The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_009613	Flavobacterium psychrophilum JIP02/86, complete genome	2860382	635806	687923	2860382	transposase,protease,tRNA,integrase	Bacillus_phage(11.11%)	43	644447:644472	689107:689132
WP_016361983.1|635806_636118_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_117601869.1|636126_637014_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	24.6	1.8e-14
WP_011963525.1|637133_637517_+	DUF1573 domain-containing protein	NA	NA	NA	NA	NA
WP_011963524.1|637743_639045_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_011963523.1|639397_640930_-	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_011963522.1|641000_642014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011963521.1|642116_643595_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	39.3	2.5e-90
WP_011963520.1|644026_644278_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
644447:644472	attL	CCCTCCCGAAAAGGTCGGGTCGGGCT	NA	NA	NA	NA
WP_011962640.1|651640_653437_+	translational GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	33.9	3.5e-22
WP_011962641.1|653530_654382_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011962642.1|654521_655361_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_011962643.1|655452_656382_+	1,4-dihydroxy-2-naphthoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_011962644.1|656404_657778_-	M28 family peptidase	NA	NA	NA	NA	NA
WP_011962645.1|657936_659139_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_011962646.1|659296_660505_+	serine hydrolase	NA	NA	NA	NA	NA
WP_011962647.1|661002_661833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011962648.1|661829_662021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011962649.1|662010_663315_-	hypothetical protein	NA	A0A2I7QLI5	Vibrio_phage	44.6	9.0e-84
WP_011962650.1|663327_663723_-	hypothetical protein	NA	G4KK90	Yersinia_phage	48.0	3.4e-18
WP_051907092.1|663762_665637_-	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016361990.1|665911_667114_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	6.9e-46
WP_011962652.1|667136_667388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011962653.1|667384_668443_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_011962654.1|668444_668744_-	mobilization protein	NA	NA	NA	NA	NA
WP_016361991.1|668897_669752_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_162179043.1|670110_671319_-	virulence-associated E family protein	NA	S0A0H4	Cellulophaga_phage	29.2	6.7e-41
WP_011962656.1|671377_671563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011962657.1|671619_671904_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011962658.1|672005_672647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016361992.1|672648_673902_-|integrase	tyrosine-type recombinase/integrase	integrase	H7BUI8	unidentified_phage	25.4	6.1e-13
WP_011962659.1|674506_674743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011962660.1|674829_675063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011962661.1|675389_675929_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011962662.1|676086_677136_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_011962663.1|677268_678465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016361993.1|678923_679889_-|transposase	IS1595-like element ISFps1 family transposase	transposase	NA	NA	NA	NA
WP_011962664.1|680223_681054_-	membrane protein	NA	NA	NA	NA	NA
WP_011962665.1|681076_681895_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.3	1.4e-45
WP_011962666.1|682040_683627_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_011962667.1|683858_684938_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_011962668.1|684951_686265_-	TolC family protein	NA	NA	NA	NA	NA
WP_011962669.1|686254_686878_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011962670.1|687032_687923_-|protease	metalloprotease	protease	NA	NA	NA	NA
689107:689132	attR	AGCCCGACCCGACCTTTTCGGGAGGG	NA	NA	NA	NA
>prophage 2
NC_009613	Flavobacterium psychrophilum JIP02/86, complete genome	2860382	985876	1032958	2860382	tail	Flavobacterium_phage(98.25%)	59	NA	NA
WP_044049349.1|985876_987793_-	hypothetical protein	NA	A0A1B0WN29	Flavobacterium_phage	99.8	0.0e+00
WP_011962931.1|987770_989471_-	hypothetical protein	NA	A0A1B0WNB8	Flavobacterium_phage	93.1	2.2e-300
WP_011962932.1|989474_993848_-|tail	phage tail tape measure protein	tail	A0A1B0WMP0	Flavobacterium_phage	79.6	0.0e+00
WP_011962933.1|993932_994337_-	hypothetical protein	NA	A0A1B0WM09	Flavobacterium_phage	100.0	1.2e-71
WP_011962934.1|994329_994641_-	hypothetical protein	NA	A0A1B0WM19	Flavobacterium_phage	91.3	7.2e-48
