The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_010410	Acinetobacter baumannii AYE, complete genome	3936291	529155	596800	3936291	transposase,tail,capsid,integrase,holin,head,tRNA,terminase,portal,plate	uncultured_Caudovirales_phage(28.57%)	78	548347:548375	580656:580684
WP_085940413.1|529155_530246_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_000587649.1|530832_531270_+	thioredoxin TrxC	NA	A0A1V0SD63	Indivirus	39.0	9.9e-11
WP_001287659.1|531271_531694_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000083565.1|531733_532228_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_001138893.1|532263_532752_-	YajQ family cyclic di-GMP-binding protein	NA	NA	NA	NA	NA
WP_000619819.1|532843_533158_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_001043524.1|533209_535081_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_001175201.1|535104_535584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001115787.1|535588_535891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000645707.1|535925_536540_-	septation protein IspZ	NA	NA	NA	NA	NA
WP_001161539.1|536584_537436_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_000637023.1|537443_538355_-	bestrophin	NA	NA	NA	NA	NA
WP_085920667.1|538416_539136_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000006958.1|539236_540490_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.0	3.8e-39
WP_001985897.1|540555_541521_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	33.1	1.7e-31
WP_001270222.1|541529_543431_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000051669.1|543482_543812_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_000667229.1|543910_545044_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.5	1.3e-94
WP_000147160.1|545219_545789_-	LemA family protein	NA	NA	NA	NA	NA
WP_001121110.1|545875_546904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001177136.1|547057_548095_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
548347:548375	attL	TCCGACCCTCGGGACCATATTCAGAATCT	NA	NA	NA	NA
WP_000107854.1|548540_549608_+|integrase	site-specific integrase	integrase	A0A0A0YR56	Pseudomonas_phage	37.9	1.5e-44
WP_000218943.1|549635_549932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000424605.1|549928_550150_-	hypothetical protein	NA	A0A2H4J8L3	uncultured_Caudovirales_phage	38.2	2.0e-07
WP_000125747.1|550159_550897_-	3'-5' exonuclease	NA	A0A0S0NDC6	Pseudomonas_phage	30.4	2.7e-21
WP_002014678.1|550906_551260_-	single-stranded DNA-binding protein	NA	M4SRQ0	Psychrobacter_phage	60.9	3.7e-32
WP_000049658.1|551247_551565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001015077.1|551557_551728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001178668.1|551717_552269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000632296.1|552334_552667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002014340.1|552663_555402_-	toprim domain-containing protein	NA	A0A2H4JDT6	uncultured_Caudovirales_phage	62.2	0.0e+00
WP_001043170.1|555495_555684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786718.1|555776_556118_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000556352.1|556162_556378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001094886.1|556502_557318_-	Rha family transcriptional regulator	NA	A0A0K2CXT4	Paenibacillus_phage	52.1	5.9e-25
WP_000696053.1|557425_557620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000417952.1|557929_558808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000713873.1|558807_559089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000130085.1|559404_559605_-	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_000113725.1|559601_559841_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000483061.1|559970_561284_-	primase	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	42.9	4.2e-97
WP_000979757.1|561284_561725_-|tail	phage tail protein	tail	A0A2H4JG54	uncultured_Caudovirales_phage	54.8	1.7e-39
WP_000774268.1|561730_564181_-|tail	phage tail tape measure protein	tail	A0A193GYN8	Enterobacter_phage	44.4	3.0e-104
WP_096903806.1|564194_564332_-|tail	GpE family phage tail protein	tail	R9QCM4	Mannheimia_phage	57.9	1.7e-06
WP_001071615.1|564334_564676_-|tail	phage tail assembly protein	tail	E5E3U8	Burkholderia_phage	52.2	5.0e-18
WP_001207612.1|564742_565261_-|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	58.5	6.1e-52
WP_000963361.1|565273_566449_-|tail	phage tail sheath protein	tail	Q9ZXK4	Pseudomonas_virus	68.3	1.4e-149
WP_000729646.1|566598_568551_-|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	42.9	2.9e-30
WP_001050805.1|568562_569168_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	38.2	1.1e-28
WP_000109738.1|569167_570070_-|plate	baseplate J/gp47 family protein	plate	A0A0F7LCJ3	Escherichia_phage	48.5	6.0e-71
WP_000987745.1|570066_570414_-	GPW/gp25 family protein	NA	A0A2H4JE52	uncultured_Caudovirales_phage	51.8	8.1e-24
WP_000990625.1|570410_571043_-|plate	phage baseplate assembly protein V	plate	A0A2H4JFJ8	uncultured_Caudovirales_phage	35.1	7.3e-23
