The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_010125	Gluconacetobacter diazotrophicus PA1 5, complete genome	3944163	368587	413163	3944163	transposase,bacteriocin	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(28.57%)	42	NA	NA
WP_012222646.1|368587_369646_+|transposase	IS481-like element ISGdi10 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	63.9	1.2e-126
WP_050935107.1|369798_370920_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012222652.1|371139_371997_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012222656.1|372257_374186_+	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_012222658.1|374182_376051_+	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	NA	NA	NA	NA
WP_012222660.1|376053_376956_+	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_012222662.1|376937_377738_+	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_012222665.1|377772_379266_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_012222667.1|379311_380325_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_012222669.1|380379_380910_-	RcnB family protein	NA	NA	NA	NA	NA
WP_012554306.1|382792_383641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012222673.1|383752_384043_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_012554307.1|384032_384332_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_012222646.1|385040_386099_+|transposase	IS481-like element ISGdi10 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	63.9	1.2e-126
WP_012554308.1|386418_386601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144880585.1|388166_388463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041249247.1|388455_388815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157864127.1|389212_390330_-|transposase	IS3-like element ISGdi11 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	2.9e-54
WP_050934969.1|390358_391039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012222702.1|391373_392813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012222704.1|393089_393770_+	DNA methyltransferase	NA	A0A2K9VH43	Faecalibacterium_phage	38.6	3.5e-31
WP_041249632.1|394135_394552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041249248.1|395204_395522_+	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_012222712.1|395572_395824_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041249249.1|396237_396882_+	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
WP_012222719.1|396978_397275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012222721.1|397271_398345_+	replication initiator protein A	NA	NA	NA	NA	NA
WP_012222723.1|398341_398830_+	DUF2840 domain-containing protein	NA	NA	NA	NA	NA
WP_012222725.1|398826_399456_+	S26 family signal peptidase	NA	NA	NA	NA	NA
WP_012222727.1|399514_399856_+	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_012222729.1|399852_400524_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	40.0	1.6e-12
WP_041249250.1|400669_401752_+|transposase	IS110-like element ISGdi15 family transposase	transposase	NA	NA	NA	NA
WP_144880576.1|402120_402318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012222742.1|402314_404054_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_012222744.1|404183_404741_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_012222746.1|404752_405184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012222748.1|405193_405445_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_076611705.1|406715_407944_-|transposase	IS3-like element ISGdi14 family transposase	transposase	Q8W6R2	Burkholderia_virus	64.2	1.9e-99
WP_012222757.1|408617_409397_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.3	7.9e-35
WP_012553862.1|410490_411072_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012222762.1|411296_412337_+	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_012222764.1|412338_413163_+|bacteriocin	bacteriocin family protein	bacteriocin	NA	NA	NA	NA
>prophage 2
NC_010125	Gluconacetobacter diazotrophicus PA1 5, complete genome	3944163	951423	1006963	3944163	tRNA,transposase	Rhizobium_phage(20.0%)	39	NA	NA
WP_012553578.1|951423_952002_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_012223788.1|952001_953096_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_012223796.1|954625_955273_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_144880108.1|955278_955827_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_012223805.1|956399_957116_-	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_012223807.1|957435_957786_-	RidA family protein	NA	NA	NA	NA	NA
WP_012553574.1|957856_958513_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_012223808.1|958509_959583_-	XdhC family protein	NA	NA	NA	NA	NA
