The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_010170	Bordetella petrii, complete genome	5287950	215831	240956	5287950	transposase	Leptospira_phage(60.0%)	19	NA	NA
WP_085970191.1|215831_217005_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.2	6.7e-62
WP_158310063.1|217275_218145_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_085970192.1|218225_219312_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.3e-43
WP_158310064.1|219925_220318_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_085970193.1|220665_221752_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_158310065.1|222305_222608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012247231.1|223520_223952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012247232.1|225572_227390_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_151208926.1|227712_228150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085970194.1|228223_229344_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.6	1.8e-48
WP_012247236.1|229876_230881_+	TniQ family protein	NA	NA	NA	NA	NA
WP_012247237.1|230904_232401_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_085970191.1|232550_233725_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.2	6.7e-62
WP_151208928.1|233903_234620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012247239.1|234732_234945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012247242.1|236551_237124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012247243.1|237116_239129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151208929.1|239131_239857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012247245.1|240728_240956_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_010170	Bordetella petrii, complete genome	5287950	1034812	1042904	5287950		Pseudomonas_phage(50.0%)	9	NA	NA
WP_151208935.1|1034812_1035202_-	hypothetical protein	NA	A0A1L2C9A6	Pseudomonas_phage	44.3	1.3e-17
WP_041862710.1|1035210_1035411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012247956.1|1035407_1035833_-	hypothetical protein	NA	A0A097EYP5	Mycobacterium_phage	43.2	7.3e-19
WP_012247957.1|1035834_1036113_-	DUF4031 domain-containing protein	NA	A0A291LA06	Bordetella_phage	71.6	1.1e-23
WP_151209019.1|1037800_1039621_-	DNA cytosine methyltransferase	NA	Q9ZXI4	Pseudomonas_virus	60.5	6.1e-163
WP_012247960.1|1039773_1039977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012247961.1|1039985_1040453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012247962.1|1040449_1042222_-	AAA family ATPase	NA	J7HXJ7	Pseudomonas_phage	38.0	3.6e-83
WP_012247963.1|1042226_1042904_-	hypothetical protein	NA	J7I0T4	Pseudomonas_phage	39.2	2.1e-20
>prophage 3
NC_010170	Bordetella petrii, complete genome	5287950	1053426	1109822	5287950	terminase,integrase,transposase,capsid	Pseudomonas_phage(24.0%)	66	1058002:1058018	1118061:1118077
WP_012247981.1|1053426_1054503_+	DUF1376 domain-containing protein	NA	A9YWY6	Burkholderia_phage	50.6	5.2e-45
WP_012247982.1|1054483_1055185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162098127.1|1055536_1055788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012247984.1|1055685_1056228_+	RusA family crossover junction endodeoxyribonuclease	NA	J7I4J7	Pseudomonas_phage	54.2	3.5e-34
WP_012247985.1|1056220_1056868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012247986.1|1057005_1057299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012247987.1|1057382_1057961_+|terminase	terminase small subunit	terminase	U5PZD3	Bacillus_phage	41.0	7.4e-30
WP_012247988.1|1057962_1059354_+|terminase	phage terminase large subunit	terminase	J7I460	Acinetobacter_phage	56.5	1.0e-141
1058002:1058018	attL	GAACTGGCGCGCGCCGA	NA	NA	NA	NA
WP_012247989.1|1059356_1060637_+	DUF1073 domain-containing protein	NA	A0A2K9V3H1	Faecalibacterium_phage	33.2	1.3e-42
WP_012247990.1|1060572_1061412_+|capsid	minor capsid protein	capsid	I3PGT9	Xanthomonas_phage	35.0	5.0e-35
WP_012247991.1|1061422_1062505_+	DUF2213 domain-containing protein	NA	E5AGA6	Erwinia_phage	39.8	3.6e-54
WP_012247992.1|1062514_1062967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012247993.1|1063033_1063996_+	DUF2184 domain-containing protein	NA	A0A0N9SG07	Pseudomonas_phage	44.8	4.8e-66