WP_011962935.1|994890_995100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011962936.1|995219_995774_-	DUF4468 domain-containing protein	NA	A0A1B0WM70	Flavobacterium_phage	100.0	2.0e-101
WP_011962937.1|995784_996000_-	hypothetical protein	NA	R9W0R6	Flavobacterium_phage	98.6	1.4e-31
WP_011962938.1|996042_996441_-	hypothetical protein	NA	A0A1B0WM80	Flavobacterium_phage	99.2	8.0e-68
WP_011962939.1|996418_996619_-	hypothetical protein	NA	A0A1B0WMN2	Flavobacterium_phage	97.0	1.3e-29
WP_011962940.1|996653_997115_-	hypothetical protein	NA	A0A1B0WMQ1	Flavobacterium_phage	98.7	8.6e-82
WP_011962941.1|997111_997993_-	hypothetical protein	NA	A0A1B0WMF2	Flavobacterium_phage	96.9	1.8e-160
WP_011962942.1|998024_998987_-	hypothetical protein	NA	A0A1B0WMK7	Flavobacterium_phage	100.0	1.4e-179
WP_011962943.1|998986_1000357_-	hypothetical protein	NA	A0A1B0WN37	Flavobacterium_phage	100.0	2.4e-268
WP_011962945.1|1001062_1001470_+	hypothetical protein	NA	A0A1B0WM75	Flavobacterium_phage	100.0	7.7e-66
WP_011962946.1|1001534_1001765_+	hypothetical protein	NA	A0A1B0WM79	Flavobacterium_phage	100.0	1.0e-35
WP_011962947.1|1001748_1001934_+	type I addiction module toxin, SymE family	NA	A0A1B0WNB3	Flavobacterium_phage	100.0	1.7e-25
WP_011962948.1|1001937_1002795_+	DUF932 domain-containing protein	NA	A0A1B0WMN7	Flavobacterium_phage	100.0	1.0e-160
WP_011962949.1|1002874_1004584_-	hypothetical protein	NA	A0A1B0WMQ6	Flavobacterium_phage	100.0	0.0e+00
WP_011962950.1|1004549_1005188_-	hypothetical protein	NA	A0A1B0WMC9	Flavobacterium_phage	100.0	2.6e-116
WP_011962951.1|1005177_1005510_-	hypothetical protein	NA	A0A1B0WML4	Flavobacterium_phage	100.0	1.9e-51
WP_011962952.1|1005673_1006270_-	hypothetical protein	NA	A0A1B0WN44	Flavobacterium_phage	100.0	2.7e-104
WP_011962953.1|1006256_1007123_-	hypothetical protein	NA	A0A1B0WND1	Flavobacterium_phage	100.0	1.1e-159
WP_011962954.1|1007250_1007583_-	hypothetical protein	NA	A0A1B0WM83	Flavobacterium_phage	100.0	9.3e-62
WP_011962955.1|1007569_1007818_-	helix-turn-helix transcriptional regulator	NA	A0A1B0WM89	Flavobacterium_phage	100.0	5.4e-38
WP_011962956.1|1007821_1008961_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A1B0WNC0	Flavobacterium_phage	100.0	4.4e-228
WP_011962957.1|1008963_1009512_-	ParB N-terminal domain-containing protein	NA	A0A1B0WMA1	Flavobacterium_phage	100.0	9.2e-99
WP_011962958.1|1009508_1010732_-	hypothetical protein	NA	A0A1B0WMP3	Flavobacterium_phage	100.0	2.9e-241
WP_011962959.1|1010724_1011018_-	hypothetical protein	NA	A0A1B0WMR4	Flavobacterium_phage	100.0	9.4e-50
WP_011962960.1|1011014_1011338_-	hypothetical protein	NA	A0A1B0WMD9	Flavobacterium_phage	100.0	3.5e-53
WP_011962961.1|1011337_1011850_-	hypothetical protein	NA	A0A1B0WMM0	Flavobacterium_phage	100.0	1.2e-92
WP_011962962.1|1012019_1012856_-	hypothetical protein	NA	A0A1B0WN51	Flavobacterium_phage	100.0	3.5e-158
WP_162179051.1|1012871_1015022_-	hypothetical protein	NA	A0A1B0WN96	Flavobacterium_phage	100.0	0.0e+00
WP_011962964.1|1015079_1015964_-	S49 family peptidase	NA	A0A1B0WM35	Flavobacterium_phage	100.0	1.4e-165
WP_011962965.1|1016024_1016579_-	hypothetical protein	NA	A0A1B0WM98	Flavobacterium_phage	100.0	1.3e-87
WP_011962966.1|1016580_1017105_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0WMS9	Flavobacterium_phage	100.0	2.5e-101
WP_011962967.1|1017101_1017320_-	hypothetical protein	NA	A0A1B0WMB7	Flavobacterium_phage	100.0	1.2e-28
WP_011962968.1|1017316_1017634_-	hypothetical protein	NA	A0A1B0WMP9	Flavobacterium_phage	100.0	1.1e-51
WP_011962969.1|1017694_1018231_-	hypothetical protein	NA	A0A1B0WMS0	Flavobacterium_phage	100.0	5.5e-96
WP_011962970.1|1018241_1018793_-	hypothetical protein	NA	A0A1B0WME9	Flavobacterium_phage	100.0	4.8e-95
WP_011962971.1|1018794_1019451_-	hypothetical protein	NA	A0A1B0WMM8	Flavobacterium_phage	99.1	7.4e-119
WP_011962972.1|1019453_1020113_-	hypothetical protein	NA	A0A1B0WN57	Flavobacterium_phage	90.9	7.2e-106
WP_011962973.1|1020114_1020609_-	hypothetical protein	NA	A0A1B0WNE9	Flavobacterium_phage	100.0	3.9e-88
WP_011962974.1|1020921_1021293_-	hypothetical protein	NA	A0A1B0WMA5	Flavobacterium_phage	100.0	1.4e-66
WP_011962975.1|1021294_1021432_-	hypothetical protein	NA	A0A1B0WMA8	Flavobacterium_phage	100.0	2.3e-19
WP_011962976.1|1021552_1021765_-	hypothetical protein	NA	A0A1B0WND2	Flavobacterium_phage	100.0	1.4e-31
WP_011962977.1|1021930_1022179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044049430.1|1022361_1023072_-	RNA ligase family protein	NA	A0A1B0WM60	Flavobacterium_phage	100.0	1.7e-137