WP_173363398.1|959761_960409_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_144880103.1|960453_960960_+	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_012223811.1|960964_962101_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_081482917.1|967981_969640_-	recombinase family protein	NA	R9TP69	Rhizobium_phage	36.4	1.7e-87
WP_012223814.1|970240_972298_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_012223815.1|972401_973124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012223817.1|974484_975165_-	4-hydroxythreonine-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_041249281.1|975161_976166_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_012223819.1|976241_977099_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012223821.1|977389_978661_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_012223823.1|978657_980484_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_012223825.1|980609_982151_+	serine/threonine protein kinase	NA	A0A2I2L395	Orpheovirus	26.7	1.4e-14
WP_157864127.1|982231_983348_+|transposase	IS3-like element ISGdi11 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	2.9e-54
WP_012223826.1|983508_985695_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	30.1	4.0e-68
WP_081482848.1|985936_986125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012223829.1|986138_987845_+	recombinase family protein	NA	R9TP69	Rhizobium_phage	35.7	1.7e-82
WP_041249676.1|987954_988320_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_041249283.1|988343_988523_+	DUF4102 domain-containing protein	NA	E5AGD0	Erwinia_phage	49.1	6.6e-06
WP_157870991.1|988758_989463_+	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_012223837.1|989466_990522_+	macro domain-containing protein	NA	B0FIJ9	Escherichia_phage	42.0	1.3e-24
WP_041249285.1|992284_993574_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	33.1	5.1e-39
WP_041249286.1|993573_994374_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	45.2	1.2e-57
WP_012223848.1|994370_995447_+	DUF4917 family protein	NA	NA	NA	NA	NA
WP_012222646.1|995921_996980_-|transposase	IS481-like element ISGdi10 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	63.9	1.2e-126
WP_157870992.1|997142_998329_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_012223855.1|998398_999172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156472016.1|999257_1000086_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012223859.1|1001645_1002785_-	MFS transporter	NA	NA	NA	NA	NA
WP_012223861.1|1003900_1004224_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012223862.1|1004277_1005174_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_041249290.1|1005439_1006963_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_010125	Gluconacetobacter diazotrophicus PA1 5, complete genome	3944163	1051734	1109870	3944163	transposase,protease	Leptospira_phage(22.22%)	44	NA	NA
WP_012223918.1|1051734_1052409_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.0	3.3e-29
WP_012223919.1|1052518_1053511_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_012223920.1|1053507_1054371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012223921.1|1054456_1054714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041249297.1|1054768_1054954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157870995.1|1055089_1055383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041249299.1|1055397_1055826_+	MFS transporter	NA	NA	NA	NA	NA
WP_012223923.1|1055977_1057795_+	DUF885 family protein	NA	NA	NA	NA	NA
WP_144880446.1|1058194_1058485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157864216.1|1058481_1059710_-|transposase	IS3-like element ISGdi14 family transposase	transposase	Q8W6R2	Burkholderia_virus	64.2	2.5e-99
WP_041249300.1|1060094_1060811_+	YfdX family protein	NA	NA	NA	NA	NA
WP_041249301.1|1060845_1062285_-	cytosine permease	NA	NA	NA	NA	NA
WP_012223932.1|1064361_1065072_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_041249303.1|1065234_1065789_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	35.6	2.5e-19
WP_041249208.1|1067936_1068158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012223947.1|1069165_1069723_+	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_012223951.1|1071509_1071992_-	Hsp20 family protein	NA	M4QDX9	Cyanophage	37.2	2.0e-17
WP_039905436.1|1072027_1072309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102324447.1|1072307_1072571_+	YXWGXW repeat-containing protein	NA	NA	NA	NA	NA
WP_010511782.1|1073091_1073340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010511780.1|1073448_1073712_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_012223960.1|1073704_1074049_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	48.4	5.9e-19
WP_157870996.1|1076207_1077324_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	1.6e-52
WP_041249691.1|1077461_1078673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012224132.1|1078702_1079803_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.2	7.0e-05
