The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_006368	Legionella pneumophila str. Paris, complete genome	3503610	216713	269636	3503610	integrase,protease,transposase	Pseudomonas_phage(66.67%)	44	226438:226454	234123:234139
WP_011212825.1|216713_217922_+|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	47.8	7.5e-93
WP_011212826.1|218148_218973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011212827.1|218959_219922_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_011212828.1|220252_222193_+	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	34.9	1.8e-56
WP_011212829.1|222189_224688_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_011212831.1|225538_226405_+|transposase	transposase	transposase	NA	NA	NA	NA
226438:226454	attL	CTTTGTTGGGGTAGAGC	NA	NA	NA	NA
WP_011212832.1|226595_229781_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_011212833.1|230008_230875_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_025519216.1|230879_231443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011212835.1|231769_232150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080019877.1|232228_232759_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	47.3	2.9e-33
WP_011212836.1|233167_234034_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011212837.1|234325_235429_+	nucleoside hydrolase	NA	NA	NA	NA	NA
234123:234139	attR	CTTTGTTGGGGTAGAGC	NA	NA	NA	NA
WP_011212842.1|240268_240784_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_162470335.1|241108_241279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011212844.1|241673_241988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011212845.1|242282_243719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011212846.1|243979_244726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011212847.1|245073_245952_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_011212848.1|245981_247064_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011212849.1|247178_247940_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_010945919.1|247920_248133_-	ParD-like family protein	NA	NA	NA	NA	NA
WP_011212850.1|248309_248789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011212851.1|249024_250002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011212852.1|250130_250550_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_011212853.1|250974_251748_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011212854.1|251829_252285_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_011212855.1|252452_253337_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_011212856.1|253603_254014_-	peptide chain release factor-like protein	NA	NA	NA	NA	NA
WP_011212857.1|254114_254840_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_011212858.1|254836_255523_-	MCE family protein	NA	NA	NA	NA	NA
WP_011212859.1|255590_256346_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011212860.1|256611_257178_-	F-box protein	NA	NA	NA	NA	NA
WP_080019879.1|257367_258093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011212862.1|258222_259083_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011212863.1|259193_260243_+	L-tyrosine/L-tryptophan isonitrile synthase family protein	NA	NA	NA	NA	NA
WP_011212864.1|260232_261069_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_011212865.1|261065_262508_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_011212866.1|262504_263653_+	MFS transporter	NA	NA	NA	NA	NA
WP_011212867.1|263649_264882_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_011212868.1|265039_266182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025519229.1|266721_267696_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_011212870.1|267800_268619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011212871.1|268793_269636_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
>prophage 2
NC_006368	Legionella pneumophila str. Paris, complete genome	3503610	793631	864669	3503610	tRNA,transposase,holin	uncultured_virus(14.29%)	57	NA	NA
WP_010946555.1|793631_794717_+|transposase	IS4-like element ISLpn9 family transposase	transposase	NA	NA	NA	NA
WP_010946556.1|794742_795036_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_042233480.1|795061_796207_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011213249.1|796215_797655_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011213250.1|797979_799761_-	lytic transglycosylase domain-containing protein	NA	K4NWI2	Pseudomonas_phage	35.8	3.0e-13
WP_011213251.1|799802_800456_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_011213252.1|800669_801134_-	DoxX family protein	NA	NA	NA	NA	NA
WP_011213253.1|801130_801910_-	putative DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011213254.1|801902_802772_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_011213255.1|802777_803032_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_011213256.1|803368_804394_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_011213257.1|804509_806726_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011213258.1|806767_807532_+	acetoacetate decarboxylase	NA	NA	NA	NA	NA
WP_011213259.1|807568_807841_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_011213260.1|807833_809147_+	adenylate/guanylate cyclase domain-containing protein	NA	M1HLN3	Pelagibacter_phage	27.7	5.6e-17
WP_011213261.1|809166_809982_-	putative DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011213262.1|809974_810802_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_010946414.1|811099_811366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011213263.1|811620_812373_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011213264.1|812510_815252_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_025519356.1|815516_816728_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011213266.1|816795_817368_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011213267.1|817360_818287_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	3.6e-18