WP_012247994.1|1063997_1064333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012247995.1|1064335_1064716_+	DUF4054 domain-containing protein	NA	A0A0N9SJE5	Pseudomonas_phage	43.5	6.6e-11
WP_012247996.1|1064702_1065161_+	hypothetical protein	NA	E5AGB1	Erwinia_phage	30.1	4.8e-08
WP_012247997.1|1065160_1065517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012247998.1|1065671_1066187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012247999.1|1066244_1067609_+	DUF3383 family protein	NA	A0A0N9SJA3	Pseudomonas_phage	42.1	6.7e-90
WP_012248000.1|1067620_1068046_+	DUF3277 family protein	NA	A0A2H4P8D6	Pseudomonas_phage	36.8	1.6e-13
WP_012248001.1|1068045_1068525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012248002.1|1068674_1070537_+	tape measure protein	NA	H9EB42	Vibrio_phage	32.6	5.1e-32
WP_012248003.1|1070533_1071091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012248004.1|1071087_1071420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012248005.1|1071406_1072321_+	hypothetical protein	NA	I3PGV5	Xanthomonas_phage	35.6	2.1e-47
WP_012248006.1|1072317_1073010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012248007.1|1073006_1073366_+	hypothetical protein	NA	I3PGV7	Xanthomonas_phage	42.3	2.7e-14
WP_012248008.1|1073388_1074840_+	hypothetical protein	NA	A0A0N9SH53	Pseudomonas_phage	36.4	2.1e-73
WP_012248009.1|1074839_1075595_+	DUF2612 domain-containing protein	NA	A0A2K9V3L5	Faecalibacterium_phage	29.6	6.7e-07
WP_012248010.1|1075622_1077173_+	hypothetical protein	NA	A0A1D8KLY0	Synechococcus_phage	25.7	4.0e-22
WP_012248011.1|1077169_1077580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012248012.1|1077589_1078255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012248013.1|1078269_1078737_+	hypothetical protein	NA	A4JWL9	Burkholderia_virus	44.6	1.4e-07
WP_012248014.1|1078810_1079152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012248015.1|1079148_1079589_+	glycoside hydrolase family protein	NA	A0A1I9L2K1	Xanthomonas_phage	56.1	1.4e-33
WP_041863548.1|1079585_1079816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012248016.1|1079793_1080066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012248017.1|1080335_1081418_-	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_041862719.1|1081616_1081829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041862720.1|1082004_1082208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012248019.1|1082210_1082876_-	SOS response-associated peptidase	NA	A0A1S5NTJ1	Burkholderia_phage	35.5	2.3e-19
WP_041862721.1|1082898_1083258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012248022.1|1085100_1085553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012248023.1|1085859_1086342_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041862725.1|1088781_1088964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041863552.1|1089182_1090181_-	cation transporter	NA	NA	NA	NA	NA
WP_124084334.1|1090292_1091533_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	76.3	1.4e-123
WP_012248032.1|1091694_1092108_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_041862728.1|1092799_1093222_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	75.7	2.2e-55
WP_012248035.1|1093236_1094322_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_012248036.1|1094332_1094830_-	arsenate reductase ArsC	NA	NA	NA	NA	NA
WP_012248037.1|1094842_1095313_-	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_041863555.1|1095325_1095655_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012248039.1|1096270_1097017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003090093.1|1097135_1097348_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_012248040.1|1097390_1098266_+	ParA family protein	NA	NA	NA	NA	NA
WP_012248041.1|1098249_1098519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012248042.1|1098511_1100191_+	ParB family protein	NA	NA	NA	NA	NA
WP_012248043.1|1100205_1100766_+	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