WP_162098029.1|1082444_1083392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012224136.1|1083388_1085179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012224137.1|1085171_1086173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081482854.1|1086215_1086482_+	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_041249309.1|1087942_1089004_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	62.6	4.7e-123
WP_157864196.1|1089680_1089896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157864168.1|1092671_1092890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012553437.1|1094405_1095230_-|transposase	IS5-like element ISGdi2 family transposase	transposase	NA	NA	NA	NA
WP_012224144.1|1096108_1097095_+	P-type conjugative transfer protein TrbG	NA	NA	NA	NA	NA
WP_173363400.1|1097157_1098252_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_012224146.1|1098248_1098494_+	DUF2274 domain-containing protein	NA	NA	NA	NA	NA
WP_012224147.1|1098465_1099344_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012224149.1|1099452_1100928_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_012224151.1|1101063_1101672_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012224153.1|1101756_1102857_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012224155.1|1102853_1105670_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_012224158.1|1107025_1107475_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012224160.1|1107544_1108351_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_157870998.1|1108773_1109870_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	2.8e-46
>prophage 4
NC_010125	Gluconacetobacter diazotrophicus PA1 5, complete genome	3944163	1544264	1559748	3944163	transposase	Leptospira_phage(100.0%)	12	NA	NA
WP_081482862.1|1544264_1545089_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012224911.1|1545375_1546455_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041249339.1|1547028_1547661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041249340.1|1548406_1548979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012224920.1|1549061_1549544_+	DUF2840 domain-containing protein	NA	NA	NA	NA	NA
WP_012224922.1|1550222_1551311_+|transposase	IS110-like element ISGdi15 family transposase	transposase	NA	NA	NA	NA
WP_012224926.1|1552112_1554224_+	relaxase/mobilization nuclease and DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_012224927.1|1554389_1554821_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_041249341.1|1555200_1556007_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_157864127.1|1556026_1557144_-|transposase	IS3-like element ISGdi11 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	2.9e-54
WP_157871009.1|1557777_1558005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081482864.1|1558959_1559748_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NC_010125	Gluconacetobacter diazotrophicus PA1 5, complete genome	3944163	1573733	1597579	3944163	transposase,integrase	Enterobacteria_phage(40.0%)	17	1589501:1589515	1599207:1599221
WP_012222646.1|1573733_1574792_-|transposase	IS481-like element ISGdi10 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	63.9	1.2e-126
WP_012553437.1|1576160_1576985_-|transposase	IS5-like element ISGdi2 family transposase	transposase	NA	NA	NA	NA
WP_081434717.1|1577610_1577820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157871010.1|1577860_1578952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012224956.1|1578889_1579882_+|transposase	IS481-like element ISGdi9 family transposase	transposase	NA	NA	NA	NA
WP_012224962.1|1583251_1584097_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	46.1	2.1e-49
WP_041249349.1|1584093_1585341_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	35.6	2.6e-40
WP_041249350.1|1586234_1587680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012222260.1|1588016_1588853_+|transposase	IS5-like element ISGdi1 family transposase	transposase	NA	NA	NA	NA
WP_144880578.1|1588781_1589468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012553975.1|1589482_1590250_-	hypothetical protein	NA	NA	NA	NA	NA
1589501:1589515	attL	GCCTGCCGCCGGGGC	NA	NA	NA	NA
WP_012224980.1|1590410_1590755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012553977.1|1591175_1592144_+	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_012226833.1|1592250_1593774_+|transposase	IS21-like element ISGdi17 family transposase	transposase	NA	NA	NA	NA
WP_012224987.1|1593763_1594543_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.3	7.9e-35
WP_012553437.1|1594844_1595669_+|transposase	IS5-like element ISGdi2 family transposase	transposase	NA	NA	NA	NA
WP_012224988.1|1595983_1597579_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U4JNS1	Bacillus_phage	29.9	2.1e-05
