The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017626	Escherichia coli 042, complete genome	5241977	201569	271294	5241977	plate,protease,transposase,tRNA	Emiliania_huxleyi_virus(11.11%)	57	NA	NA
WP_014639066.1|201569_202922_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|202951_205384_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|205505_205991_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139282.1|205994_207020_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|207124_207580_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565972.1|207583_208372_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139685.1|208371_209520_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569423.1|209516_210113_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
WP_001294791.1|210149_213632_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.8e-209
WP_000055746.1|213644_214604_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020966.1|214702_216844_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|216900_217290_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176529.1|217354_218650_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062315.1|218698_218959_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|218945_219146_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185300.1|219311_219857_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635534.1|219853_220276_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239179.1|220289_221000_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000360445.1|221029_221854_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260707.1|221906_223625_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094026.1|223735_224443_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|224439_224844_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|224961_225777_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|225816_226470_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|226462_227494_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140178.1|227681_228254_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997023.1|234016_234820_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SKP9	Klosneuvirus	31.4	4.4e-33
WP_000648550.1|234816_235731_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|235971_236772_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211713.1|236848_237619_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|237666_239025_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052736.1|239096_239852_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001295200.1|239885_240608_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|240604_241072_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_024165575.1|241136_241868_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_001086160.1|242403_243189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000013179.1|243528_244008_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000073803.1|244025_245384_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_122986661.1|245394_248832_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001306815.1|248941_250384_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088844.1|250388_251132_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614302.1|251128_253861_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.1	1.4e-83
WP_001280269.1|253870_254644_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000224513.1|254648_255995_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001013424.1|255997_256522_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000433571.1|256518_257811_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000896719.1|257815_258865_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000863395.1|258828_260670_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001189669.1|260675_261101_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000111580.1|261105_262590_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000041478.1|262612_263116_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142963.1|263818_264337_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001306807.1|264557_266516_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.7	1.9e-24
WP_000446997.1|266515_267355_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_001306805.1|267376_268948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000536467.1|269062_270025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000400154.1|270337_271294_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_017626	Escherichia coli 042, complete genome	5241977	877188	917583	5241977	terminase,protease,capsid,plate,head,holin,tail,portal,integrase,lysis	Enterobacteria_phage(41.94%)	66	871802:871817	915962:915977
871802:871817	attL	ATACAGAAAGAACAGG	NA	NA	NA	NA
WP_000533632.1|877188_878259_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	4.3e-201
WP_001303849.1|878236_878455_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_001281192.1|878560_878905_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
WP_001277768.1|879005_879185_-	Eag protein	NA	Q9AZ37	Salmonella_phage	100.0	3.3e-29
WP_001094870.1|879281_879986_-	DUF551 domain-containing protein	NA	S5MC19	Escherichia_phage	81.2	9.1e-107
WP_001014290.1|879988_880180_-	hypothetical protein	NA	K7PKJ7	Enterobacteria_phage	98.4	3.3e-27
WP_001289981.1|880181_880808_-	ead/Ea22-like family protein	NA	Q6H9Z5	Enterobacteria_phage	62.6	3.2e-71
WP_001214451.1|880804_880972_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	96.4	3.6e-22
WP_000753555.1|880988_881303_-	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