WP_012248044.1|1100769_1102002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003090099.1|1102432_1103227_+	TIGR03761 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_012248045.1|1103223_1103751_+	DUF3158 family protein	NA	NA	NA	NA	NA
WP_003120036.1|1103825_1104278_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_012248046.1|1104553_1106575_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	27.6	2.6e-29
WP_012248048.1|1107784_1108834_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3T6D9	Bacillus_phage	27.9	2.7e-06
WP_012248049.1|1108826_1109822_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1118061:1118077	attR	GAACTGGCGCGCGCCGA	NA	NA	NA	NA
>prophage 4
NC_010170	Bordetella petrii, complete genome	5287950	1154797	1190504	5287950	transposase,integrase	Burkholderia_virus(20.0%)	28	1150739:1150754	1168835:1168850
1150739:1150754	attL	ATCATCCAGCGCGCCG	NA	NA	NA	NA
WP_012248096.1|1154797_1155424_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_012248097.1|1155740_1157603_+	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_158310071.1|1158421_1158745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081482969.1|1161055_1162048_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_151208938.1|1163466_1163565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012248103.1|1163840_1164485_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_012248104.1|1164443_1165685_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_012248105.1|1165731_1166025_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_012248106.1|1166039_1166615_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_041862734.1|1166874_1167336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012248108.1|1167446_1167731_+	hydantoin utilization protein A	NA	NA	NA	NA	NA
WP_158310072.1|1169430_1170021_-	FUSC family protein	NA	NA	NA	NA	NA
1168835:1168850	attR	ATCATCCAGCGCGCCG	NA	NA	NA	NA
WP_124084334.1|1170056_1171297_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	76.3	1.4e-123
WP_012248110.1|1171310_1172009_-	FUSC family protein	NA	NA	NA	NA	NA
WP_012248104.1|1172095_1173337_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_012248111.1|1173352_1174993_-	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_012247241.1|1176919_1177411_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_041863569.1|1177660_1178806_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_012248113.1|1178857_1179925_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_012248114.1|1179935_1181156_-	phenylacetate--CoA ligase family protein	NA	NA	NA	NA	NA
WP_012248115.1|1181183_1181972_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_012248116.1|1182157_1183255_+	CoA transferase	NA	NA	NA	NA	NA
WP_012248117.1|1183378_1184617_+	thiolase family protein	NA	NA	NA	NA	NA
WP_012248118.1|1184681_1186235_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	28.3	4.4e-29
WP_012248119.1|1186325_1187087_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012248120.1|1187221_1188022_+	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	29.5	1.3e-16
WP_050978203.1|1188030_1189323_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	21.4	8.5e-10
WP_085970191.1|1189329_1190504_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.2	6.7e-62
>prophage 5
NC_010170	Bordetella petrii, complete genome	5287950	1491478	1544523	5287950	transposase,integrase	Acinetobacter_phage(37.5%)	51	1489540:1489557	1512845:1512862
1489540:1489557	attL	AGGCTTGGGGCGCGGCAG	NA	NA	NA	NA
WP_012248421.1|1491478_1493314_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U1UNT3	Pseudomonas_phage	50.0	2.1e-102
WP_003460276.1|1494344_1495100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003460278.1|1495219_1495432_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_011489277.1|1495475_1496351_+	ParA family protein	NA	NA	NA	NA	NA
WP_003460282.1|1496334_1496592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011489278.1|1496584_1498237_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_011489279.1|1498252_1498813_+	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
