756	1046926:1046941
WP_004247117.1|980552_981656_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004247118.1|981761_982214_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004247119.1|982206_982836_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004247120.1|982974_984228_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.6e-21
WP_012367770.1|984337_985471_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	73.4	1.5e-156
WP_012367771.1|985445_985697_-	excisionase	NA	NA	NA	NA	NA
WP_012367772.1|985757_986234_-	class I SAM-dependent methyltransferase	NA	A0A1W6JP48	Morganella_phage	78.1	1.7e-69
WP_012367773.1|986217_986469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012367774.1|986468_987002_-	hypothetical protein	NA	A0A1W5PTP2	Pseudoalteromonas_phage	30.9	1.2e-13
WP_012367775.1|987011_987191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041707084.1|987218_987413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012367777.1|987452_987950_-	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	66.1	7.0e-45
WP_012367778.1|988008_988836_-	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	56.6	1.1e-79
WP_012367779.1|988901_989276_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	70.6	7.1e-42
WP_004247128.1|989924_990407_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	51.4	3.7e-11
WP_004247129.1|990510_990750_+	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	54.8	3.0e-14
WP_004251663.1|990834_991497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004251662.1|991512_991971_+	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	48.2	6.9e-31
WP_004251659.1|992056_992230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004251656.1|992226_992406_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	1.8e-11
WP_004251644.1|992418_993510_+	hypothetical protein	NA	H2DE83	Erwinia_phage	54.4	5.3e-29
WP_004247134.1|993678_994386_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	51.7	5.6e-56
WP_004251638.1|994385_995411_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	46.2	3.7e-85
WP_004251637.1|995438_995837_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	55.8	2.7e-31
WP_004247137.1|996177_996390_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	75.7	7.6e-25
WP_004251636.1|996934_999136_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_004251632.1|1000048_1000384_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004251618.1|1000487_1001414_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004251614.1|1001830_1002253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004251611.1|1002305_1002575_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	52.3	6.7e-18
WP_004251609.1|1002574_1003045_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	63.2	1.5e-49
WP_004244729.1|1003026_1003185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004251606.1|1003187_1003649_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	46.3	1.4e-23
WP_004242468.1|1004546_1004885_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	67.9	5.4e-41
WP_006537822.1|1005003_1005471_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	9.5e-44
WP_012367783.1|1005424_1007158_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.5	6.9e-148
WP_012367784.1|1007157_1008426_+|portal	phage portal protein	portal	Q77W97	Enterobacteria_phage	80.2	5.1e-201
WP_004242476.1|1008443_1009112_+|head,protease	HK97 family phage prohead protease	head,protease	K7PM91	Enterobacterial_phage	65.8	6.6e-83
WP_012367785.1|1009115_1010282_+|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	79.8	9.6e-170
WP_012367786.1|1010320_1010620_+|head,tail	phage head-tail connector protein	head,tail	K7PKV5	Enterobacterial_phage	64.3	9.7e-34
WP_012367787.1|1010619_1010949_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_036976749.1|1010938_1011412_+	HK97 gp10 family phage protein	NA	A0A0R6PHU8	Moraxella_phage	31.5	1.9e-12
WP_012367789.1|1011417_1011759_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_012367790.1|1011768_1012434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012367791.1|1012498_1012915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036894769.1|1012911_1013190_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_004242485.1|1013214_1013406_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_041707085.1|1013532_1016808_+|tail	phage tail tape measure protein	tail	B7SE05	Pseudomonas_virus	46.7	2.4e-53
WP_012367794.1|1016808_1017405_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	52.8	3.9e-50
WP_012367795.1|1017404_1017986_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.0	4.0e-52
WP_012367796.1|1018042_1018441_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	48.5	4.1e-32
WP_012367797.1|1018440_1021470_+	DUF1983 domain-containing protein	NA	Q7Y3Z3	Yersinia_phage	51.1	1.0e-199
WP_004251552.1|1021473_1022475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004251549.1|1022673_1022922_+	cloacin	NA	NA	NA	NA	NA
WP_004247902.1|1024619_1024784_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.6e-22
WP_157867040.1|1025587_1025860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086935859.1|1026143_1027733_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_012367802.1|1027738_1028602_+	hypothetical protein	NA	NA	NA	NA	NA