WP_000041319.1|881314_881797_-	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	97.5	1.3e-77
WP_000065838.1|881780_882692_-	recombinase RecT	NA	K7PKG9	Enterobacteria_phage	99.3	1.3e-169
WP_000604111.1|882688_882997_-	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	100.0	1.1e-53
WP_001243355.1|883081_883234_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000972063.1|883218_883353_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_000167590.1|883547_884018_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	8.2e-88
WP_000406157.1|884026_884407_-	Antitermination protein N	NA	A4KWR0	Enterobacteria_phage	99.1	5.3e-53
WP_000618033.1|884656_885061_-	hypothetical protein	NA	Q716D7	Shigella_phage	97.8	1.3e-68
WP_000028392.1|885057_885690_-	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
WP_001194219.1|885793_886009_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	98.6	4.2e-31
WP_001177653.1|886128_886407_+	transcriptional regulator	NA	Q8VNP9	Enterobacteria_phage	100.0	3.6e-43
WP_000166961.1|886441_886603_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539351.1|886589_887411_+	replication protein	NA	K7PJZ3	Enterobacterial_phage	98.9	2.8e-152
WP_001248394.1|887407_888784_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.6	2.8e-253
WP_001036029.1|888780_889050_+	hypothetical protein	NA	G9L682	Escherichia_phage	98.9	1.9e-44
WP_000736913.1|889324_889765_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000611488.1|889761_890607_+	phosphoadenosine phosphosulfate reductase family protein	NA	I6R0S6	Salmonella_phage	56.6	7.1e-90
WP_001254256.1|890603_890786_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000566866.1|890782_890953_+	protein ninF	NA	K7PLU6	Enterobacteria_phage	100.0	2.5e-26
WP_001000608.1|890945_891455_+	HNH endonuclease	NA	U5PWK7	Bacillus_phage	40.4	2.4e-24
WP_001008199.1|891719_892082_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
WP_000994516.1|892078_892267_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_000027548.1|892263_892752_+	late gene antiterminator protein	NA	M1FPN0	Enterobacteria_phage	98.8	4.5e-89
WP_000783734.1|893377_893701_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229393.1|893684_894161_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	99.4	2.9e-88
WP_014639107.1|894157_894595_+|lysis	lysis protein	lysis	A0A2I6PIF7	Escherichia_phage	97.9	4.2e-70
WP_000099430.1|895024_895276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135094.1|895488_895839_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	96.6	2.3e-63
WP_000929176.1|895964_896459_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	98.8	1.1e-87
WP_122989542.1|896692_898189_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.4	6.3e-299
WP_000605604.1|898200_898383_+	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	100.0	1.7e-25
WP_000466244.1|898382_899624_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	2.2e-241
WP_001193635.1|899601_900252_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	98.6	2.4e-117
WP_000257523.1|900266_901472_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.5	2.7e-223
WP_000601365.1|901521_901722_+	hypothetical protein	NA	S5FNU1	Shigella_phage	100.0	3.4e-27
WP_000927711.1|901724_902048_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000702391.1|902044_902455_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	9.7e-69
WP_000224837.1|902429_902936_+	hypothetical protein	NA	Q8SBH5	Shigella_phage	91.7	9.5e-82
WP_000779298.1|902932_903493_+	hypothetical protein	NA	Q8SBH4	Shigella_phage	98.9	8.8e-105
WP_000497757.1|903501_903672_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	2.7e-25
WP_000213511.1|903655_905152_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	99.6	4.1e-274
WP_000090998.1|905151_905508_+|tail	phage tail tube protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
WP_000661047.1|905507_905777_+|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_000807178.1|905918_907751_+|tail	phage tail tape measure protein	tail	M1FQW0	Enterobacteria_phage	98.4	3.3e-302
WP_071821387.1|907782_908169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000219908.1|908197_909523_+	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.9	3.5e-245
WP_000999527.1|909522_910602_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	6.9e-207
WP_001259071.1|910601_911150_+|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	98.9	2.5e-96
WP_000424738.1|911149_911575_+	phage GP46 family protein	NA	U5P0R9	Shigella_phage	99.3	8.8e-81
WP_000785318.1|911561_912620_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	99.1	1.2e-200
WP_000383537.1|912610_913195_+	YmfQ family protein	NA	O22003	Shigella_phage	99.5	5.4e-113
WP_000554710.1|913198_914131_+	hypothetical protein	NA	U5P0I1	Shigella_phage	95.2	2.1e-50
WP_071593801.1|914251_914536_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	62.5	3.5e-17
WP_071781723.1|914507_914624_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_000038425.1|914834_916310_-	hypothetical protein	NA	NA	NA	NA	NA
915962:915977	attR	ATACAGAAAGAACAGG	NA	NA	NA	NA
WP_000703624.1|916306_917224_-	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	89.1	2.8e-156
WP_000931964.1|917220_917583_-	GtrA family protein	NA	U5P0S6	Shigella_phage	86.7	3.9e-53
>prophage 3
NC_017626	Escherichia coli 042, complete genome	5241977	1396823	1465993	5241977	terminase,protease,capsid,head,holin,tail,portal,integrase,lysis	Escherichia_phage(40.62%)	88	1389589:1389603	1420102:1420116
1389589:1389603	attL	CCCAGCAGCCAGCAG	NA	NA	NA	NA
WP_000113674.1|1396823_1397954_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1397931_1398180_-	excisionase	NA	NA	NA	NA	NA
WP_000048531.1|1398244_1400716_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	8.0e-57