WP_011962979.1|1023229_1023499_-	hypothetical protein	NA	A0A1B0WMF7	Flavobacterium_phage	100.0	3.2e-44
WP_011962980.1|1023577_1023787_-	hypothetical protein	NA	A0A1B0WMN8	Flavobacterium_phage	100.0	4.4e-33
WP_011962981.1|1023787_1024117_-	hypothetical protein	NA	A0A1B0WM99	Flavobacterium_phage	96.7	7.1e-46
WP_011962982.1|1024357_1024585_-	hypothetical protein	NA	A0A1B0WMQ5	Flavobacterium_phage	100.0	1.9e-34
WP_011962983.1|1024585_1025107_-	hypothetical protein	NA	A0A1B0WMS6	Flavobacterium_phage	99.4	7.2e-93
WP_011962985.1|1025558_1029116_-	toprim domain-containing protein	NA	A0A1B0WMR3	Flavobacterium_phage	99.5	0.0e+00
WP_011962986.1|1029115_1029352_-	hypothetical protein	NA	A0A1B0WMB4	Flavobacterium_phage	98.7	1.4e-32
WP_011962987.1|1029467_1030025_-	LuxR family transcriptional regulator	NA	A0A1B0WMB8	Flavobacterium_phage	100.0	3.0e-105
WP_011962988.1|1030035_1030311_-	hypothetical protein	NA	A0A1B0WND8	Flavobacterium_phage	100.0	2.3e-42
WP_011962989.1|1030432_1030744_+	XRE family transcriptional regulator	NA	A0A1B0WMD8	Flavobacterium_phage	100.0	2.9e-49
WP_011962990.1|1031170_1032958_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	34.2	1.4e-63
>prophage 3
NC_009613	Flavobacterium psychrophilum JIP02/86, complete genome	2860382	1307276	1355665	2860382	transposase,integrase,protease	Bacillus_phage(66.67%)	30	1335749:1335770	1361262:1361283
WP_051907069.1|1307276_1307603_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_117386929.1|1307635_1307905_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_011963053.1|1308068_1309376_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_011963052.1|1309372_1310833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011963636.1|1318470_1319160_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.9	4.1e-27
WP_011963637.1|1319821_1323886_+	type II CRISPR RNA-guided endonuclease Cas9	NA	NA	NA	NA	NA
WP_011963638.1|1324194_1325091_+	type II CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_011963639.1|1325083_1325431_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_016361983.1|1328087_1328399_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_117601869.1|1328407_1329295_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	24.6	1.8e-14
WP_011963640.1|1329309_1330149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011963641.1|1330152_1333392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011963642.1|1333388_1334036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011963643.1|1334005_1335346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011963644.1|1335364_1337359_-	hypothetical protein	NA	NA	NA	NA	NA
1335749:1335770	attL	AATATTTTCTTTTGGAATATCT	NA	NA	NA	NA
WP_011963645.1|1337360_1338521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034100366.1|1338522_1340670_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_011963647.1|1340721_1341579_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_162179081.1|1341578_1342325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011963649.1|1342562_1345832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011963650.1|1346604_1347231_-	ATPase	NA	NA	NA	NA	NA
WP_011963651.1|1347316_1348177_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_011963652.1|1348184_1348472_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011963653.1|1348583_1349432_-	RteC domain-containing protein	NA	NA	NA	NA	NA
WP_011963654.1|1349893_1351117_-	MFS transporter	NA	NA	NA	NA	NA
WP_162179050.1|1351134_1351281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011963656.1|1351313_1352471_-	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_011963657.1|1352568_1353534_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011963658.1|1353540_1354380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016362010.1|1354420_1355665_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	34.1	9.3e-38
1361262:1361283	attR	AATATTTTCTTTTGGAATATCT	NA	NA	NA	NA
>prophage 4
NC_009613	Flavobacterium psychrophilum JIP02/86, complete genome	2860382	1976294	2117346	2860382	transposase,tRNA,integrase	Bacillus_phage(15.38%)	102	1997173:1997191	2056241:2056259
WP_016361985.1|1976294_1977188_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_162179087.1|1977800_1984991_-	cell surface protein SprA	NA	NA	NA	NA	NA
WP_011964221.1|1985042_1985624_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_011964222.1|1985697_1988013_-	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_011964223.1|1988076_1989003_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_011964224.1|1989073_1990096_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	23.8	3.7e-08
