The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_008571	Gramella forsetii KT0803, complete genome	3798465	609548	620492	3798465		Synechococcus_phage(25.0%)	11	NA	NA
WP_041249982.1|609548_610382_+	polysaccharide pyruvyl transferase family protein	NA	A0A1V0SK48	Klosneuvirus	28.5	3.3e-23
WP_148264583.1|610387_611239_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_011708465.1|611271_612063_+	FkbM family methyltransferase	NA	A0A0P0YN40	Yellowstone_lake_phycodnavirus	29.5	1.4e-15
WP_011708466.1|612242_613529_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.6	5.7e-14
WP_011708467.1|613533_614370_+	FkbM family methyltransferase	NA	M1IAW9	Acanthocystis_turfacea_Chlorella_virus	27.2	1.0e-08
WP_011708468.1|614362_615304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148264643.1|615329_616259_+	hypothetical protein	NA	H8ZJG6	Ostreococcus_tauri_virus	30.1	3.0e-17
WP_011708470.1|616258_617353_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	33.0	2.5e-47
WP_041250218.1|617354_618086_+	formyl transferase	NA	M4QRX9	Synechococcus_phage	34.3	2.0e-11
WP_011708472.1|618174_619359_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_041250219.1|619379_620492_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.6	1.3e-131
>prophage 2
NC_008571	Gramella forsetii KT0803, complete genome	3798465	657104	666238	3798465	tRNA	uncultured_Mediterranean_phage(33.33%)	9	NA	NA
WP_011708508.1|657104_657845_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	2.7e-24
WP_011708509.1|657888_658236_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_011708510.1|658239_659073_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	26.9	2.5e-18
WP_011708511.1|659072_660038_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	33.0	1.0e-39
WP_011708512.1|660122_662321_+	RecQ family ATP-dependent DNA helicase	NA	A0A2K9L3P7	Tupanvirus	38.4	1.6e-88
WP_011708513.1|662376_662979_-	PorT family protein	NA	NA	NA	NA	NA
WP_011708514.1|663100_664054_-	transketolase family protein	NA	NA	NA	NA	NA
WP_011708515.1|664093_664939_-	transketolase	NA	A0A2K9L6P9	Tupanvirus	28.5	2.9e-27
WP_011708516.1|665107_666238_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	41.2	7.3e-74
>prophage 3
NC_008571	Gramella forsetii KT0803, complete genome	3798465	945934	977235	3798465	protease,transposase	Streptococcus_phage(50.0%)	30	NA	NA
WP_011708766.1|945934_946921_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011708767.1|947500_948286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011708768.1|948691_949666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011708770.1|950877_951300_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_011708771.1|951299_951551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011708772.1|951788_952253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011708774.1|953046_954027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011708775.1|954175_955000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011708776.1|955162_955528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011708777.1|955524_955917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011708778.1|956084_957026_-|protease	clan AA aspartic protease	protease	NA	NA	NA	NA
WP_011708766.1|957278_958265_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011708779.1|958428_959088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011708782.1|960066_960528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011708783.1|961226_962177_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011708785.1|962672_962948_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011708786.1|962971_963802_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011708787.1|963831_964134_-	hypothetical protein	NA	M1Q227	Streptococcus_phage	63.2	1.5e-05
WP_011708788.1|964126_964324_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011708791.1|965773_966724_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	25.2	9.3e-06
WP_011708792.1|966944_967907_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_011708793.1|968110_968488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011708794.1|968796_969180_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011708795.1|969881_970409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011708796.1|971354_972095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011708797.1|972248_972992_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_011708799.1|973927_974458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011708800.1|974459_974906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011708801.1|975071_976022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011708766.1|976248_977235_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_008571	Gramella forsetii KT0803, complete genome	3798465	988687	1023754	3798465	transposase,integrase	Stx2-converting_phage(40.0%)	37	1003293:1003308	1031014:1031029