WP_001093951.1|1400795_1400999_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450218.1|1400995_1401184_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000935597.1|1401194_1402049_-	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	3.6e-65
WP_014639149.1|1402321_1402516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000358771.1|1402621_1402900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394530.1|1402859_1403261_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	78.9	6.5e-09
WP_001171958.1|1403283_1403502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379612.1|1403661_1403817_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	6.8e-07
WP_000753626.1|1404070_1404532_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	99.3	7.6e-78
WP_001053425.1|1404639_1404915_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	97.6	1.1e-39
WP_000702041.1|1404898_1405324_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262415.1|1405395_1406436_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	89.8	1.0e-98
WP_001309414.1|1406347_1406890_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_000450705.1|1406923_1407694_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.6	9.7e-86
WP_001141099.1|1407709_1408102_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_001266130.1|1408098_1408395_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001209470.1|1408391_1408853_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	1.3e-37
WP_000403782.1|1408830_1409187_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.4e-58
WP_001224665.1|1409282_1409465_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	9.1e-27
WP_000753053.1|1409457_1409634_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	3.3e-26
WP_001289989.1|1409630_1409990_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	73.5	1.7e-37
WP_000510387.1|1409990_1410206_+	hypothetical protein	NA	A0A222YWK2	Escherichia_phage	94.4	2.2e-35
WP_001142588.1|1410207_1410426_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	93.1	3.6e-30
WP_000224216.1|1410427_1410691_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	3.9e-31
WP_000207997.1|1410701_1410869_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
WP_000350274.1|1410976_1411210_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	2.8e-36
WP_000967408.1|1411444_1411657_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001004956.1|1411822_1412473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000401168.1|1412453_1413557_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000687431.1|1413714_1413888_+	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	68.5	6.8e-16
WP_001403449.1|1413947_1414220_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	1.0e-10
WP_001265091.1|1414221_1415268_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	4.5e-110
WP_000904113.1|1415280_1415655_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_000762898.1|1415651_1416473_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.8	1.3e-80
WP_000917767.1|1416699_1416897_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000935516.1|1417047_1418097_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	96.0	2.3e-199
WP_000874514.1|1419371_1421225_+	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
1420102:1420116	attR	CCCAGCAGCCAGCAG	NA	NA	NA	NA
WP_000284510.1|1421375_1421591_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001274711.1|1421966_1422500_+	lysozyme	NA	Q08J98	Stx2-converting_phage	96.6	2.4e-99
WP_001082537.1|1422798_1423263_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	84.2	1.0e-61
WP_000079508.1|1423570_1423981_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001331705.1|1424038_1424272_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	9.5e-21
WP_000867570.1|1424659_1425208_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001390579.1|1425179_1427108_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.6	7.4e-260
WP_000259002.1|1427091_1427298_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_014639157.1|1427294_1428887_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	1.4e-184
WP_001253990.1|1428876_1430382_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.3	4.6e-100
WP_000256823.1|1430418_1430766_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_000522599.1|1430823_1431852_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	2.3e-114
WP_000201501.1|1431903_1432287_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204533.1|1432279_1432633_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_000975009.1|1432648_1433224_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	56.8	2.1e-48
WP_000683093.1|1433220_1433616_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	4.4e-58
WP_000235045.1|1433623_1434376_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.6	1.8e-132
WP_000479111.1|1434389_1434821_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	1.8e-41
WP_000533402.1|1434847_1435261_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082410.1|1435241_1437812_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	85.4	0.0e+00
WP_000847345.1|1437811_1438141_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001152586.1|1438140_1438839_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	2.1e-132
WP_014639158.1|1438843_1439587_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	2.0e-144
WP_000090880.1|1439523_1440126_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.2	4.0e-87
WP_001332187.1|1440198_1440537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000515468.1|1440603_1444083_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.7	0.0e+00