1599207:1599221	attR	GCCCCGGCGGCAGGC	NA	NA	NA	NA
>prophage 6
NC_010125	Gluconacetobacter diazotrophicus PA1 5, complete genome	3944163	2384276	2394020	3944163		uncultured_Mediterranean_phage(50.0%)	6	NA	NA
WP_041249404.1|2384276_2387189_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	60.2	0.0e+00
WP_041249405.1|2387483_2388038_+	single-stranded DNA-binding protein	NA	A0A0U2C0X4	Paracoccus_phage	64.3	3.2e-38
WP_012226218.1|2388205_2390998_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.8	2.1e-93
WP_012226220.1|2390990_2391500_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	45.2	1.3e-30
WP_012226222.1|2391558_2392044_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	50.0	1.4e-34
WP_012226224.1|2392253_2394020_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.9	4.0e-10
>prophage 7
NC_010125	Gluconacetobacter diazotrophicus PA1 5, complete genome	3944163	2802835	2849189	3944163	transposase	Planktothrix_phage(33.33%)	47	NA	NA
WP_012226833.1|2802835_2804359_-|transposase	IS21-like element ISGdi17 family transposase	transposase	NA	NA	NA	NA
WP_012553430.1|2804708_2805431_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	6.2e-26
WP_081482922.1|2805417_2805783_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_012223140.1|2805912_2807256_+|transposase	IS1182-like element ISGdi13 family transposase	transposase	NA	NA	NA	NA
WP_041249443.1|2807322_2807508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012226840.1|2807521_2808181_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_012553433.1|2808177_2809023_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012553434.1|2809246_2809462_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_041249444.1|2809448_2810873_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012226848.1|2810869_2812024_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_012226850.1|2812020_2812968_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_012226852.1|2812972_2813614_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012226854.1|2813652_2815047_+	dihydropyrimidinase	NA	NA	NA	NA	NA
WP_012553437.1|2816399_2817224_-|transposase	IS5-like element ISGdi2 family transposase	transposase	NA	NA	NA	NA
WP_012226859.1|2817265_2817484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012222260.1|2817509_2818346_+|transposase	IS5-like element ISGdi1 family transposase	transposase	NA	NA	NA	NA
WP_012226673.1|2818414_2819665_+|transposase	IS701-like element ISGdi12 family transposase	transposase	NA	NA	NA	NA
WP_012226861.1|2819934_2820135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041249446.1|2821685_2822408_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012226868.1|2822522_2823464_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012226876.1|2823475_2824366_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041249447.1|2824513_2825302_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	25.6	2.7e-06
WP_012226880.1|2825343_2826921_+	acetolactate synthase large subunit	NA	NA	NA	NA	NA
WP_041249822.1|2826929_2827715_+	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_012226884.1|2827699_2828578_+	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_012226886.1|2828574_2829489_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012226888.1|2829491_2829725_-	DUF2274 domain-containing protein	NA	NA	NA	NA	NA
WP_012226890.1|2829721_2830894_-	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_012226892.1|2830890_2831892_-	P-type conjugative transfer protein TrbG	NA	NA	NA	NA	NA
WP_041249448.1|2831888_2832572_-	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_041249823.1|2832571_2834005_-	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_041249449.1|2834025_2834805_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_012226900.1|2834801_2837234_-	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_012226902.1|2837246_2837525_-	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_012226904.1|2837524_2837857_-	TrbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_081482884.1|2837853_2838831_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_012226908.1|2839013_2839934_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_041249450.1|2840113_2841169_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_041249451.1|2841203_2841632_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_012226914.1|2841639_2843640_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_162098033.1|2843813_2843963_+	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_157871047.1|2844038_2844461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012226916.1|2844470_2845097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012226917.1|2845144_2845555_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_012226918.1|2845592_2847332_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_157871048.1|2847328_2847526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157871049.1|2848244_2849189_+|transposase	IS630-like element ISGdi6 family transposase	transposase	A0A1V0SCG6	Indivirus	26.2	2.1e-10