WP_011489280.1|1498816_1500061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011489281.1|1500391_1501171_+	TIGR03761 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_003460292.1|1501167_1501695_+	DUF3158 family protein	NA	NA	NA	NA	NA
WP_011489282.1|1501768_1502209_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_011489283.1|1502487_1504500_+	DNA topoisomerase III	NA	A0A0G2Y787	Acanthamoeba_polyphaga_mimivirus	22.8	1.4e-11
WP_012248050.1|1505778_1506987_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012248049.1|1506986_1507982_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_085970191.1|1508108_1509283_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.2	6.7e-62
WP_011489285.1|1511661_1512219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003290186.1|1512549_1512762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011489287.1|1512783_1513176_+	hypothetical protein	NA	NA	NA	NA	NA
1512845:1512862	attR	CTGCCGCGCCCCAAGCCT	NA	NA	NA	NA
WP_011489288.1|1513348_1514035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011489289.1|1514114_1514852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003290191.1|1514949_1515228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085970191.1|1516253_1517428_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.2	6.7e-62
WP_003290193.1|1517755_1518109_+	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_011489292.1|1518254_1519097_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A1P8VV89	Erythrobacter_phage	41.5	2.7e-49
WP_029044444.1|1519102_1519612_+	hypothetical protein	NA	Q6JIG5	Burkholderia_virus	68.9	2.7e-52
WP_003290197.1|1519874_1520792_+	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_012248427.1|1520849_1521539_+	DUF3275 family protein	NA	NA	NA	NA	NA
WP_003460300.1|1521634_1521967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003460301.1|1522063_1522471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011489294.1|1522487_1522748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011489295.1|1522824_1523475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011489296.1|1523539_1524649_+	O-methyltransferase	NA	NA	NA	NA	NA
WP_012248428.1|1525669_1527490_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	29.8	4.8e-27
WP_011489298.1|1529678_1530548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011489299.1|1530708_1531308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011489300.1|1531304_1531955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003290214.1|1531969_1532689_+	TIGR03759 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_011489301.1|1532670_1533261_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_003460312.1|1533257_1533806_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_003290220.1|1533810_1535997_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_003290222.1|1535993_1536743_+	TIGR03747 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
WP_011489302.1|1536779_1537184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011489303.1|1537369_1537753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003050225.1|1537749_1537983_+	TIGR03758 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_003290228.1|1537999_1538359_+	TIGR03745 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
WP_003290229.1|1538371_1538782_+	TIGR03750 family conjugal transfer protein	NA	NA	NA	NA	NA
WP_003460319.1|1538778_1539471_+	TIGR03746 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_003290231.1|1539467_1540400_+	TIGR03749 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_011489305.1|1540389_1541808_+	TIGR03752 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_003290235.1|1541788_1542229_+	TIGR03751 family conjugal transfer lipoprotein	NA	NA	NA	NA	NA
WP_085970191.1|1543349_1544523_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.2	6.7e-62
>prophage 6
NC_010170	Bordetella petrii, complete genome	5287950	1547844	1595424	5287950	transposase,integrase	Brevibacillus_phage(25.0%)	44	1537507:1537523	1597569:1597585
1537507:1537523	attL	CCAGCTCGACGCGCTGG	NA	NA	NA	NA
WP_012248433.1|1547844_1549104_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012248434.1|1549100_1550093_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012248435.1|1550089_1551100_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	30.0	2.8e-24
