The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_008054	Lactobacillus delbrueckii subsp. bulgaricus ATCC 11842 = JCM 1002, complete genome	1864998	238847	255399	1864998		Planktothrix_phage(16.67%)	17	NA	NA
WP_003619471.1|238847_239891_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.2	4.7e-19
WP_011543591.1|239905_240859_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.3	3.5e-21
WP_080554281.1|240940_241078_+	DUF975 family protein	NA	NA	NA	NA	NA
WP_003622302.1|241210_242524_-	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	32.7	3.3e-62
WP_011543592.1|242575_243889_-	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	33.3	3.3e-62
WP_003619462.1|243985_244411_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_011543593.1|244638_245100_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_003622306.1|245183_246473_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	38.2	1.6e-72
WP_003622309.1|246658_247651_+	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	68.4	1.8e-132
WP_011543594.1|247779_249087_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	40.8	1.0e-87
WP_041806400.1|249079_249439_+	hypothetical protein	NA	E3W8I0	Leuconostoc_phage	34.8	6.0e-06
WP_011543596.1|249508_250801_-	purine permease	NA	Q9KX94	Enterobacteria_phage	31.0	8.2e-29
WP_003619447.1|250830_251400_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003619444.1|251754_252912_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	31.3	4.1e-56
WP_003619442.1|252911_254465_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.2	3.5e-18
WP_003616790.1|254789_255041_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_003616793.1|255027_255399_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0K2CZV4	Paenibacillus_phage	45.6	8.9e-21
>prophage 2
NC_008054	Lactobacillus delbrueckii subsp. bulgaricus ATCC 11842 = JCM 1002, complete genome	1864998	972693	982134	1864998		Bacillus_phage(28.57%)	11	NA	NA
WP_011543913.1|972693_973644_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	34.2	7.6e-32
WP_041806509.1|973855_974293_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011543914.1|974292_976020_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.6	7.3e-33
WP_011543915.1|976019_977777_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.7	1.1e-41
WP_003618103.1|977859_978168_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_041806511.1|978216_978612_-	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	31.5	1.4e-08
WP_157862418.1|978608_978935_-	viroplasmin family protein	NA	F2Y108	Organic_Lake_phycodnavirus	33.7	7.1e-06
WP_050899095.1|979765_980209_-	ribonuclease HI	NA	A0A0H3UZB5	Geobacillus_virus	32.8	3.7e-13
WP_011543917.1|980457_980940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011543918.1|981146_981413_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011543919.1|981414_982134_-	HAD family hydrolase	NA	M1H9H9	Acanthocystis_turfacea_Chlorella_virus	24.1	1.2e-05
>prophage 3
NC_008054	Lactobacillus delbrueckii subsp. bulgaricus ATCC 11842 = JCM 1002, complete genome	1864998	993912	1086591	1864998	integrase,tRNA,transposase,protease	Streptococcus_phage(13.64%)	66	1023119:1023163	1050995:1051039
WP_011543931.1|993912_994665_+|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011543932.1|995831_997262_-	NADP-dependent glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_003620545.1|997362_998883_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_011543933.1|998886_999810_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.7	2.1e-26
WP_003623037.1|1000140_1000602_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_041806782.1|1001055_1001475_+	3-beta hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
WP_011543934.1|1001536_1002448_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011543935.1|1002599_1003025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011543936.1|1003168_1004341_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011543938.1|1004610_1010451_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.3	7.8e-10
WP_011543941.1|1012112_1012727_+	DedA family protein	NA	NA	NA	NA	NA
WP_011543942.1|1013077_1014094_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	38.8	2.7e-59
WP_011543871.1|1014169_1015468_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	28.4	8.2e-53
WP_041806525.1|1015520_1016825_-|transposase	ISL3-like element ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.0	1.4e-57
WP_003619632.1|1018108_1021135_-	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	32.9	1.3e-141
WP_011543943.1|1021138_1023022_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
1023119:1023163	attL	TTAAACTTCCCACACCAAAAAGAACTATGAAGCCTTGAAAACTCA	NA	NA	NA	NA
WP_011543944.1|1023637_1024861_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.0	1.3e-97