1028741:1028756	attL	TCTATATCATTTTTTG	NA	NA	NA	NA
WP_157867043.1|1028885_1029041_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	61.1	1.9e-09
WP_012367803.1|1029337_1030465_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	59.5	2.8e-118
WP_012367804.1|1030445_1030688_-	excisionase	NA	NA	NA	NA	NA
WP_041707087.1|1030944_1031604_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	44.0	3.8e-46
WP_012367806.1|1031922_1032996_+	conserved phage C-terminal domain-containing protein	NA	A0A2H4JEZ8	uncultured_Caudovirales_phage	36.7	2.2e-27
WP_004247847.1|1033008_1033407_+	antitermination protein Q	NA	B6SCZ7	Bacteriophage	55.3	4.6e-31
WP_012367807.1|1033628_1033889_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004247849.1|1034044_1034302_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004247850.1|1034307_1034580_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	67.2	1.3e-16
WP_004247851.1|1034886_1035093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012367808.1|1035395_1036418_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	71.9	4.2e-129
WP_012367809.1|1036692_1037682_+	DUF4747 family protein	NA	NA	NA	NA	NA
WP_041707125.1|1037717_1038299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012367811.1|1038659_1039124_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	44.7	2.0e-22
WP_012367812.1|1039167_1039749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086935847.1|1040136_1040607_+	DUF4297 domain-containing protein	NA	NA	NA	NA	NA
WP_036969579.1|1041068_1041227_-|transposase	transposase	transposase	NA	NA	NA	NA
1046926:1046941	attR	CAAAAAATGATATAGA	NA	NA	NA	NA
>prophage 5
NC_010554	Proteus mirabilis HI4320, complete genome	4063606	1822786	1841793	4063606	lysis,holin,plate	Escherichia_phage(28.57%)	21	NA	NA
WP_012368081.1|1822786_1825225_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	54.5	5.0e-261
WP_004243609.1|1825236_1825854_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	67.8	1.3e-88
WP_012368082.1|1825857_1826634_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	39.8	5.1e-42
WP_004243612.1|1826749_1827292_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.7	1.9e-19
WP_012368083.1|1827858_1828038_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_004243615.1|1829557_1830214_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.9	2.3e-35
WP_012368085.1|1830210_1831398_-|plate	baseplate J/gp47 family protein	plate	A0A2H5BG53	Pseudoalteromonas_phage	37.7	3.2e-72
WP_004243617.1|1831390_1831735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012368086.1|1831731_1832424_-	hypothetical protein	NA	A1Z003	Burkholderia_virus	37.1	1.6e-34
WP_004243622.1|1832426_1833239_-	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
WP_004243623.1|1833207_1833528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250719.1|1833540_1834029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012368087.1|1834031_1836335_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	24.6	8.9e-18
WP_004243627.1|1836417_1836876_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
WP_012368088.1|1836935_1837388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012368089.1|1837398_1838886_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.7	4.2e-77
WP_012368090.1|1838894_1839407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012368091.1|1839443_1839893_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_012368092.1|1839889_1840294_-	hypothetical protein	NA	A0A0A0RQM4	Escherichia_phage	47.9	1.7e-25
WP_004248367.1|1840296_1840596_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	51.0	1.9e-21
WP_012368093.1|1840977_1841793_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.7	3.5e-54
>prophage 6
NC_010554	Proteus mirabilis HI4320, complete genome	4063606	2104939	2156333	4063606	protease,terminase,integrase,tRNA,capsid,lysis,holin,tail,plate,portal,head	Salmonella_phage(29.73%)	62	2117082:2117106	2147092:2147116
WP_004243990.1|2104939_2105431_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_004243991.1|2105683_2105899_+	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_004248513.1|2106042_2106282_+	YecH family protein	NA	NA	NA	NA	NA
WP_012368173.1|2106394_2106640_-	DinI-like family protein	NA	A0A0M4S6H1	Salmonella_phage	38.2	2.7e-10
WP_004248514.1|2106824_2107172_+	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
WP_012368174.1|2107149_2107710_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004243999.1|2107784_2108471_-	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_004244000.1|2109558_2110395_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017627942.1|2110461_2111322_+	T3SS regulon anti-activator ExsD family protein	NA	NA	NA	NA	NA
WP_012368176.1|2111379_2113848_-	sugar transporter	NA	NA	NA	NA	NA
WP_004244003.1|2113853_2114306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244004.1|2114768_2115317_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.1	2.2e-15
WP_004244005.1|2115817_2116027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244007.1|2116334_2116544_+	hypothetical protein	NA	NA	NA	NA	NA