>prophage 8
NC_010125	Gluconacetobacter diazotrophicus PA1 5, complete genome	3944163	3658163	3709056	3944163	plate,transposase,integrase	Enterobacteria_phage(18.18%)	53	3671101:3671156	3707257:3707312
WP_157871070.1|3658163_3658625_-|plate	baseplate J/gp47 family protein	plate	NA	NA	NA	NA
WP_012228228.1|3659636_3660365_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	30.4	6.5e-15
WP_012228230.1|3660365_3660866_-	phage GP46 family protein	NA	NA	NA	NA	NA
WP_012228232.1|3660877_3661390_-|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_012228234.1|3661386_3662589_-	bacteriophage related protein	NA	Q8W618	Enterobacteria_phage	28.4	1.2e-26
WP_012228236.1|3662651_3663959_-	DNA circularization N-terminal domain-containing protein	NA	Q8W619	Enterobacteria_phage	25.2	3.3e-17
WP_041249561.1|3664030_3664297_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_041249562.1|3664274_3664580_+	BrnA antitoxin family protein	NA	NA	NA	NA	NA
WP_041249563.1|3664599_3664962_-	hypothetical protein	NA	A0A1D8KS53	Synechococcus_phage	50.0	7.9e-06
WP_012228247.1|3667451_3668516_+	hypothetical protein	NA	A0A068CDI9	Rhizobium_phage	32.3	3.2e-55
WP_157871071.1|3668521_3668989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041249565.1|3668985_3669648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157871072.1|3669640_3669883_+	hypothetical protein	NA	NA	NA	NA	NA
3671101:3671156	attL	AGCCCTGGTTGAGCTTCAGCAGACACCATCCGTCAGATTTAGTCGAGACTTCTACA	NA	NA	NA	NA
WP_081482906.1|3671184_3671337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041249566.1|3671284_3672529_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q8W6M6	Sinorhizobium_phage	52.8	1.3e-111
WP_012228256.1|3672860_3674090_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A077KET4	Ralstonia_phage	45.3	8.5e-84
WP_041249894.1|3674669_3675683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041249567.1|3676109_3676892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012228272.1|3677713_3677983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041249568.1|3677979_3678192_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012228275.1|3678549_3678777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041249569.1|3678773_3679049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157871073.1|3679170_3679440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012228278.1|3679439_3679640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012228279.1|3679636_3679852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041249571.1|3680264_3680522_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041249572.1|3680855_3681188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012228282.1|3681184_3682054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012228283.1|3682050_3682365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012228284.1|3682361_3684890_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.2	2.2e-62
WP_157871074.1|3685184_3685829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012228286.1|3685825_3686623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157871075.1|3686689_3686977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157871076.1|3687360_3689598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041249574.1|3689597_3692171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012228296.1|3692163_3693381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041249575.1|3693377_3693665_+	hypothetical protein	NA	A0A2H5BHK6	Acinetobacter_phage	47.1	7.9e-09
WP_050935090.1|3693732_3693987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012228307.1|3694141_3694510_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012228308.1|3694506_3694758_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_012228309.1|3694947_3695514_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	43.3	5.7e-27
WP_157871102.1|3695864_3696725_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_012228311.1|3696806_3697250_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_012228312.1|3697274_3697718_+	GFA family protein	NA	NA	NA	NA	NA
WP_157871077.1|3697736_3699338_-	amidase	NA	NA	NA	NA	NA
WP_012228314.1|3699334_3700216_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_012228315.1|3700469_3700766_-	pentapeptide MXKDX repeat protein	NA	NA	NA	NA	NA
WP_012228316.1|3700872_3701622_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012228317.1|3701618_3702242_-	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_012228318.1|3702394_3702859_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_012228319.1|3703037_3703742_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_012228320.1|3705542_3706964_-	adenylosuccinate lyase family protein	NA	NA	NA	NA	NA