WP_001228316.1|1444150_1444750_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	2.0e-107
WP_000216506.1|1444901_1447916_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	55.2	5.9e-54
WP_014639160.1|1447915_1448500_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.3e-103
WP_000239881.1|1448554_1449223_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|1449279_1449549_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000251936.1|1449663_1449834_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_001079500.1|1450322_1450829_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056488.1|1450874_1451375_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1451460_1451640_-	general stress protein	NA	NA	NA	NA	NA
WP_000443071.1|1452020_1452827_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209502.1|1452826_1454020_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983887.1|1454031_1455393_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	8.6e-37
WP_000763502.1|1455393_1456989_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	2.2e-52
WP_001194612.1|1456988_1458551_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1458641_1458686_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285663.1|1458823_1459705_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001353240.1|1459701_1460322_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_014639161.1|1460349_1462251_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291206.1|1462463_1463339_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278908.1|1463378_1463969_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559254.1|1463965_1464724_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_000422058.1|1464943_1465993_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 4
NC_017626	Escherichia coli 042, complete genome	5241977	1518717	1633110	5241977	terminase,transposase,tail,lysis,tRNA	Escherichia_phage(47.54%)	113	NA	NA
WP_000526113.1|1518717_1519176_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	8.5e-13
WP_001262123.1|1519366_1520317_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000611911.1|1520468_1521221_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_000945046.1|1521415_1521931_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
WP_000062984.1|1521941_1523468_-	p-aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_001156413.1|1523504_1524950_-	p-aminobenzoyl-glutamate hydrolase subunit AbgB	NA	NA	NA	NA	NA
WP_000444920.1|1524949_1526260_-	p-aminobenzoyl-glutamate hydrolase subunit AbgA	NA	NA	NA	NA	NA
WP_000885449.1|1526435_1527344_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046824.1|1527673_1528237_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_024165601.1|1528257_1529490_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	4.0e-17
WP_000387388.1|1529744_1530728_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123753.1|1531205_1532579_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	2.5e-52
WP_001157377.1|1532707_1533643_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	100.0	2.8e-148
WP_000040836.1|1533694_1534930_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	99.3	4.2e-240
WP_000079601.1|1534931_1535147_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	98.6	1.1e-36
WP_001383994.1|1535246_1535435_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	100.0	1.9e-27
WP_021500490.1|1535427_1535622_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	100.0	9.0e-33
WP_001516464.1|1535685_1536774_-	recombinase RecT	NA	A0A0U2S5Y9	Escherichia_phage	99.7	6.6e-205
WP_000105115.1|1536788_1539812_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0U2I1R6	Escherichia_phage	85.8	0.0e+00
WP_001516463.1|1539913_1540189_-	phage protein	NA	A0A0U2QW85	Escherichia_phage	94.5	7.5e-41
WP_000245522.1|1540263_1540440_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	91.4	1.1e-24
WP_000560230.1|1540433_1540655_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	3.1e-37
WP_014639167.1|1541085_1541574_+	super-infection exclusion protein B	NA	NA	NA	NA	NA
WP_001169146.1|1541570_1541726_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	57.4	3.6e-08
WP_000233320.1|1542159_1542579_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001072342.1|1542658_1542913_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693802.1|1542909_1543332_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	6.9e-70
WP_000899759.1|1543344_1544202_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.8	1.6e-68
WP_000788766.1|1544208_1544955_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	79.7	9.0e-113
WP_000450696.1|1544977_1545739_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.5	5.5e-118
WP_001151236.1|1545754_1546171_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.2	8.1e-63
WP_021554705.1|1546355_1547021_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000935258.1|1547201_1547414_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	6.6e-29
WP_000940322.1|1547880_1548480_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.5	5.9e-107
WP_000228021.1|1548479_1548770_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	2.8e-46
WP_000640127.1|1548766_1549303_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.0	3.0e-70
WP_000839596.1|1550595_1550811_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135280.1|1550810_1551308_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
WP_001228693.1|1551524_1551710_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	69.0	2.0e-13
WP_001097899.1|1551906_1553364_+	potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001291096.1|1553501_1554293_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.7	1.7e-48