2117082:2117106	attL	ATAAAAAAGCCATCTTGCGATGGCT	NA	NA	NA	NA
WP_012368177.1|2117375_2118083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012368178.1|2118114_2118333_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	70.3	1.7e-19
WP_012368179.1|2118385_2119483_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	54.3	7.3e-111
WP_036907694.1|2119482_2119947_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	61.4	3.3e-41
WP_012368181.1|2119946_2122781_-|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	41.3	1.9e-110
WP_072070684.1|2122773_2122947_-|tail	GpE family phage tail protein	tail	A0A2I8TV82	Erwinia_phage	52.6	5.6e-10
WP_012368182.1|2122907_2123255_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	55.7	7.8e-19
WP_012368183.1|2123274_2123790_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	57.9	2.6e-55
WP_012368184.1|2123793_2124966_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	70.9	1.1e-165
WP_012368185.1|2125065_2126697_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	70.8	5.3e-57
WP_012368186.1|2126686_2127298_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	68.4	5.5e-76
WP_012368187.1|2127290_2128199_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	67.2	1.9e-109
WP_012368188.1|2128200_2128539_-	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	49.5	8.4e-26
WP_012368189.1|2128535_2129162_-|plate	phage baseplate assembly protein V	plate	A0A0F7LBP2	Escherichia_phage	57.0	4.5e-57
WP_012368190.1|2129227_2129863_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	36.3	1.5e-28
WP_012368191.1|2129852_2130290_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	50.0	8.3e-34
WP_012368192.1|2130264_2130768_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	30.1	6.5e-06
WP_012368193.1|2130764_2131169_-	M15 family metallopeptidase	NA	K4F776	Cronobacter_phage	58.1	1.6e-39
WP_012368194.1|2131161_2131476_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_012368195.1|2131495_2131702_-|tail	tail protein X	tail	K4PAW7	Burkholderia_phage	52.9	1.3e-16
WP_012368196.1|2131701_2132157_-|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	45.9	8.4e-29
WP_012368197.1|2132234_2132903_-|terminase	terminase	terminase	F1BUQ7	Erwinia_phage	46.6	7.2e-45
WP_012368198.1|2132902_2134048_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	67.4	6.8e-128
WP_012368199.1|2134063_2134873_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	49.1	8.9e-66
WP_012368200.1|2135045_2136800_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	73.4	2.3e-260
WP_012368201.1|2136799_2137828_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	67.8	8.0e-136
WP_012368202.1|2138438_2139566_-	ImmA/IrrE family metallo-endopeptidase	NA	B6SBZ6	Clostridium_virus	29.4	4.5e-31
WP_012368203.1|2139576_2140170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012368205.1|2140485_2142864_-	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	47.1	2.3e-162
WP_012368206.1|2142863_2143187_-	DUF5405 family protein	NA	NA	NA	NA	NA
WP_012368207.1|2143186_2144011_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	49.4	4.7e-62
WP_012368208.1|2144012_2144234_-	TraR/DksA family transcriptional regulator	NA	F1BUS2	Erwinia_phage	52.1	2.6e-12
WP_012368209.1|2144226_2144484_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_012368210.1|2144501_2144897_-	DUF5347 domain-containing protein	NA	NA	NA	NA	NA
WP_012368211.1|2144905_2145055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012368212.1|2145051_2145249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012368213.1|2145254_2145530_-	regulatory phage cox family protein	NA	Q1JS60	Enterobacteria_phage	47.0	3.7e-16
WP_012368214.1|2145632_2145932_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	70.7	4.8e-33
WP_012368215.1|2145998_2146982_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	56.5	2.8e-98
WP_004244024.1|2147150_2148665_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	38.0	4.1e-88
2147092:2147116	attR	ATAAAAAAGCCATCTTGCGATGGCT	NA	NA	NA	NA
WP_012368216.1|2148673_2149772_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	37.3	4.1e-05
WP_004244029.1|2149943_2151677_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	4.3e-65
WP_004244030.1|2151686_2152394_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_004244032.1|2152427_2153369_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.7	4.1e-30
WP_004244033.1|2153476_2153995_+	flavodoxin FldB	NA	NA	NA	NA	NA
WP_004244035.1|2154095_2154503_-	protein YgfX	NA	NA	NA	NA	NA
WP_026090407.1|2154810_2155086_-	FAD assembly factor SdhE	NA	NA	NA	NA	NA
WP_004248524.1|2155346_2156333_+|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
>prophage 7
NC_010554	Proteus mirabilis HI4320, complete genome	4063606	2605001	2613851	4063606		Caulobacter_phage(50.0%)	9	NA	NA
WP_004245601.1|2605001_2606570_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	7.2e-11
WP_012368337.1|2606970_2607651_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004245603.1|2607747_2608323_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
WP_004249446.1|2608399_2608978_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	41.5	2.4e-33