WP_001059843.1|571115_571565_-	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	48.2	4.8e-29
WP_000742888.1|571561_572089_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	50.0	2.8e-36
WP_000600982.1|572085_572916_-	DUF3380 domain-containing protein	NA	A4JWU0	Burkholderia_virus	42.6	2.8e-46
WP_000571491.1|572912_573182_-|holin	phage holin family protein	holin	Q9ZXL7	Pseudomonas_virus	38.5	7.7e-06
WP_001114936.1|573178_573529_-	membrane protein	NA	NA	NA	NA	NA
WP_000659474.1|573537_573747_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	59.7	5.2e-18
WP_000015691.1|573747_574200_-|head	head completion/stabilization protein	head	Q9ZXM1	Pseudomonas_virus	46.5	1.2e-24
WP_000950641.1|574303_575050_-|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	42.9	1.2e-37
WP_001243259.1|575060_576050_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	54.5	1.5e-94
WP_000748563.1|576102_576930_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	45.8	6.3e-59
WP_000289875.1|577067_578876_+|terminase	terminase	terminase	Q9ZXM5	Pseudomonas_virus	58.5	4.3e-201
WP_001284079.1|578875_579874_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	53.2	6.4e-98
WP_000194110.1|581205_582474_+	HAMP domain-containing histidine kinase	NA	B5LWN0	Feldmannia_species_virus	24.8	1.3e-07
580656:580684	attR	TCCGACCCTCGGGACCATATTCAGAATCT	NA	NA	NA	NA
WP_000990839.1|582542_585293_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_001046506.1|585317_586244_+	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_000548427.1|586311_587202_+	mitochondrial fission ELM1 family protein	NA	NA	NA	NA	NA
WP_000697431.1|587224_588253_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_000989966.1|588249_589005_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001033817.1|589001_589766_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_000706922.1|589777_590812_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_000934706.1|590808_591699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012300502.1|591758_592523_+	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_000595308.1|592552_593482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001251492.1|593519_593738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085920670.1|593961_594969_+	stealth conserved region 3 domain-containing protein	NA	NA	NA	NA	NA
WP_000986451.1|595021_596800_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	21.9	6.2e-19
>prophage 2
NC_010410	Acinetobacter baumannii AYE, complete genome	3936291	1187057	1201854	3936291		Acinetobacter_phage(100.0%)	10	NA	NA
WP_001187843.1|1187057_1187606_-	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	99.5	1.5e-96
WP_000893677.1|1187868_1189368_+	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	97.0	1.2e-278
WP_001076822.1|1189369_1191745_+	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	98.7	0.0e+00
WP_001164227.1|1191751_1192735_+	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	99.4	1.0e-188
WP_000066126.1|1192745_1193441_-	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	100.0	5.8e-122
WP_000608308.1|1193450_1194257_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	99.6	1.8e-146
WP_001982145.1|1194266_1195316_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	100.0	9.8e-190
WP_000281154.1|1195672_1198405_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	97.7	0.0e+00
WP_000960544.1|1198483_1201183_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	97.8	0.0e+00
WP_000566783.1|1201278_1201854_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	A0A0P0IKJ1	Acinetobacter_phage	99.5	4.2e-110
>prophage 3
NC_010410	Acinetobacter baumannii AYE, complete genome	3936291	1311963	1326582	3936291	head,tail	Acinetobacter_phage(64.29%)	26	NA	NA
WP_005803714.1|1311963_1312659_-	LexA family transcriptional regulator	NA	A0A0R6PCY1	Moraxella_phage	36.6	3.0e-25
WP_005803712.1|1312754_1313015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000818540.1|1313024_1313351_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_001046768.1|1313366_1314227_+	replication protein	NA	NA	NA	NA	NA
WP_000993202.1|1314223_1314958_+	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	52.4	5.3e-65
WP_000175553.1|1314954_1315143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001106885.1|1315139_1315292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001242985.1|1315288_1315795_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1X9SFE9	Acinetobacter_phage	53.0	1.5e-26
WP_001261841.1|1315804_1316209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000826376.1|1316205_1316862_+	hypothetical protein	NA	A0A0N7IRF9	Acinetobacter_phage	93.1	1.2e-121
WP_000801897.1|1316858_1317239_+	hypothetical protein	NA	A0A068CDI0	Acinetobacter_phage	33.8	8.0e-09
WP_000066269.1|1317231_1317411_+	hypothetical protein	NA	A0A0D4DCD9	Acinetobacter_phage	83.1	1.0e-22
WP_001278405.1|1317476_1317662_+	hypothetical protein	NA	A0A0D4DCN1	Acinetobacter_phage	96.4	2.5e-24