WP_011964225.1|1990304_1991750_+	amino acid permease	NA	NA	NA	NA	NA
WP_011964226.1|1991890_1994134_-	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_162179054.1|1994192_1994618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011964228.1|1994709_1995429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011964229.1|1995545_1996253_+	dipeptidase PepE	NA	NA	NA	NA	NA
WP_011964230.1|1996642_1997074_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011964231.1|1997083_1998784_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
1997173:1997191	attL	TATACATTTTCCTTTTCTT	NA	NA	NA	NA
WP_011964232.1|1998772_1999483_-	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_011964233.1|1999723_2001241_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_011964234.1|2001614_2002658_+|integrase	site-specific integrase	integrase	S5W9T9	Leptospira_phage	35.6	1.3e-32
WP_011964235.1|2002847_2005112_+	N-6 DNA methylase	NA	A0A2H4JBT5	uncultured_Caudovirales_phage	26.0	3.3e-33
WP_011964236.1|2006436_2007141_+	PorT family protein	NA	NA	NA	NA	NA
WP_011964237.1|2007143_2007323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011964238.1|2007345_2007798_+	DUF2846 domain-containing protein	NA	NA	NA	NA	NA
WP_011964239.1|2008210_2009446_+	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_011964240.1|2012430_2012937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011964241.1|2013589_2013814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011964242.1|2014558_2014945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155273285.1|2014948_2015098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011964243.1|2015094_2015274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011964244.1|2015483_2015762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011964235.1|2015999_2018264_+	N-6 DNA methylase	NA	A0A2H4JBT5	uncultured_Caudovirales_phage	26.0	3.3e-33
WP_011964245.1|2018411_2018639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162179088.1|2019147_2019789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011964247.1|2019775_2020783_+	DNA cytosine methyltransferase	NA	Q6DMX0	Streptococcus_phage	62.7	5.3e-108
WP_011964248.1|2021816_2022542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016361990.1|2023802_2025005_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	6.9e-46
WP_011964249.1|2025299_2026046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011964250.1|2026874_2027642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011964251.1|2028063_2028654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011964252.1|2028666_2029341_-	DUF2931 family protein	NA	NA	NA	NA	NA
WP_162179055.1|2029605_2030031_-	TonB family protein	NA	NA	NA	NA	NA
WP_011964254.1|2030407_2030716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011964255.1|2030717_2031191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016361987.1|2032064_2033267_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	6.9e-46
WP_011964256.1|2033453_2034611_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	28.0	1.5e-13
WP_086438997.1|2037183_2038167_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162179056.1|2038476_2039526_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_011964258.1|2039646_2040819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011964259.1|2041123_2042326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011964260.1|2042608_2043028_-	type II toxin-antitoxin system RnlB family antitoxin	NA	NA	NA	NA	NA
WP_034100130.1|2043030_2043885_-	type II toxin-antitoxin system RnlA family toxin	NA	NA	NA	NA	NA
WP_117601869.1|2044086_2044974_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	24.6	1.8e-14
WP_016361983.1|2044982_2045294_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011964261.1|2045556_2046315_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011964262.1|2046479_2049422_-	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	21.7	3.3e-09
WP_011964263.1|2049499_2052193_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_011964264.1|2052350_2053349_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	46.8	7.6e-83
WP_011964265.1|2053403_2055068_-	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	35.2	4.0e-60
WP_011964266.1|2055396_2057505_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
2056241:2056259	attR	TATACATTTTCCTTTTCTT	NA	NA	NA	NA
WP_011964267.1|2057504_2059343_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_011964268.1|2059474_2061211_-	TerB family tellurite resistance protein	NA	NA	NA	NA	NA