WP_011489309.1|1551599_1552046_+	TIGR03757 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_011489310.1|1552042_1552990_+	TIGR03756 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_011489311.1|1552999_1554397_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_011489312.1|1554393_1554753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011489313.1|1554768_1556286_+	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_011489314.1|1556299_1556677_-	DUF3742 family protein	NA	NA	NA	NA	NA
WP_011489315.1|1556704_1557163_-	type II toxin-antitoxin system YhaV family toxin	NA	NA	NA	NA	NA
WP_003290252.1|1557162_1557480_-	type II toxin-antitoxin system PrlF family antitoxin	NA	NA	NA	NA	NA
WP_012248437.1|1557785_1559633_+	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_081482991.1|1560147_1560726_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012248440.1|1560802_1561570_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	35.2	1.8e-20
WP_012248441.1|1561651_1562170_-	aromatic-ring-hydroxylating dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_081482992.1|1562212_1562731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012248443.1|1562791_1564339_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_041862790.1|1566126_1567494_-	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_151209032.1|1567490_1568105_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012248448.1|1568128_1568749_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012248449.1|1568762_1569353_-	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_012248450.1|1569367_1569670_-	Dabb family protein	NA	NA	NA	NA	NA
WP_012248451.1|1569682_1569988_-	YciI family protein	NA	NA	NA	NA	NA
WP_173376827.1|1570185_1571982_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0P0YLZ6	Yellowstone_lake_phycodnavirus	31.1	3.0e-21
WP_041862792.1|1571984_1572680_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_012248453.1|1572676_1573705_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_012248454.1|1573701_1574760_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_012248455.1|1574752_1575355_-	acyltransferase	NA	NA	NA	NA	NA
WP_041862793.1|1575338_1576571_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_012248457.1|1576781_1577165_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_012248458.1|1577567_1579115_-|transposase	IS91-like element ISPps1 family transposase	transposase	NA	NA	NA	NA
WP_012248462.1|1580831_1581716_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012248463.1|1581885_1582668_+	chlorocatechol 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_011489354.1|1582664_1583777_+	muconate cycloisomerase family protein	NA	NA	NA	NA	NA
WP_012248464.1|1583803_1584787_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_011489356.1|1584808_1585519_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_011489357.1|1585515_1586574_+	maleylacetate reductase	NA	NA	NA	NA	NA
WP_011489358.1|1586689_1587673_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012248465.1|1588468_1589731_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_011489368.1|1589733_1590213_+	aromatic-ring-hydroxylating dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_011489369.1|1590310_1591288_+	oxidoreductase	NA	NA	NA	NA	NA
WP_012248466.1|1591492_1592878_+	MFS transporter	NA	NA	NA	NA	NA
WP_029044453.1|1592981_1593284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011489372.1|1593492_1595424_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U1UNT3	Pseudomonas_phage	49.5	6.6e-99
1597569:1597585	attR	CCAGCGCGTCGAGCTGG	NA	NA	NA	NA
>prophage 7
NC_010170	Bordetella petrii, complete genome	5287950	2665189	2673281	5287950	tRNA	uncultured_Mediterranean_phage(28.57%)	9	NA	NA
WP_012249456.1|2665189_2666038_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	47.4	1.3e-14
WP_173376870.1|2666055_2666802_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	47.5	3.5e-32
WP_012249458.1|2666855_2667614_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.2	1.4e-65