WP_001204257.1|1317654_1317987_+	hypothetical protein	NA	E2GLW0	Acinetobacter_phage	44.7	2.0e-11
WP_000356498.1|1317990_1318440_+	hypothetical protein	NA	A0A0D4DBZ8	Acinetobacter_phage	64.1	3.4e-14
WP_001123238.1|1318430_1318742_+	hypothetical protein	NA	A0A0D4DCM1	Acinetobacter_phage	95.1	1.1e-59
WP_000568836.1|1318795_1319332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729780.1|1319406_1319748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000333834.1|1319747_1319978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001293191.1|1319979_1321623_+|head,tail	phage head-tail adapter protein	head,tail	A0A2H4J3N6	uncultured_Caudovirales_phage	44.6	7.3e-123
WP_000611265.1|1321619_1322105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000931282.1|1322097_1322721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262752.1|1322732_1323632_+	hypothetical protein	NA	A0A1B1IRE8	uncultured_Mediterranean_phage	27.7	5.0e-17
WP_000072947.1|1323707_1323878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002039465.1|1323943_1324504_+	hypothetical protein	NA	A0A1B1IRI7	uncultured_Mediterranean_phage	37.4	9.0e-25
WP_001250302.1|1324503_1326582_+	hypothetical protein	NA	A0A1B1IW99	uncultured_Mediterranean_phage	27.3	8.8e-33
>prophage 4
NC_010410	Acinetobacter baumannii AYE, complete genome	3936291	1332746	1341588	3936291	terminase	uncultured_Caudovirales_phage(33.33%)	8	NA	NA
WP_000662731.1|1332746_1335272_+	hypothetical protein	NA	A0A193GZ61	Enterobacter_phage	31.0	9.2e-109
WP_000733401.1|1335268_1335628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204066.1|1335693_1336002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000165574.1|1336001_1337678_+|terminase	phage terminase large subunit	terminase	A0A2H4JCA3	uncultured_Caudovirales_phage	45.7	6.9e-137
WP_000115841.1|1337687_1340270_+	lipase	NA	I2FLT2	Pseudomonas_phage	24.5	5.5e-08
WP_001157161.1|1340346_1340724_+	hypothetical protein	NA	A0A2H4JFC0	uncultured_Caudovirales_phage	58.9	7.4e-31
WP_001019741.1|1340720_1341266_+	N-acetylmuramidase	NA	A0A0B5L5G7	Acinetobacter_phage	91.7	1.2e-95
WP_000084540.1|1341393_1341588_+	hypothetical protein	NA	A0A1B1P9F8	Acinetobacter_phage	93.8	1.3e-28
>prophage 5
NC_010410	Acinetobacter baumannii AYE, complete genome	3936291	2445212	2523326	3936291	transposase,plate	uncultured_Caudovirales_phage(25.0%)	59	NA	NA
WP_000471444.1|2445212_2446577_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000020713.1|2446593_2447688_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000987834.1|2447711_2450393_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	30.9	1.3e-81
WP_000168112.1|2450611_2450875_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_001072410.1|2450891_2451659_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000557241.1|2451661_2452621_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_000556921.1|2452658_2456483_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_000591871.1|2456513_2457926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001190396.1|2457922_2458921_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000568822.1|2458884_2460696_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001047031.1|2460712_2461189_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000653195.1|2461268_2461772_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_001066523.1|2461821_2463303_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_001119042.1|2463295_2463799_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000043350.1|2465595_2465997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000542531.1|2466092_2467037_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001000088.1|2467036_2467918_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.2	6.6e-38
WP_000591242.1|2467969_2468992_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000916846.1|2468988_2470800_-	allophanate hydrolase	NA	NA	NA	NA	NA
WP_001118705.1|2470812_2471247_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001000626.1|2471251_2471377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001118143.1|2471568_2471922_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001196263.1|2472015_2472552_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000217385.1|2476196_2476850_-	DUF1989 domain-containing protein	NA	NA	NA	NA	NA
WP_001090546.1|2476865_2477606_-	DUF1989 domain-containing protein	NA	NA	NA	NA	NA
WP_001202393.1|2477921_2479085_-	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.7	1.8e-11
WP_000921226.1|2479337_2479769_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_001133098.1|2479825_2480386_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000024256.1|2481250_2481772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000720612.1|2481787_2482369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000414788.1|2482639_2482990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000465123.1|2483123_2484032_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000698630.1|2484141_2485362_-	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	29.3	1.2e-32