WP_011708813.1|988687_988963_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011708786.1|988986_989817_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011708815.1|990299_991262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011708816.1|991563_991920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148264592.1|991916_992447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011708818.1|992620_993352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011708766.1|993598_994585_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011708819.1|994755_996039_-	erythromycin esterase family protein	NA	NA	NA	NA	NA
WP_011708821.1|997362_998313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011708766.1|998559_999546_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011708822.1|999724_1000081_-	helix-turn-helix domain-containing protein	NA	A0A0P0ZCT8	Stx2-converting_phage	48.2	4.1e-23
WP_011708823.1|1000085_1000379_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	41.8	1.2e-15
WP_049792081.1|1000679_1001138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011708766.1|1001469_1002456_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011708826.1|1002599_1003676_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
1003293:1003308	attL	TTTTAATAATTGATTT	NA	NA	NA	NA
WP_011708827.1|1003839_1004883_-	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_011708828.1|1005040_1005343_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011708829.1|1005326_1005560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011708766.1|1005836_1006823_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011708830.1|1006981_1007473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011708831.1|1007472_1008231_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_011708832.1|1008387_1009611_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_011708834.1|1010452_1010917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041250241.1|1010922_1011303_-	VOC family protein	NA	NA	NA	NA	NA
WP_011708836.1|1011543_1011843_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	47.7	1.2e-15
WP_011708837.1|1011861_1012143_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	43.8	2.3e-13
WP_148264593.1|1012821_1013121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041250005.1|1013139_1013340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011708766.1|1013570_1014557_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011708840.1|1015394_1015973_-	YdeI/OmpD-associated family protein	NA	NA	NA	NA	NA
WP_041250242.1|1016161_1016452_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011708842.1|1016453_1016792_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011708843.1|1017468_1018143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011708844.1|1019338_1019881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011708845.1|1019877_1020480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011708846.1|1020648_1021347_-	barstar family protein	NA	NA	NA	NA	NA
WP_011708849.1|1022596_1023754_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	34.0	2.3e-30
1031014:1031029	attR	AAATCAATTATTAAAA	NA	NA	NA	NA
>prophage 5
NC_008571	Gramella forsetii KT0803, complete genome	3798465	1228798	1289087	3798465	transposase,integrase	Salinibacter_virus(16.67%)	59	1284426:1284455	1287886:1287915
WP_011709058.1|1228798_1230130_+|integrase	site-specific integrase	integrase	A0A2I6UG75	Salinibacter_virus	24.0	1.7e-05
WP_011709059.1|1230446_1230992_+	DUF3347 domain-containing protein	NA	NA	NA	NA	NA
WP_011709060.1|1231024_1231519_+	DUF305 domain-containing protein	NA	NA	NA	NA	NA
WP_011709061.1|1231642_1232080_-|transposase	IS200/IS605 family transposase	transposase	A0A0H3UZM0	Geobacillus_virus	36.5	1.0e-15
WP_011709063.1|1232429_1233746_+	APC family permease	NA	NA	NA	NA	NA
WP_011709064.1|1233856_1235536_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_011709065.1|1235619_1236225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011709068.1|1237006_1237156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011709069.1|1237310_1237961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011709070.1|1238110_1239118_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_011709071.1|1239233_1239554_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_011709074.1|1241247_1242528_+	trehalase-like protein	NA	NA	NA	NA	NA
WP_011709075.1|1242534_1243086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011709076.1|1243160_1244189_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011709077.1|1244274_1247022_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.5	1.7e-87
WP_148264651.1|1247197_1247518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011709079.1|1247656_1252090_+	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
WP_041250264.1|1252139_1253351_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_008613762.1|1253447_1253786_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_008613756.1|1253801_1254224_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_011709081.1|1254250_1254610_+	STAS/SEC14 domain-containing protein	NA	NA	NA	NA	NA