WP_012249459.1|2667795_2668434_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_012249460.1|2668449_2669496_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	53.0	5.9e-94
WP_012249461.1|2669571_2670864_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.9	4.3e-70
WP_012249462.1|2671157_2672177_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012249463.1|2672282_2672660_+	thioredoxin	NA	V9SJ74	Achromobacter_phage	28.9	1.2e-09
WP_012249464.1|2672681_2673281_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	35.9	5.7e-17
>prophage 8
NC_010170	Bordetella petrii, complete genome	5287950	3912547	3969385	5287950	transposase,integrase	Stenotrophomonas_phage(16.67%)	59	3931113:3931172	3974397:3975678
WP_151209067.1|3912547_3913861_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.3	6.7e-79
WP_012250599.1|3913945_3914248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012250600.1|3914295_3914961_+	conjugal transfer protein TrbM	NA	NA	NA	NA	NA
WP_012250601.1|3914972_3915638_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_012250602.1|3915728_3916049_+	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_012250603.1|3916052_3916373_+	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_012250604.1|3916384_3918829_+	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
WP_012250605.1|3918840_3919398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012250606.1|3919588_3919972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012250607.1|3920010_3920715_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_012250608.1|3920724_3921675_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_012250609.1|3921762_3921900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012250610.1|3921903_3922590_+	conjugal transfer protein TraJ	NA	NA	NA	NA	NA
WP_012250611.1|3922617_3923505_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_012250612.1|3923501_3924635_+	type IV secretion system protein VirB10	NA	NA	NA	NA	NA
WP_012250613.1|3924612_3925632_+	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
WP_012250614.1|3925779_3926697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012250615.1|3927148_3927637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151208976.1|3927633_3928071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012250616.1|3928067_3928775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012250617.1|3928786_3929221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012250618.1|3929233_3930880_+	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
3931113:3931172	attL	TGAGCTTGCCCGCAAAAAATGGATCCCTTGCTGAGTGTGTAAAACTCACGCAAGGAGGGA	NA	NA	NA	NA
WP_085970191.1|3931178_3932352_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.2	6.7e-62
WP_050978259.1|3935067_3935682_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012250621.1|3935986_3937357_-	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_041864193.1|3937356_3937995_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012250623.1|3938056_3938671_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_012250624.1|3938667_3939300_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_050978260.1|3939439_3939661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050978261.1|3939675_3939993_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012250626.1|3939992_3940328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012250627.1|3940342_3941416_+	maleylacetate reductase	NA	NA	NA	NA	NA
WP_085970224.1|3941961_3943522_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	31.8	3.0e-09
WP_012250632.1|3944227_3944929_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_050978262.1|3944929_3945118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012250633.1|3945314_3946382_+|transposase	IS630-like element IS1066 family transposase	transposase	NA	NA	NA	NA
WP_012250634.1|3946636_3947467_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_041863076.1|3947552_3948905_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_012250636.1|3949014_3949578_+	3-phenylpropionate/cinnamic acid dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_012250637.1|3949586_3949910_+	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_012250638.1|3949909_3951142_+	oxidoreductase	NA	NA	NA	NA	NA