WP_157871078.1|3708111_3709056_+|transposase	IS630-like element ISGdi6 family transposase	transposase	A0A1V0SCG6	Indivirus	25.6	3.1e-09
3707257:3707312	attR	AGCCCTGGTTGAGCTTCAGCAGACACCATCCGTCAGATTTAGTCGAGACTTCTACA	NA	NA	NA	NA
>prophage 9
NC_010125	Gluconacetobacter diazotrophicus PA1 5, complete genome	3944163	3733642	3787222	3944163	tRNA,terminase,transposase	Bacillus_virus(18.18%)	49	NA	NA
WP_012228348.1|3733642_3734065_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_012228349.1|3734101_3734266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012228350.1|3734357_3735122_-	S24 family peptidase	NA	NA	NA	NA	NA
WP_012228352.1|3735453_3735729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012554404.1|3735733_3738250_+	topoisomerase	NA	Q9JMN6	Wolbachia_phage	38.5	3.7e-09
WP_041249578.1|3738542_3739400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012228356.1|3739415_3740417_+|transposase	IS481-like element ISGdi9 family transposase	transposase	NA	NA	NA	NA
WP_157871079.1|3740456_3742517_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	30.0	4.4e-16
WP_157871080.1|3742680_3743814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144880236.1|3744249_3744744_+|terminase	terminase small subunit	terminase	I6NV32	Burkholderia_virus	42.5	3.7e-14
WP_012554408.1|3744824_3745049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012228361.1|3745074_3746568_+	hypothetical protein	NA	A0A1B1IVN4	uncultured_Mediterranean_phage	41.9	7.1e-101
WP_012554409.1|3746569_3746815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012554412.1|3749088_3749502_+	co-chaperone GroES	NA	NA	NA	NA	NA
WP_162098028.1|3749390_3750110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041249580.1|3750069_3750456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012554415.1|3751050_3751647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012228365.1|3751659_3752568_+	hypothetical protein	NA	A0A218MME7	uncultured_virus	40.5	2.0e-58
WP_012554416.1|3752677_3752860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012228367.1|3752924_3753341_+	hypothetical protein	NA	A0A218MLF9	uncultured_virus	37.0	2.7e-10
WP_041249581.1|3753351_3753828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012228369.1|3753824_3755711_+	hypothetical protein	NA	A0A0E3M2T0	Rhodoferax_phage	40.9	1.7e-06
WP_012228370.1|3755717_3759350_+	hypothetical protein	NA	A0A2I7RQ21	Vibrio_phage	35.9	1.0e-60
WP_012228371.1|3759349_3759985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012228372.1|3759984_3760443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157871081.1|3760439_3761441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012228375.1|3761547_3763080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041249582.1|3763231_3763576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012228379.1|3763572_3764049_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_041249583.1|3764045_3764762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012228384.1|3764810_3765560_-	YfdX family protein	NA	NA	NA	NA	NA
WP_012228387.1|3766756_3767230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012554426.1|3767229_3767712_+	hypothetical protein	NA	A0A2I7S7C4	Vibrio_phage	35.4	1.4e-10
WP_041249584.1|3767974_3768715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041249585.1|3768891_3769725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012228391.1|3769663_3770506_-	DUF3667 domain-containing protein	NA	NA	NA	NA	NA
WP_012228393.1|3770717_3771206_+	bacterioferritin	NA	NA	NA	NA	NA
WP_041249586.1|3771259_3771946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041249587.1|3773274_3774558_-	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.5	1.8e-44
WP_041249588.1|3774780_3775773_-|transposase	IS481-like element ISGdi9 family transposase	transposase	NA	NA	NA	NA
WP_012228402.1|3775859_3777158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012553437.1|3777308_3778133_-|transposase	IS5-like element ISGdi2 family transposase	transposase	NA	NA	NA	NA
WP_012228403.1|3778152_3778965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012228404.1|3778961_3779612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012228405.1|3779705_3780698_+|transposase	IS481-like element ISGdi9 family transposase	transposase	NA	NA	NA	NA
WP_012228409.1|3781008_3782121_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_012228411.1|3782213_3785138_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	32.7	8.1e-16
WP_012228416.1|3785152_3786310_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_012222260.1|3786385_3787222_+|transposase	IS5-like element ISGdi1 family transposase	transposase	NA	NA	NA	NA