WP_013073461.1|1254630_1254882_+	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_011709083.1|1254881_1255424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041250021.1|1255913_1256105_+	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_011709087.1|1256163_1256925_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_011709089.1|1257242_1258133_+	membrane protein	NA	NA	NA	NA	NA
WP_173362634.1|1258148_1258580_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	46.7	2.3e-20
WP_011709091.1|1258581_1261134_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	38.5	9.5e-130
WP_011709092.1|1261180_1261609_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_011709093.1|1261698_1263102_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.9	1.7e-43
WP_011709094.1|1263199_1264549_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	41.1	2.2e-69
WP_011709095.1|1264550_1265351_+	cation transporter	NA	NA	NA	NA	NA
WP_041250265.1|1265399_1266080_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_011709097.1|1266082_1267081_+	sodium/calcium exchanger protein	NA	NA	NA	NA	NA
WP_011709098.1|1267084_1267270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011709099.1|1267288_1268605_+	amino acid permease	NA	NA	NA	NA	NA
WP_008615607.1|1268614_1268791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011709100.1|1268809_1269166_+	STAS/SEC14 domain-containing protein	NA	NA	NA	NA	NA
WP_011709101.1|1269223_1270045_+	universal stress protein	NA	NA	NA	NA	NA
WP_011709103.1|1270492_1270984_+	asparaginase	NA	NA	NA	NA	NA
WP_011709105.1|1271255_1271462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148264652.1|1271466_1272042_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_011709107.1|1272174_1273830_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_011709108.1|1273900_1274530_-	lipid-A-disaccharide synthase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_011709109.1|1274526_1275240_-	glycosyltransferase family 2 protein	NA	B9UDL7	Salmonella_phage	25.6	2.2e-15
WP_011709110.1|1275389_1276325_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	26.5	1.8e-22
WP_011709111.1|1276392_1276854_-	PepSY-like domain-containing protein	NA	NA	NA	NA	NA
WP_011709112.1|1276921_1277683_-	membrane protein	NA	NA	NA	NA	NA
WP_011709113.1|1278047_1280471_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011709114.1|1280539_1281730_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011709115.1|1281803_1282478_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011709116.1|1282609_1283338_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_041250022.1|1283702_1284059_+	single-stranded DNA-binding protein	NA	A0A2I6UG15	Salinibacter_virus	39.4	9.5e-20
WP_041250023.1|1284137_1284440_+	JAB domain-containing protein	NA	NA	NA	NA	NA
1284426:1284455	attL	CATTATGTAAAGTAAATTATTATGTAAAGT	NA	NA	NA	NA
WP_011709119.1|1284587_1285865_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_173362640.1|1285857_1286826_+|integrase	tyrosine-type recombinase/integrase	integrase	H7BW99	unidentified_phage	28.9	1.2e-05
WP_011709121.1|1286812_1287826_+|integrase	tyrosine-type recombinase/integrase	integrase	Q8W5Y3	Listeria_phage	21.9	5.3e-07
WP_011709122.1|1287931_1288105_+	DNA repair protein RadC	NA	NA	NA	NA	NA
1287886:1287915	attR	ACTTTACATAATAATTTACTTTACATAATG	NA	NA	NA	NA
WP_148264597.1|1288931_1289087_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NC_008571	Gramella forsetii KT0803, complete genome	3798465	2106188	2127017	3798465	transposase	Escherichia_phage(33.33%)	20	NA	NA
WP_011708813.1|2106188_2106464_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011708786.1|2106487_2107318_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011709862.1|2107603_2107885_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	41.6	2.0e-12
WP_011709863.1|2107902_2108202_+	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	47.3	5.3e-16
WP_148264610.1|2108748_2109720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011708786.1|2110136_2110967_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011708813.1|2110990_2111266_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011709866.1|2111603_2113505_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A0N9QYX6	Chrysochromulina_ericina_virus	28.9	2.3e-27
WP_011709867.1|2113555_2114521_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_011709868.1|2114736_2115939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011709869.1|2115940_2116882_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011709870.1|2117093_2118218_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_011709871.1|2118336_2119458_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_011709872.1|2119454_2120582_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_011709873.1|2120608_2121484_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011709874.1|2121488_2122364_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_011709875.1|2122590_2124303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011709876.1|2124381_2126106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011709877.1|2126364_2126718_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011709878.1|2126741_2127017_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NC_008571	Gramella forsetii KT0803, complete genome	3798465	2561612	2583588	3798465	portal,capsid,terminase,tail	Riemerella_phage(33.33%)	30	NA	NA