WP_001091000.1|2485665_2487384_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_001211794.1|2487383_2488967_-	5-oxoprolinase/urea amidolyase family protein	NA	NA	NA	NA	NA
WP_000276200.1|2488999_2489806_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_000496077.1|2489817_2490582_-	LamB/YcsF family protein	NA	NA	NA	NA	NA
WP_001987220.1|2490616_2491870_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_001049897.1|2492215_2493127_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_085920602.1|2493410_2493719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001195549.1|2494160_2494697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000459778.1|2494774_2495293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094273310.1|2495310_2496168_-	RHS domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	59.2	4.6e-44
WP_000873472.1|2497244_2497913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085940413.1|2500131_2501222_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_000935010.1|2503998_2507145_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	63.2	9.9e-254
WP_002017666.1|2507766_2509014_+	serine hydrolase	NA	NA	NA	NA	NA
WP_000406271.1|2509059_2509488_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001127331.1|2509582_2510041_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.1	6.9e-31
WP_001986316.1|2510293_2510488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000398495.1|2510645_2511596_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000185559.1|2511846_2512545_+	DUF1826 domain-containing protein	NA	NA	NA	NA	NA
WP_001033905.1|2512855_2514487_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_000760328.1|2514977_2515415_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_000659371.1|2515509_2516814_-	MFS transporter	NA	NA	NA	NA	NA
WP_001143895.1|2517083_2517719_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000165399.1|2518301_2519234_-	lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	35.1	3.6e-42
WP_000972442.1|2521219_2522080_-	EamA family transporter	NA	NA	NA	NA	NA
WP_085940413.1|2522235_2523326_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
>prophage 6
NC_010410	Acinetobacter baumannii AYE, complete genome	3936291	2547337	2559007	3936291	capsid,terminase	Acinetobacter_phage(30.0%)	14	NA	NA
WP_000433906.1|2547337_2547727_-	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	96.9	1.1e-64
WP_001068512.1|2547877_2548864_+	right-handed parallel beta-helix repeat-containing protein	NA	U5PSS0	Bacillus_phage	31.7	5.7e-14
WP_001990242.1|2548924_2549923_-	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_001990240.1|2549919_2550411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000060043.1|2550414_2550885_-	hypothetical protein	NA	M4T3R5	Psychrobacter_phage	41.8	8.1e-19
WP_000653192.1|2550903_2552103_-	DUF2213 domain-containing protein	NA	A0A2I7R2U8	Vibrio_phage	28.5	2.0e-21
WP_001140766.1|2552156_2552789_-	hypothetical protein	NA	U5U717	Lactobacillus_phage	24.5	2.8e-06
WP_000032786.1|2552829_2553018_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001273094.1|2553097_2553910_-|capsid	minor capsid protein	capsid	M4T3R2	Psychrobacter_phage	42.1	2.7e-54
WP_000852322.1|2553854_2555189_-	DUF1073 domain-containing protein	NA	M4SN90	Psychrobacter_phage	40.0	3.7e-85
WP_001086349.1|2555197_2556688_-|terminase	phage terminase large subunit	terminase	I3PGT7	Xanthomonas_phage	41.2	1.4e-88
WP_000113266.1|2556665_2557148_-	DUF2280 domain-containing protein	NA	A0A0P0HSK4	Acinetobacter_phage	85.8	2.2e-67
WP_001004672.1|2557895_2558240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001138417.1|2558548_2559007_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	46.6	2.0e-30
>prophage 7
NC_010410	Acinetobacter baumannii AYE, complete genome	3936291	2725831	2780088	3936291	capsid	Acinetobacter_phage(86.54%)	75	NA	NA
WP_000072124.1|2725831_2726041_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	61.8	1.2e-17
WP_000165565.1|2726493_2727126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019711.1|2727269_2727815_-	N-acetylmuramidase	NA	A0A0P0IW03	Acinetobacter_phage	96.1	9.5e-96
WP_000433918.1|2727857_2728247_-	hypothetical protein	NA	J7I481	Acinetobacter_phage	100.0	2.5e-66
WP_000598522.1|2728314_2731761_-	hypothetical protein	NA	J7HXG3	Acinetobacter_phage	98.2	0.0e+00
WP_000835153.1|2731753_2732116_-	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	78.3	1.4e-50
WP_000368382.1|2732112_2732619_-	DUF1833 family protein	NA	J7HXQ5	Acinetobacter_phage	98.2	3.8e-91
WP_000277446.1|2732618_2733017_-	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	97.7	3.1e-72
WP_000991941.1|2733153_2733861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000959543.1|2733887_2734532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000134295.1|2734521_2735253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000046567.1|2735721_2740029_-	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	97.4	0.0e+00