WP_025519358.1|818301_819420_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011213269.1|819489_820809_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_011213270.1|820898_822659_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_010946424.1|822844_823135_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	48.9	1.5e-18
WP_011213271.1|823162_824809_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	60.1	4.1e-174
WP_011213272.1|824931_825372_+	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_011213273.1|825628_827746_+	fused MFS/spermidine synthase	NA	NA	NA	NA	NA
WP_011213274.1|828079_829960_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	36.2	6.0e-97
WP_011213275.1|830093_831902_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	2.8e-19
WP_011213276.1|831990_836274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011213277.1|836631_838341_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	30.1	6.6e-10
WP_080019926.1|838502_841352_+	Dot/Icm T4SS effector AnkX	NA	A0A2L2DMI5	Acanthamoeba_polyphaga_mimivirus	22.7	1.6e-08
WP_080019927.1|841358_843071_-|holin	T4SS effector phosphocholine hydrolase Lem3	holin	NA	NA	NA	NA
WP_010946434.1|843157_845464_-	bifunctional SulP family inorganic anion transporter/carbonic anhydrase	NA	NA	NA	NA	NA
WP_011213280.1|845653_846505_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	53.9	8.8e-72
WP_010946436.1|846522_847890_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_011213281.1|847901_848552_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_011213282.1|848732_849917_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	1.0e-41
WP_011213283.1|850003_851026_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	62.7	3.8e-13
WP_011213284.1|851068_852742_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	28.9	1.1e-44
WP_010946441.1|852783_853395_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_011213285.1|853504_853942_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_011213286.1|853941_854367_+	transporter	NA	NA	NA	NA	NA
WP_011213287.1|854406_855579_-	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_011213288.1|855635_856610_-	DotI/IcmL/TraM family protein	NA	NA	NA	NA	NA
WP_011213289.1|856622_857582_-	formimidoylglutamase	NA	NA	NA	NA	NA
WP_014841157.1|857871_858681_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011213291.1|858680_859892_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_011213292.1|859918_860614_+	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_011213293.1|860613_862614_+	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_021437009.1|862998_863307_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_104411335.1|863396_864126_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	46.8	1.5e-24
WP_021437011.1|864102_864345_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_021437012.1|864360_864669_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_006368	Legionella pneumophila str. Paris, complete genome	3503610	1006172	1013012	3503610		Acinetobacter_phage(42.86%)	9	NA	NA
WP_010946569.1|1006172_1006949_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	48.2	3.3e-57
WP_010946570.1|1006941_1007976_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	47.6	3.5e-75
WP_010946571.1|1007953_1008532_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	53.2	1.0e-55
WP_010946572.1|1008565_1009291_-	LPS export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	3.1e-17
WP_010946573.1|1009287_1009797_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_010946574.1|1009777_1010347_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_011213328.1|1010343_1010871_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	47.7	1.4e-27
WP_010946576.1|1010884_1011847_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	34.1	4.2e-38
WP_010946577.1|1012214_1013012_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.8	1.3e-21
>prophage 4
NC_006368	Legionella pneumophila str. Paris, complete genome	3503610	1315908	1321845	3503610		Staphylococcus_phage(50.0%)	6	NA	NA
WP_011213534.1|1315908_1316982_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	27.8	9.5e-31
WP_011213535.1|1316966_1317581_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	38.4	4.6e-22
WP_011213536.1|1317577_1318786_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.0	1.0e-97
WP_010946914.1|1318793_1319261_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.1	9.2e-23
WP_010946915.1|1319386_1321024_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.3	3.6e-154
WP_010946916.1|1321020_1321845_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	43.9	1.8e-53
>prophage 5
NC_006368	Legionella pneumophila str. Paris, complete genome	3503610	2042731	2114437	3503610	integrase,tRNA,transposase,protease	Tupanvirus(18.18%)	59	2048174:2048233	2097886:2097948
WP_010947570.1|2042731_2043169_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_010947571.1|2043386_2044169_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_011214098.1|2044277_2045237_-	glutathione synthase	NA	NA	NA	NA	NA
WP_011214099.1|2045236_2046532_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_010946556.1|2046690_2046984_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_010946555.1|2047009_2048095_-|transposase	IS4-like element ISLpn9 family transposase	transposase	NA	NA	NA	NA
2048174:2048233	attL	CACTGGATTGCTTCGTCGCTACGCTCCTCGCAACGACGGTCCCAAAAATCGTACCGTACA	NA	NA	NA	NA
WP_011214101.1|2048547_2049444_+	DMT family transporter	NA	NA	NA	NA	NA
WP_011214102.1|2049447_2049729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021437159.1|2049715_2050066_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_011214104.1|2050099_2050762_-	Dot/Icm T4SS effector Lem14	NA	NA	NA	NA	NA
WP_011214105.1|2051131_2052769_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_014841922.1|2052821_2053460_+	uridine kinase	NA	A0A2K9L178	Tupanvirus	36.7	1.7e-27