WP_012250639.1|3951138_3951966_+	cis-2,3-dihydrobiphenyl-2,3-diol dehydrogenase	NA	NA	NA	NA	NA
WP_081483019.1|3951966_3953154_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_012250641.1|3953140_3953626_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_151209069.1|3953743_3955336_+	MFS transporter	NA	NA	NA	NA	NA
WP_158310089.1|3955494_3956445_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012250644.1|3956646_3957531_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012250645.1|3957680_3958436_+	chlorocatechol 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_011255151.1|3958432_3959545_+	muconate cycloisomerase family protein	NA	Q6A202	Oenococcus_phage	22.7	1.9e-10
WP_158310090.1|3959681_3960557_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_011255149.1|3960578_3961295_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_011255148.1|3961291_3962350_+	maleylacetate reductase	NA	NA	NA	NA	NA
WP_012250647.1|3963311_3963491_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012250648.1|3963487_3964210_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	7.8e-13
WP_012250649.1|3964206_3964968_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.4	2.0e-11
WP_050978265.1|3964964_3965978_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_012250651.1|3966291_3966870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012250652.1|3966968_3968405_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_041864210.1|3968908_3969385_+|transposase	transposase	transposase	NA	NA	NA	NA
3974397:3975678	attR	TGAGCTTGCCCGCAAAAAATGGATCCCTTGCTGAGTGTGTAAAACTCACGCAAGGAGGGAGGAAAGATGGGTAATCCGAGAGCTCGATATACGCAGGAATTCATGCTGGAAGCCGTGCGCATGGTCCGCGGCGGCCAGAGCATGGCGGCGGTGGCGAAGATACTGGGCATCAGCCCGAAGACGCTGCACAACTGGGTGAAGGCCGATGCCGCTGGGAAGCTGAACGGCGCAGGCAAACAGGTTTCTCCAGAACAGATGGAGATTGCCCGGCTGCGCGCGGAGTTGGCACGCGTGAAGATGGAGCGCGACATATTGGGAAAAGCCACGGCGTACTTTGCGAAGGTGTCGGCATGAAGTACGCCTGGATCGAGCTTCACAGCCGACAATGGCCGGTGTCCCTGAGCTGCCAGGTGCTGGGTGTCAGCCCCAGCGGTTACCACGCGCGCAAGGTGCGGGATGTCGATACTGACCGACCGCGCCGACGCATCAGCAACGACGCTCTGCTGGTGCACATCAAGGCCGTGCACGCTGAATCCAAAGGCGAGTACGGCTGGCCGCGCGTGTGGAAGCAACTGCTGGTCCAGGGCATTCGCGTCAGCAAGGATCGTGTCCAGCGGCTCATGAAGCTGCACGGCATCAAGGCGAAGACCAAACGCCGGTTCAAGGTCACGACCGACAGCAAACACAGCCTGCCGGTCGCACCGGACCTGCTGCAACGAGACTTCTCTCCCGCGCGTCCCGACCAGGTCTGGACTACGGACATCACGTACATCTGGACGGACGAGGGTTGGCTGTTTCTGACCGTCATTCTCGACCTGTTCAGCCGTCAGGTGGTGGGCTGGTCGATGCAGCCGCACATGCGCACGGAGCTGGTGTCTGATGCGCTGCGTATGGCGTGGTTTCGCCGCCGTCCGCAAGCGGGCCTGATCCTCCACAGTGACCGTGGCAGCCAGTATTGCAGTCATGACTTCCAGGACCTGCTCAAGGGCTACGGCATGCGCAGTTCGATGAGCCGTCGAGGCAATTGCTGGGACAACGCACCGACCGAGAGCCTGTGGGGATCGCTCAAGCGTGCACGCATCCTCGGCCAGCGCTTTGCAACGCGTCGCGAAGCGATGGACGAGGTAATCGACTGGTTGAGCTTCTACAATCATTCGCGCTTGCACTCGACGTTGGGCTACGTCAGCCCGATGCAATTCGAGCGGGACTGGTACGCCGCCCAGAACCAACGGGTGGCATAATCTCGCTCAGTTAAGGGATCCGAAATTCGCGGGCAACGTCA	NA	NA	NA	NA
>prophage 9
NC_010170	Bordetella petrii, complete genome	5287950	4644776	4679794	5287950	transposase,capsid,tail,integrase,plate	Alteromonadaceae_phage(50.0%)	50	4654833:4654850	4689925:4689942
WP_151209077.1|4644776_4645175_-	helix-turn-helix domain-containing protein	NA	A7Y8H7	Pseudomonas_virus	62.1	2.6e-10
WP_012251216.1|4645372_4645675_+	helix-turn-helix domain-containing protein	NA	A0A2P9JZG5	Alteromonadaceae_phage	67.9	4.4e-26
WP_012251217.1|4645781_4646267_+	hypothetical protein	NA	A0A2P9JZG6	Alteromonadaceae_phage	55.6	1.2e-38
WP_012251218.1|4646263_4648225_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2P9JZG7	Alteromonadaceae_phage	54.7	4.3e-207
WP_012251219.1|4648308_4649277_+	AAA family ATPase	NA	A0A2P9JZG8	Alteromonadaceae_phage	60.2	5.1e-100
WP_151208984.1|4649273_4649462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158310097.1|4649458_4649623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041863167.1|4649619_4649934_+	hypothetical protein	NA	A0A2P9JZG9	Alteromonadaceae_phage	42.7	6.4e-12
WP_012251221.1|4649930_4650305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012251222.1|4650333_4650957_+	DUF3164 family protein	NA	A0A0A1IVF8	Pseudomonas_phage	45.8	8.4e-48