WP_001275792.1|2740156_2740420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000721572.1|2740421_2741102_-	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	49.3	2.5e-53
WP_000274931.1|2741206_2741665_-	helix-turn-helix domain-containing protein	NA	A0A0P0IRJ4	Acinetobacter_phage	100.0	1.1e-84
WP_000335868.1|2741673_2741973_-	DUF4258 domain-containing protein	NA	A0A0P0IE58	Acinetobacter_phage	100.0	7.4e-50
WP_001185578.1|2742475_2742991_-	hypothetical protein	NA	A0A0D4DBX8	Acinetobacter_phage	95.9	3.6e-76
WP_000094258.1|2743060_2743978_-	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	94.4	1.5e-162
WP_001285008.1|2744073_2745171_-	hypothetical protein	NA	A0A0N7IRE5	Acinetobacter_phage	41.0	7.1e-74
WP_000064569.1|2745170_2745521_-	hypothetical protein	NA	J7I469	Acinetobacter_phage	88.9	1.4e-52
WP_001277691.1|2745616_2745835_-	hypothetical protein	NA	A0A0D4DC29	Acinetobacter_phage	95.8	1.5e-31
WP_002040017.1|2745836_2746280_-	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	86.4	4.4e-67
WP_001985549.1|2746236_2746605_-	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	79.5	2.2e-51
WP_000248291.1|2746576_2746984_-	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	76.9	5.7e-53
WP_001074458.1|2747037_2747685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000524221.1|2747722_2748091_-	hypothetical protein	NA	J7I467	Acinetobacter_phage	97.5	1.9e-63
WP_000505830.1|2748090_2748471_-	hypothetical protein	NA	A0A0P0IVQ3	Acinetobacter_phage	83.3	3.4e-52
WP_000524483.1|2748474_2748831_-	hypothetical protein	NA	A0A0N7IRE4	Acinetobacter_phage	83.9	1.0e-42
WP_000502910.1|2748875_2749826_-	hypothetical protein	NA	A0A0P0HSG2	Acinetobacter_phage	97.8	1.6e-175
WP_001112410.1|2749839_2750595_-	hypothetical protein	NA	A0A0P0J090	Acinetobacter_phage	99.2	3.1e-129
WP_000196672.1|2750704_2751256_-	hypothetical protein	NA	A0A2I7RHW2	Vibrio_phage	66.7	1.1e-17
WP_001290162.1|2751378_2751594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004252.1|2751615_2751852_-	hypothetical protein	NA	A0A0D4DC19	Acinetobacter_phage	93.6	1.1e-35
WP_000965232.1|2751950_2752379_-	hypothetical protein	NA	A0A0D4DBV9	Acinetobacter_phage	100.0	5.2e-73
WP_000146962.1|2752388_2753495_-|capsid	minor capsid protein	capsid	A0A0P0IR98	Acinetobacter_phage	90.5	2.7e-190
WP_000301510.1|2753504_2754851_-	DUF4055 domain-containing protein	NA	A0A0P0IDW1	Acinetobacter_phage	98.7	4.4e-251
WP_001132932.1|2754890_2756183_-	hypothetical protein	NA	A0A1B1P9C9	Acinetobacter_phage	86.3	3.2e-214
WP_000729387.1|2756142_2756658_-	DUF2280 domain-containing protein	NA	A0A1B1P9C2	Acinetobacter_phage	61.3	3.2e-45
WP_000372132.1|2756716_2757358_-	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	96.2	7.4e-124
WP_000378502.1|2757326_2757794_-	hypothetical protein	NA	A0A0P0IRI6	Acinetobacter_phage	83.9	6.5e-69
WP_001115720.1|2757847_2758126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005115951.1|2758416_2759634_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_000959664.1|2759949_2760702_-	hypothetical protein	NA	A0A0P0J081	Acinetobacter_phage	96.4	4.9e-135
WP_000100191.1|2760712_2761114_-	DUF559 domain-containing protein	NA	A0A0P0IKL1	Acinetobacter_phage	95.5	8.9e-67
WP_000378366.1|2761113_2761437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001039748.1|2761426_2761606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000778999.1|2761602_2762001_-	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	48.5	5.8e-26
WP_001031745.1|2761997_2762123_-	putative phage replication protein	NA	A0A0P0IR92	Acinetobacter_phage	89.5	4.8e-11
WP_002014198.1|2762119_2762845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356504.1|2762841_2763291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001288692.1|2763283_2763559_-	hypothetical protein	NA	E2GLW0	Acinetobacter_phage	53.3	9.9e-17
WP_001084930.1|2763551_2763728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000801878.1|2763724_2764033_-	hypothetical protein	NA	A0A0P0I8J0	Acinetobacter_phage	73.1	1.8e-35
WP_000568882.1|2764029_2764206_-	hypothetical protein	NA	A0A0P0IRH7	Acinetobacter_phage	89.7	1.5e-18
WP_000854669.1|2764202_2764460_-	hypothetical protein	NA	A0A2H4J6Z3	uncultured_Caudovirales_phage	61.5	7.3e-22
WP_000065244.1|2764456_2765773_-	AAA family ATPase	NA	A0A2H4J6D5	uncultured_Caudovirales_phage	74.3	8.0e-165
WP_000501092.1|2765772_2766600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001109646.1|2766599_2766758_-	hypothetical protein	NA	A0A1B1P9H5	Acinetobacter_phage	98.1	7.9e-19
WP_000166816.1|2766798_2767074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000703023.1|2767082_2767271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000052236.1|2767375_2768125_+	helix-turn-helix domain-containing protein	NA	J7I4M9	Acinetobacter_phage	72.5	6.9e-97
WP_000370485.1|2768139_2768355_+	hypothetical protein	NA	A0A0P0IKK4	Acinetobacter_phage	98.6	9.4e-31
WP_000065151.1|2768487_2770755_+	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	100.0	0.0e+00