WP_003618241.1|1027128_1027440_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011543945.1|1027619_1028456_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_003618238.1|1028498_1029065_+	signal peptidase I	NA	NA	NA	NA	NA
WP_011543946.1|1029134_1029320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011543947.1|1029711_1030950_-	peptidase T	NA	NA	NA	NA	NA
WP_011543948.1|1030993_1031791_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_011543949.1|1031783_1032476_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011543950.1|1032619_1033060_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_011543951.1|1033059_1033908_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_011543953.1|1035908_1036241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011543954.1|1039517_1041392_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	36.4	2.3e-104
WP_011543955.1|1041384_1042008_-	DUF4391 domain-containing protein	NA	NA	NA	NA	NA
WP_011543956.1|1042008_1045245_-	helicase	NA	A0A2K5B2B9	Erysipelothrix_phage	43.7	1.7e-232
WP_011543957.1|1046323_1046503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041806788.1|1047822_1050060_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	30.2	3.1e-60
WP_011543961.1|1052094_1053231_-	sigma-70 family RNA polymerase sigma factor	NA	G8CLC7	Synechococcus_phage	35.9	1.6e-36
1050995:1051039	attR	TTAAACTTCCCACACCAAAAAGAACTATGAAGCCTTGAAAACTCA	NA	NA	NA	NA
WP_011543962.1|1053266_1054385_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.1	2.9e-38
WP_011543963.1|1054356_1056195_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	37.4	5.4e-58
WP_041806537.1|1056226_1058293_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003618715.1|1058285_1059197_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_003613030.1|1059461_1060211_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_011543965.1|1060210_1061116_-	GTPase Era	NA	NA	NA	NA	NA
WP_003618710.1|1061099_1061519_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_003618709.1|1061520_1062045_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_011543966.1|1062044_1062992_-	PhoH family protein	NA	H6X2N1	Pseudomonas_phage	48.8	8.9e-49
WP_002880182.1|1063145_1063322_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003618707.1|1063490_1064348_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_011543967.1|1064407_1064629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011543968.1|1064745_1065630_-	YitT family protein	NA	NA	NA	NA	NA
WP_041806539.1|1066784_1066985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041806541.1|1066993_1067305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003618701.1|1067548_1068733_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_041806543.1|1068914_1070213_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_011543969.1|1070580_1071276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077302027.1|1071675_1071900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002880191.1|1072223_1073120_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_011543971.1|1073201_1074596_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IB03	Erwinia_phage	26.0	1.9e-31
WP_003618695.1|1074598_1075132_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_003618694.1|1075241_1076129_-	tyrosine recombinase XerC	NA	S5W9T9	Leptospira_phage	30.2	1.4e-24
WP_003618693.1|1076128_1077448_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_011543972.1|1077579_1079763_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	34.8	1.6e-93
WP_011543973.1|1079889_1080729_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	37.4	2.4e-29
WP_003618690.1|1080826_1081597_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	37.2	5.6e-25
WP_003623895.1|1081586_1082444_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_002880201.1|1082518_1082749_-	YozE family protein	NA	NA	NA	NA	NA
WP_011543974.1|1082752_1083598_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	45.0	1.0e-19
WP_011543975.1|1083732_1084395_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_003618685.1|1084420_1085611_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	47.8	2.4e-43
WP_011543976.1|1085691_1086591_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	39.4	2.6e-50
>prophage 4
NC_008054	Lactobacillus delbrueckii subsp. bulgaricus ATCC 11842 = JCM 1002, complete genome	1864998	1683521	1689709	1864998		Streptomyces_phage(50.0%)	6	NA	NA
WP_041806712.1|1683521_1684199_-	C40 family peptidase	NA	A0A0A8WF62	Clostridium_phage	40.5	7.1e-16
WP_041806715.1|1684377_1685160_-	C40 family peptidase	NA	A0A2L1IW19	Streptomyces_phage	42.7	1.0e-13
WP_011544282.1|1686582_1687056_-	C40 family peptidase	NA	A0A2L1IW19	Streptomyces_phage	41.9	1.9e-15
WP_011544283.1|1687226_1688273_-	lactate dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	29.4	1.8e-26
WP_003621166.1|1688556_1689042_-	C40 family peptidase	NA	A0A2L1IW19	Streptomyces_phage	41.1	2.3e-16
WP_011544284.1|1689166_1689709_-	AAA family ATPase	NA	U5J9X2	Bacillus_phage	34.7	5.0e-12