WP_050978280.1|4650953_4651430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081483072.1|4651660_4651897_+	hypothetical protein	NA	A0A2D2W2G5	Stenotrophomonas_phage	47.9	4.1e-11
WP_012251225.1|4652351_4652954_+	regulatory protein GemA	NA	A0A2P9JZH5	Alteromonadaceae_phage	55.3	1.6e-43
WP_012251226.1|4652953_4653241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012251228.1|4653712_4654102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012251229.1|4654094_4654520_+	hypothetical protein	NA	B5TA91	Burkholderia_phage	39.3	5.1e-12
WP_012251230.1|4654625_4654958_+	membrane protein	NA	A0A2P1A4C6	Alteromonadaceae_phage	48.2	2.6e-19
4654833:4654850	attL	GCCGCCCAGGCCGCCGCC	NA	NA	NA	NA
WP_173376880.1|4654974_4655592_+	transglycosylase SLT domain-containing protein	NA	A0A2P9JZI1	Alteromonadaceae_phage	59.1	3.7e-64
WP_012251232.1|4655585_4655993_+	hypothetical protein	NA	A0A2P9JZI2	Alteromonadaceae_phage	40.0	1.4e-14
WP_012251233.1|4655989_4656298_+	hypothetical protein	NA	A0A2P9JZI3	Alteromonadaceae_phage	50.8	5.3e-11
WP_041863169.1|4656248_4656494_+	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_012251235.1|4656493_4656835_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_012251236.1|4656838_4657138_+	hypothetical protein	NA	A0A2P9JZI6	Alteromonadaceae_phage	79.8	2.4e-40
WP_012251237.1|4657139_4657688_+	DUF3486 family protein	NA	A0A2P9JZI7	Alteromonadaceae_phage	71.5	1.0e-60
WP_012251238.1|4657690_4659406_+	hypothetical protein	NA	A0A219VH72	Ochrobactrum_phage	42.3	3.4e-99
WP_012251239.1|4659406_4660882_+	DUF935 family protein	NA	A0A0S4L5M4	Pseudomonas_phage	54.7	1.2e-140
WP_012251240.1|4660882_4661677_+	F protein (gpF) (protein gp30)	NA	J9STS2	Pseudomonas_phage	51.8	8.5e-69
WP_012251241.1|4661681_4662194_+	phage virion morphogenesis protein	NA	A0A2H4J9E5	uncultured_Caudovirales_phage	42.1	5.3e-24
WP_151208986.1|4662429_4663575_+	peptidase	NA	Q6QIB7	Burkholderia_phage	44.3	3.4e-71
WP_012251243.1|4663579_4663924_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_012251244.1|4663948_4664884_+|capsid	major capsid protein	capsid	R9U4B8	Rhizobium_phage	48.4	1.5e-80
WP_012251245.1|4664947_4665430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041863171.1|4665432_4665843_+	DUF1320 family protein	NA	A0A2P9JZJ4	Alteromonadaceae_phage	36.9	1.1e-16
WP_012251247.1|4665842_4666421_+	DUF1834 family protein	NA	NA	NA	NA	NA
WP_012251248.1|4666417_4666630_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_012251249.1|4666629_4668117_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A2P9JZJ8	Alteromonadaceae_phage	56.2	1.1e-157
WP_012251250.1|4668143_4668500_+|tail	phage tail tube protein	tail	A0A2I7S9D5	Vibrio_phage	35.9	2.9e-13
WP_012251251.1|4668503_4668866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151208987.1|4668986_4670762_+	hypothetical protein	NA	A0A291AUM6	Sinorhizobium_phage	38.0	8.1e-27
WP_151208988.1|4670767_4670953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012251254.1|4670996_4672250_+	DNA circularization N-terminal domain-containing protein	NA	A0A2P9JZK2	Alteromonadaceae_phage	32.9	7.9e-45
WP_050978282.1|4672317_4673322_+	hypothetical protein	NA	A0A2P9JZK3	Alteromonadaceae_phage	46.1	2.8e-69
WP_012251256.1|4673318_4673885_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	50.0	4.7e-37
WP_012251257.1|4673884_4674328_+	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	50.4	9.6e-30
WP_012251258.1|4674339_4675392_+|plate	baseplate J/gp47 family protein	plate	A0A2P9JZK6	Alteromonadaceae_phage	42.2	9.8e-65
WP_012251259.1|4675376_4676003_+	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	34.5	7.2e-31
WP_012251260.1|4676005_4676806_+	hypothetical protein	NA	A0A0A8J8U5	Ralstonia_phage	35.7	1.9e-23
WP_081483074.1|4677898_4678090_+	Com family DNA-binding transcriptional regulator	NA	A0A1S5NPS9	Burkholderia_phage	54.7	2.0e-08
WP_012251262.1|4678031_4678805_+	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	50.6	4.4e-54
WP_012251263.1|4678807_4679794_-|integrase	site-specific integrase	integrase	A0A2H4JE37	uncultured_Caudovirales_phage	30.5	3.9e-23
4689925:4689942	attR	GGCGGCGGCCTGGGCGGC	NA	NA	NA	NA