WP_001101040.1|2770955_2771396_+	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	95.9	7.0e-73
WP_000064463.1|2771398_2771722_+	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	95.3	4.8e-55
WP_001207451.1|2771733_2772855_+	ATP-binding protein	NA	A0A0D4DBX7	Acinetobacter_phage	99.5	1.3e-211
WP_000789906.1|2772851_2773916_+	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	70.9	1.4e-130
WP_000043828.1|2773915_2774212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453537.1|2774211_2774709_+	methyltransferase domain-containing protein	NA	A0A0N7IRF6	Acinetobacter_phage	72.3	4.5e-68
WP_000088975.1|2774709_2774973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000669363.1|2775393_2775711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001166305.1|2775783_2775897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000768231.1|2776004_2776346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085920719.1|2776606_2777173_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_001292274.1|2777658_2780088_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	62.7	8.4e-277
>prophage 8
NC_010410	Acinetobacter baumannii AYE, complete genome	3936291	3614110	3644088	3936291	transposase,integrase	Escherichia_phage(50.0%)	32	3619450:3619509	3649919:3649988
WP_000137809.1|3614110_3615400_-|transposase	ISL3-like element ISPpu12 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	40.4	9.5e-86
WP_000021528.1|3615421_3615934_-	signal peptidase II	NA	NA	NA	NA	NA
WP_000041516.1|3615937_3616834_-	cation transporter	NA	NA	NA	NA	NA
WP_001219639.1|3616929_3617337_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000947164.1|3617458_3617722_+	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_000168107.1|3617778_3618162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001991400.1|3618224_3618374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170318974.1|3618367_3618817_-	recombinase family protein	NA	Q71TD8	Escherichia_phage	63.7	9.7e-38
WP_000862068.1|3618867_3619212_-	hypothetical protein	NA	A0A2I7S8K9	Vibrio_phage	41.4	2.0e-11
WP_000017328.1|3619208_3619496_-	hypothetical protein	NA	NA	NA	NA	NA
3619450:3619509	attL	CGGACTGCAAGTGATCTTGAAGCCACGGGCCCGTCCCACCCCGACATGGACCTCGATGCC	NA	NA	NA	NA
WP_000376623.1|3619519_3620020_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|3620147_3620987_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|3620980_3621328_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206316.1|3621491_3622283_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_001102919.1|3622695_3623208_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002016612.1|3623233_3623893_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002089484.1|3623864_3624329_-	aminoglycoside N-acetyltransferase AAC(3)-Ia	NA	NA	NA	NA	NA
WP_000845054.1|3624499_3625513_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_000454193.1|3625715_3626066_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|3626213_3626918_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018326.1|3627047_3627863_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
WP_000902128.1|3628016_3628196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|3628462_3629167_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000904905.1|3629178_3629838_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.4e-37
WP_001067855.1|3632861_3633566_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000412211.1|3637353_3638013_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|3638213_3638591_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001214976.1|3640397_3640805_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|3640942_3641827_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|3641858_3643058_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|3643163_3643814_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|3643845_3644088_-|transposase	transposase	transposase	NA	NA	NA	NA
3649919:3649988	attR	CGGACTGCAAGTGATCTTGAAGCCACGGGCCCGTCCCACCCCGACATGGACCTCGATGCCCGAACGGACG	NA	NA	NA	NA
>prophage 9
NC_010410	Acinetobacter baumannii AYE, complete genome	3936291	3648717	3696120	3936291	transposase,integrase	uncultured_Caudovirales_phage(26.32%)	47	3659607:3659622	3695783:3695798
WP_001389365.1|3648717_3649482_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000376623.1|3649988_3650489_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259018.1|3650616_3651456_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|3651449_3651797_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001027119.1|3651833_3652397_-	trimethoprim-resistant dihydrofolate reductase DfrA10	NA	A0A0B6VT49	Edwardsiella_phage	29.2	1.5e-11
WP_000050481.1|3652778_3654320_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|3654724_3655564_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|3655557_3655905_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001209508.1|3656068_3656860_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000846390.1|3656876_3657677_-	oxacillin-hydrolyzing class D beta-lactamase OXA-10	NA	NA	NA	NA	NA