WP_004245605.1|2609045_2610071_-	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.9	1.3e-74
WP_004245607.1|2610105_2610561_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_012368338.1|2610585_2611728_-	TerD family protein	NA	NA	NA	NA	NA
WP_004250201.1|2611728_2612313_-	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.2	4.2e-17
WP_012368339.1|2612705_2613851_+	phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	26.9	3.5e-31
>prophage 8
NC_010554	Proteus mirabilis HI4320, complete genome	4063606	3276462	3340274	4063606	tRNA,transposase	Salmonella_phage(23.08%)	54	NA	NA
WP_041707102.1|3276462_3277671_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	81.5	1.6e-188
WP_012368578.1|3277693_3278110_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.0	2.0e-45
WP_004249011.1|3278929_3279448_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_020946442.1|3279520_3281692_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_012368580.1|3281691_3282915_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_041707160.1|3282968_3286013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012368582.1|3286012_3286951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004249835.1|3286943_3287213_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_012368583.1|3287392_3288328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012368584.1|3288417_3289095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012368585.1|3289187_3290795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250001.1|3293325_3294009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246669.1|3294098_3294722_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_004246668.1|3294861_3295182_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012368586.1|3296229_3297264_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	41.3	2.5e-65
WP_012368587.1|3297984_3300027_+	oligopeptidase A	NA	NA	NA	NA	NA
WP_012368588.1|3300030_3300777_+	16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ	NA	NA	NA	NA	NA
WP_012368589.1|3300847_3301597_-	D-threitol dehydrogenase	NA	NA	NA	NA	NA
WP_004246662.1|3301725_3303066_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_004246661.1|3303319_3303754_-	universal stress protein UspA	NA	NA	NA	NA	NA
WP_004246660.1|3304167_3304500_+	universal stress protein UspB	NA	NA	NA	NA	NA
WP_004246659.1|3304571_3306071_-	inorganic phosphate transporter PitA	NA	NA	NA	NA	NA
WP_012368590.1|3306379_3307585_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_041707103.1|3307596_3307818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004249849.1|3308736_3309438_+	pirin family protein	NA	NA	NA	NA	NA
WP_004246655.1|3309553_3311173_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.4	1.7e-140
WP_004246652.1|3311377_3312262_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_004246651.1|3312289_3312703_-	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_004249850.1|3312776_3314885_-	intracellular growth attenuator family protein	NA	NA	NA	NA	NA
WP_004246647.1|3315240_3315798_+	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_004249852.1|3315887_3316691_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012368592.1|3317024_3319559_-	peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA	NA	NA	NA	NA	NA
WP_012368593.1|3319675_3320500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012368594.1|3320487_3321087_+	fimbrial assembly protein	NA	NA	NA	NA	NA
WP_012368595.1|3321070_3321604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004246639.1|3321610_3322726_+	competence protein E	NA	D0U174	Enterobacteria_phage	24.9	1.7e-11
WP_012368596.1|3323306_3323828_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_004249857.1|3323880_3324975_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_012368597.1|3325129_3326074_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_004249858.1|3326155_3326971_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	47.1	1.2e-65
WP_004246629.1|3327015_3327690_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_004249859.1|3327686_3328397_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_004246627.1|3328398_3329427_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012368598.1|3329487_3330696_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	81.5	1.9e-189
WP_012368599.1|3330718_3331135_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.8	1.5e-45
WP_012368600.1|3331215_3331890_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_004249861.1|3332007_3332631_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.5	6.4e-64
WP_004249862.1|3332998_3334957_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	39.1	3.7e-89
WP_004246621.1|3335121_3335433_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_004246620.1|3335429_3337085_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_012368601.1|3337407_3339039_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_173362648.1|3339078_3339333_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	80.3	1.6e-29
WP_173362649.1|3339223_3339835_-	helix-turn-helix domain-containing protein	NA	A0A077SL42	Escherichia_phage	46.8	2.5e-68
WP_012368602.1|3339857_3340274_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.8	7.6e-45