WP_011710284.1|2561612_2564078_-|tail	phage tail protein	tail	F5A399	Riemerella_phage	29.2	2.7e-49
WP_011710285.1|2564159_2568137_-|tail	phage tail tape measure protein	tail	A0A1V0DYA9	Dinoroseobacter_phage	36.9	9.0e-34
WP_011710286.1|2568222_2569161_-	HNH endonuclease	NA	E5DV63	Deep-sea_thermophilic_phage	45.1	2.4e-30
WP_011710287.1|2569260_2569920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158308624.1|2569929_2570076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041250108.1|2570126_2570618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011710289.1|2570684_2571089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011710290.1|2571132_2571675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011710291.1|2571678_2572062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011710292.1|2572045_2572474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011710293.1|2572461_2572749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011710294.1|2572745_2573048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011710295.1|2573049_2574342_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_011710296.1|2574341_2574713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011710297.1|2574729_2575356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011710298.1|2575415_2575631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011710299.1|2575617_2576022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011710300.1|2576002_2577028_-	hypothetical protein	NA	F5A3C5	Riemerella_phage	35.8	1.1e-44
WP_011710302.1|2577166_2577406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011710303.1|2577405_2577648_-	hypothetical protein	NA	W8CQR9	Croceibacter_phage	50.6	1.3e-12
WP_011710304.1|2577651_2578023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011710305.1|2578019_2578232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011710306.1|2578215_2578452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011710307.1|2578463_2578817_-	hypothetical protein	NA	A0A1B0WLQ7	Flavobacterium_phage	35.2	1.3e-08
WP_011710308.1|2578816_2580154_-|portal	phage portal protein	portal	F5A3C6	Riemerella_phage	28.5	5.5e-28
WP_011710309.1|2580153_2581674_-|terminase	phage terminase large subunit	terminase	K4F6Z3	Cronobacter_phage	39.8	5.1e-54
WP_011710310.1|2581660_2582182_-|terminase	terminase small subunit	terminase	NA	NA	NA	NA
WP_011710311.1|2582181_2582496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011710312.1|2582496_2582667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011710313.1|2582673_2583588_-	hypothetical protein	NA	A0A1P8VWA8	Flavobacterium_phage	38.6	2.4e-43
>prophage 8
NC_008571	Gramella forsetii KT0803, complete genome	3798465	2593438	2599649	3798465		Cellulophaga_phage(33.33%)	10	NA	NA
WP_011710337.1|2593438_2593879_-	hypothetical protein	NA	F5A3F5	Riemerella_phage	48.0	3.6e-29
WP_011710338.1|2593879_2594392_-	hypothetical protein	NA	A0A1B1IU97	uncultured_Mediterranean_phage	35.1	1.1e-13
WP_011710339.1|2594396_2594903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011710340.1|2594914_2595115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011710341.1|2595114_2595510_-	hypothetical protein	NA	A8ASP1	Listeria_phage	31.0	1.5e-05
WP_011710342.1|2595513_2596251_-	MBL fold metallo-hydrolase	NA	A0A0A0RVF5	Bacillus_phage	47.2	5.1e-52
WP_011710343.1|2596250_2596418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011710344.1|2596421_2597363_-	recombinase RecT	NA	S0A2Z5	Cellulophaga_phage	57.0	1.0e-76
WP_011710345.1|2597373_2597613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011710346.1|2597624_2599649_-	AAA family ATPase	NA	S0A069	Cellulophaga_phage	38.2	2.1e-111
>prophage 9
NC_008571	Gramella forsetii KT0803, complete genome	3798465	3535515	3544485	3798465		Bacillus_virus(16.67%)	7	NA	NA
WP_173362646.1|3535515_3538629_-	UvrD-helicase domain-containing protein	NA	G3MA40	Bacillus_virus	23.7	8.1e-14
WP_173362647.1|3538795_3539407_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	56.5	3.8e-61
WP_011711219.1|3540072_3541971_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	24.4	1.6e-12
WP_041250170.1|3542043_3542967_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_011711221.1|3543040_3543505_-	ribonuclease HI	NA	A0A223LIW7	Erwinia_phage	38.4	1.3e-21
WP_011711222.1|3543504_3544101_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.1	3.9e-18
WP_011711223.1|3544248_3544485_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	38.1	1.8e-06