WP_011964269.1|2061770_2063864_-	hypothetical protein	NA	M1NXJ3	Cellulophaga_phage	40.0	2.4e-70
WP_011964270.1|2063961_2064243_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052193140.1|2064485_2065085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016361983.1|2065172_2065484_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_117601869.1|2065492_2066380_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	24.6	1.8e-14
WP_162179057.1|2066560_2067421_+	AAA family ATPase	NA	A0A220BZX1	Staphylococcus_phage	41.0	2.8e-49
WP_011964274.1|2067422_2068241_+	phage protein	NA	S5Z6N6	Mycobacterium_phage	27.2	2.0e-17
WP_016361990.1|2068486_2069689_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	6.9e-46
WP_011964275.1|2069944_2070658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011964276.1|2072586_2073678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011964278.1|2074161_2075649_-	serine hydrolase	NA	Q19XB5	Mycobacterium_phage	27.9	3.4e-10
WP_162263851.1|2076408_2077878_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_011964279.1|2078036_2079185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011964280.1|2079425_2079626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016361983.1|2080072_2080384_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_117601869.1|2080392_2081280_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	24.6	1.8e-14
WP_155275254.1|2081616_2081898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011964281.1|2081959_2082418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011964282.1|2082601_2083297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011964245.1|2083492_2083720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011964283.1|2085716_2086094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034100111.1|2087797_2087992_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011964284.1|2088031_2088418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046201310.1|2088523_2089369_+|transposase	transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	24.5	4.9e-06
WP_011962639.1|2096337_2099241_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	26.0	1.0e-23
WP_011962638.1|2099294_2100536_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_011962637.1|2100551_2101016_-	ribosome assembly cofactor RimP	NA	NA	NA	NA	NA
WP_011962636.1|2101198_2102023_+	universal stress protein	NA	NA	NA	NA	NA
WP_011962635.1|2102068_2102500_-	TerB family tellurite resistance protein	NA	NA	NA	NA	NA
WP_011962634.1|2102644_2103238_+	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_011962633.1|2103418_2103847_+	dCMP deaminase family protein	NA	H6WFU3	Cyanophage	45.7	1.9e-30
WP_011962632.1|2103920_2105495_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.1	3.4e-21
WP_011962631.1|2105540_2106149_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011962630.1|2106148_2106352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011962629.1|2106390_2106969_-	MarC family protein	NA	NA	NA	NA	NA
WP_011962628.1|2107194_2107764_+	DUF3109 family protein	NA	NA	NA	NA	NA
WP_011962627.1|2108011_2108989_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1B4X9B4	Tenacibaculum_phage	77.6	4.7e-146
WP_011962626.1|2109325_2111746_+	ribonucleoside-diphosphate reductase subunit alpha	NA	Q8QMY6	Cowpox_virus	63.7	5.4e-292
WP_011962625.1|2112545_2113001_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_011962624.1|2113000_2113387_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_011962623.1|2113540_2114341_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_011962622.1|2114442_2115267_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_011962621.1|2115432_2116056_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_016361990.1|2116143_2117346_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	6.9e-46
>prophage 5
NC_009613	Flavobacterium psychrophilum JIP02/86, complete genome	2860382	2409964	2418089	2860382		Enterobacteria_phage(16.67%)	6	NA	NA
WP_011963425.1|2409964_2410846_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	60.8	6.0e-100
WP_011963426.1|2410914_2411961_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	50.5	1.3e-85
WP_011963427.1|2411967_2413344_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	31.6	4.7e-59
WP_011963428.1|2413375_2414647_-	nucleotide sugar dehydrogenase	NA	A7IWZ0	Paramecium_bursaria_Chlorella_virus	26.4	6.2e-21
WP_011963429.1|2414657_2415638_-	SDR family oxidoreductase	NA	A0A2K9L0I7	Tupanvirus	50.9	2.7e-85
WP_011963430.1|2415641_2418089_-	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	31.3	2.1e-17