WP_012300772.1|3657941_3659201_-	chloramphenicol efflux MFS transporter CmlA5	NA	S4TR35	Salmonella_phage	31.7	1.7e-26
WP_000237816.1|3659521_3659974_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-2	NA	NA	NA	NA	NA
3659607:3659622	attL	TCCCAGTCTTCAACAA	NA	NA	NA	NA
WP_000381802.1|3660058_3660592_-	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
WP_000706731.1|3660736_3661636_-	class A extended-spectrum beta-lactamase VEB-1	NA	NA	NA	NA	NA
WP_011788815.1|3661769_3663020_+|transposase	IS4-like element IS10A family transposase	transposase	Q9E8P4	Bluetongue_virus	71.4	4.2e-171
WP_001470697.1|3663144_3663798_+|integrase	phage integrase N-terminal SAM-like domain-containing protein	integrase	A0A2I7SAK5	Vibrio_phage	58.1	1.1e-21
WP_079261366.1|3663936_3665481_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000959805.1|3667407_3667980_-	aminoglycoside N-acetyltransferase AAC(6')-Ian	NA	A0A0N9SKF6	Staphylococcus_phage	40.1	1.8e-36
WP_001470697.1|3668181_3668835_+|integrase	phage integrase N-terminal SAM-like domain-containing protein	integrase	A0A2I7SAK5	Vibrio_phage	58.1	1.1e-21
WP_079261367.1|3669061_3670594_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001253716.1|3670685_3671411_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001257840.1|3671431_3672607_-	tetracycline efflux MFS transporter Tet(G)	NA	NA	NA	NA	NA
WP_000163574.1|3672710_3673337_+	tetracycline resistance transcriptional repressor TetR(G)	NA	NA	NA	NA	NA
WP_001747812.1|3673333_3673516_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214125.1|3673543_3674758_-	chloramphenicol/florfenicol efflux MFS transporter FloR2	NA	S4TR35	Salmonella_phage	23.7	9.8e-16
WP_000259025.1|3674974_3675871_-	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_000679427.1|3675864_3676212_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000777554.1|3676915_3677389_-	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
WP_000845039.1|3677545_3678559_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000480959.1|3678819_3679656_-	APH(6)-I family aminoglycoside O-phosphotransferase	NA	NA	NA	NA	NA
WP_025464697.1|3679655_3680459_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.6	2.2e-24
WP_000137809.1|3680641_3681931_-|transposase	ISL3-like element ISPpu12 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	40.4	9.5e-86
WP_005136949.1|3681952_3682465_-	signal peptidase II	NA	NA	NA	NA	NA
WP_000041516.1|3682468_3683365_-	cation transporter	NA	NA	NA	NA	NA
WP_001219642.1|3683460_3683868_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001275666.1|3684690_3685125_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	56.5	2.9e-39
WP_000372102.1|3685182_3685503_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	63.7	2.1e-26
WP_000670219.1|3685509_3685983_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	53.2	3.9e-37
WP_000068656.1|3685990_3687034_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_000174605.1|3687039_3687744_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	70.9	1.3e-92
WP_001172025.1|3687761_3688715_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.1	2.4e-62
WP_000192758.1|3688816_3689884_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	58.7	7.1e-95
WP_005116093.1|3689987_3691436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002024550.1|3691428_3692544_-	TniQ family protein	NA	NA	NA	NA	NA
WP_000417085.1|3692573_3693494_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_000573062.1|3693498_3695409_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000736404.1|3695409_3696120_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	I6WI48	Vibriophage	29.3	9.1e-06
3695783:3695798	attR	TCCCAGTCTTCAACAA	NA	NA	NA	NA
>prophage 10
NC_010410	Acinetobacter baumannii AYE, complete genome	3936291	3865650	3930205	3936291	holin,tRNA,protease,transposase	Tupanvirus(20.0%)	56	NA	NA
WP_001081748.1|3865650_3867819_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_001217232.1|3868107_3868824_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_085920706.1|3868982_3870125_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_000994544.1|3870155_3871181_-	ferredoxin reductase	NA	NA	NA	NA	NA
WP_000027529.1|3871354_3871993_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001047027.1|3872129_3872777_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000737570.1|3872855_3873473_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_000080759.1|3873652_3874366_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_000973871.1|3874362_3875064_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_000877608.1|3875129_3875876_+	YciK family oxidoreductase	NA	NA	NA	NA	NA
WP_014462675.1|3876147_3876504_+	RcnB family protein	NA	NA	NA	NA	NA
WP_000724539.1|3876726_3877047_+	RcnB family protein	NA	NA	NA	NA	NA