WP_027229338.1|2053573_2054362_+	enoyl-ACP reductase	NA	NA	NA	NA	NA
WP_080454273.1|2054813_2057654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011214109.1|2058160_2058787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011214110.1|2059069_2062204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011214111.1|2062776_2064651_-	SurA N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_011214112.1|2064908_2065187_-	HU family DNA-binding protein	NA	B5TA87	Burkholderia_phage	49.4	2.5e-15
WP_010947583.1|2065315_2067766_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	50.2	5.1e-213
WP_172407122.1|2067999_2069280_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.2	1.9e-134
WP_010947585.1|2069414_2070059_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.5	1.2e-57
WP_010947586.1|2070061_2071393_-	trigger factor	NA	NA	NA	NA	NA
WP_011214115.1|2072263_2073490_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_011214116.1|2073612_2075463_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	32.8	5.6e-71
WP_011214117.1|2075490_2076165_-	ribonuclease III	NA	A0A0P0BX11	Ostreococcus_lucimarinus_virus	33.8	7.5e-26
WP_011214118.1|2076154_2076547_-	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_011214119.1|2076558_2077314_-	signal peptidase I	NA	NA	NA	NA	NA
WP_010947592.1|2077421_2079254_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.2	2.8e-22
WP_011214120.1|2079448_2080465_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_011214121.1|2080539_2081679_+	GspL family type II secretion system protein LspL	NA	NA	NA	NA	NA
WP_011214122.1|2081675_2082146_+	GspM family type II secretion system protein LspM	NA	NA	NA	NA	NA
WP_011214123.1|2082249_2082783_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_011214124.1|2083057_2084383_+	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_014844191.1|2084646_2087877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011214126.1|2088755_2090288_+	alpha,alpha-trehalase	NA	NA	NA	NA	NA
WP_014844192.1|2090308_2091373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011214128.1|2091464_2091905_-	VOC family protein	NA	NA	NA	NA	NA
WP_010947600.1|2092139_2092667_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	33.8	1.7e-20
WP_011214129.1|2092903_2094121_+	Dot/Icm T4SS effector LegC2/YlfB	NA	NA	NA	NA	NA
WP_011214130.1|2094442_2094757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011214131.1|2094921_2096031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011214132.1|2096461_2097547_+|transposase	IS4-like element ISLpn9 family transposase	transposase	NA	NA	NA	NA
WP_010946556.1|2097572_2097866_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_011214133.1|2098043_2098319_-	acylphosphatase	NA	NA	NA	NA	NA
2097886:2097948	attR	CACTGGATTGCTTCGTCGCTACGCTCCTCGCAACGACGGTCCCAAAAATCGTACCGTACAGAG	NA	NA	NA	NA
WP_011214134.1|2098475_2098829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011214135.1|2099010_2100342_-	Lpg1888 family Dot/Icm type IV secretion system effector	NA	NA	NA	NA	NA
WP_011214136.1|2100570_2101536_+	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	46.6	1.9e-78
WP_080020008.1|2101599_2103321_-	Dot/Icm T4SS effector LegLC8	NA	NA	NA	NA	NA
WP_013101554.1|2103432_2103699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011214139.1|2103752_2104172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011214140.1|2104181_2105462_-	MFS transporter	NA	NA	NA	NA	NA
WP_011214141.1|2105938_2107219_+	chloride channel protein	NA	NA	NA	NA	NA
WP_021437098.1|2107417_2107633_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011214143.1|2107801_2108908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011214144.1|2109109_2109613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011214145.1|2109876_2110356_+	YchJ family protein	NA	NA	NA	NA	NA
WP_011214146.1|2110375_2112181_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_011214148.1|2113757_2114093_+	endonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_021437102.1|2114116_2114437_-|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	39.1	3.0e-09
>prophage 6
NC_006368	Legionella pneumophila str. Paris, complete genome	3503610	2261893	2272016	3503610		Bacillus_phage(16.67%)	7	NA	NA
WP_011214266.1|2261893_2263582_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.4	8.0e-16
WP_011214267.1|2263713_2264721_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011214268.1|2264844_2266170_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	31.2	1.8e-47
WP_011214269.1|2266188_2267337_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	7.6e-127
WP_011214270.1|2267545_2268658_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.4	1.7e-51
WP_010947740.1|2268753_2269893_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.9	1.6e-23
WP_011214271.1|2270081_2272016_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.4	3.8e-147
>prophage 7
NC_006368	Legionella pneumophila str. Paris, complete genome	3503610	2648137	2656383	3503610	integrase,tRNA,transposase	Moraxella_phage(16.67%)	7	2652294:2652306	2657239:2657251
WP_015961445.1|2648137_2649139_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	50.7	3.4e-91
WP_010948064.1|2649343_2649583_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_014842313.1|2649785_2650229_+	lpg2359 family Dot/Icm T4SS effector	NA	A0A292GL36	Xanthomonas_phage	43.2	1.1e-20
WP_015961446.1|2650237_2651971_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.5	4.6e-59
WP_014844507.1|2652057_2653923_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.8	1.3e-35
2652294:2652306	attL	TATTGAAGAAGCA	NA	NA	NA	NA
WP_011213396.1|2654263_2655439_-|transposase	ISL3-like element ISLpn11 family transposase	transposase	A9YX10	Burkholderia_phage	22.9	3.2e-16
WP_032831057.1|2655504_2656383_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A059VF45	Pseudomonas_phage	46.7	5.9e-71
2657239:2657251	attR	TGCTTCTTCAATA	NA	NA	NA	NA