WP_001142457.1|3877167_3878523_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_001173276.1|3878856_3879825_+	sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001164678.1|3879896_3880880_+	sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000689562.1|3880906_3882082_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_000031022.1|3882078_3882876_+	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_000183286.1|3882889_3883690_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	36.9	4.3e-28
WP_001186827.1|3883950_3884571_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001090743.1|3884605_3885172_-	5'-nucleosidase	NA	NA	NA	NA	NA
WP_000828383.1|3885252_3886386_-	TDT family transporter	NA	NA	NA	NA	NA
WP_085940413.1|3886531_3887621_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_000771825.1|3887783_3888785_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_001281046.1|3888846_3891684_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	27.0	1.1e-78
WP_001133879.1|3891676_3892207_+	signal peptidase II	NA	NA	NA	NA	NA
WP_000136002.1|3892208_3892691_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_000964180.1|3892824_3893367_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002035835.1|3893412_3893754_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_002013328.1|3899627_3900113_-	peptidyl-prolyl cis-trans isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	37.5	1.9e-15
WP_000123587.1|3900328_3901399_-	alpha/beta hydrolase	NA	A0A2K9L3Q5	Tupanvirus	27.3	9.8e-12
WP_001274778.1|3901609_3901936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000733015.1|3902109_3902340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000765235.1|3902731_3903598_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_001262789.1|3904762_3905317_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001062607.1|3905470_3907411_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	48.3	2.9e-147
WP_000714235.1|3907741_3908659_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_001241361.1|3908845_3909751_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_001985173.1|3909852_3910239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170318964.1|3910288_3911497_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_000361794.1|3912207_3913329_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000994663.1|3913338_3913851_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.9	1.0e-19
WP_002018080.1|3914034_3914397_-	DMT family protein	NA	NA	NA	NA	NA
WP_000550101.1|3914638_3916012_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_001266008.1|3916081_3917332_-	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_000051338.1|3917467_3918064_+	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
WP_000447690.1|3918382_3919339_+	TerC family protein	NA	A0A1D7XFL1	Escherichia_phage	32.5	2.2e-31
WP_001256728.1|3919527_3919893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000823196.1|3919914_3921075_+	glutathionylspermidine synthase family protein	NA	E5E3Y5	Acinetobacter_phage	44.8	3.1e-96
WP_000991559.1|3921365_3922421_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_000052288.1|3922477_3923803_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000214980.1|3924017_3924545_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.5	3.6e-15
WP_000269732.1|3924717_3924969_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_041171172.1|3925022_3925718_-	DsbC family protein	NA	NA	NA	NA	NA
WP_085940413.1|3925737_3926828_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001136784.1|3926861_3927044_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	58.3	9.4e-08
WP_085940413.1|3929115_3930205_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
>prophage 1
NC_010404	Acinetobacter baumannii AYE plasmid p3ABAYE, complete sequence	94413	70939	78904	94413	transposase	Acinetobacter_phage(50.0%)	13	NA	NA
WP_000743263.1|70939_71872_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	41.0	3.9e-57
WP_025464206.1|72002_72200_-	hypothetical protein	NA	A0A1B1P9F8	Acinetobacter_phage	57.1	7.5e-11
WP_000994925.1|72292_72511_-	hypothetical protein	NA	A0A0R6PIC9	Moraxella_phage	77.4	4.0e-21
WP_000096286.1|72567_73170_-	hypothetical protein	NA	A0A0P0J0J1	Acinetobacter_phage	62.2	3.2e-36
WP_000453245.1|73376_73646_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000288004.1|73700_74030_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	64.6	2.9e-23
WP_001258993.1|74016_74304_+	helix-turn-helix domain-containing protein	NA	A0A088CD40	Shigella_phage	48.4	3.3e-15
WP_000340067.1|74340_74529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002120129.1|75283_75460_-	hypothetical protein	NA	A0A0R6PIB1	Moraxella_phage	57.7	1.1e-08
WP_005804845.1|75531_75855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000372120.1|77316_77958_-	hypothetical protein	NA	A0A0P0I8J9	Acinetobacter_phage	85.0	3.2e-111
WP_000378528.1|77926_78388_-	hypothetical protein	NA	A0A0P0IRI6	Acinetobacter_phage	73.8	9.0e-55
WP_001136766.1|78448_78904_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	95.4	4.7e-80