WP_001204030.1|1554285_1555218_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.9e-83
WP_000613571.1|1555153_1555405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000089437.1|1555408_1556503_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.9	2.0e-113
WP_000625349.1|1556483_1557785_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.8	1.6e-149
WP_000763705.1|1557787_1559194_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	68.8	6.7e-186
WP_024165603.1|1559177_1560290_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.0	8.7e-112
WP_000770040.1|1560394_1561159_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	66.1	5.6e-86
WP_000918489.1|1561257_1562397_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	74.7	7.4e-159
WP_000908083.1|1562439_1562664_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	52.7	5.6e-10
WP_000634207.1|1562667_1563063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000524258.1|1563062_1563446_+	hypothetical protein	NA	A0A0H5ARS2	Pseudomonas_phage	38.1	5.4e-13
WP_001029818.1|1563446_1563827_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	43.6	1.9e-18
WP_000144682.1|1563823_1564216_+	hypothetical protein	NA	A0A059VK45	Pseudomonas_phage	31.5	2.3e-11
WP_000094291.1|1564242_1565205_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	3.4e-56
WP_122984268.1|1565355_1565715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000840612.1|1566186_1569420_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.0	8.2e-102
WP_000024053.1|1569412_1569751_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.9	1.1e-28
WP_001152480.1|1569750_1570449_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.7	5.6e-133
WP_000194743.1|1570453_1571197_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	2.7e-149
WP_011703559.1|1571094_1571742_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.3	2.1e-110
WP_000515284.1|1571802_1575198_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.6	0.0e+00
WP_001228228.1|1575265_1575865_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	93.0	1.2e-102
WP_000741766.1|1575929_1578305_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	69.3	1.4e-167
WP_000654143.1|1578304_1578586_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.6e-17
WP_001353819.1|1578595_1579636_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.3	1.4e-124
WP_000355601.1|1579678_1579972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968130.1|1580323_1581181_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001101725.1|1581177_1582035_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000983720.1|1582031_1582859_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.0	8.7e-08
WP_000555618.1|1582858_1583773_-	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_001295593.1|1584358_1584793_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837924.1|1584933_1586067_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_000628224.1|1586432_1589957_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_001295715.1|1590230_1590497_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_014639176.1|1590493_1590916_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_000762229.1|1591026_1592016_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_000900922.1|1592223_1594863_+	YdbH family protein	NA	NA	NA	NA	NA
WP_000698145.1|1594859_1595045_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_001306533.1|1595052_1595379_+	YdbL family protein	NA	NA	NA	NA	NA
WP_072134698.1|1595550_1595763_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001314702.1|1595727_1595910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001123440.1|1595891_1596482_+	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000069825.1|1596712_1597573_+	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_000476130.1|1597636_1599937_+	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
WP_000177496.1|1600107_1600713_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_000431873.1|1602401_1604159_+	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014639178.1|1604148_1605465_+	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_000048938.1|1605518_1606124_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_000139603.1|1606324_1610227_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_014639179.1|1610511_1610850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014639180.1|1610836_1611286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343024.1|1611404_1611782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001146822.1|1611993_1612698_+	YdcF family protein	NA	NA	NA	NA	NA
WP_000115951.1|1612894_1614334_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000048642.1|1614375_1615377_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_014639181.1|1615565_1616096_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	4.1e-19
WP_000731826.1|1616340_1616514_+	hypothetical protein	NA	A0A0R6PIB1	Moraxella_phage	58.2	5.8e-07
WP_001309484.1|1616586_1616736_-	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_001098587.1|1617134_1618775_+	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_000414564.1|1618812_1619736_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000013805.1|1619952_1621296_+	VOC family protein	NA	NA	NA	NA	NA
WP_000375958.1|1621520_1623176_+	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_001296778.1|1623315_1623540_+	YdcH family protein	NA	NA	NA	NA	NA
WP_001587028.1|1623602_1624142_+	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001234018.1|1624133_1625114_-	LbetaH domain-containing protein	NA	NA	NA	NA	NA
WP_001376850.1|1625237_1626230_+	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_000586739.1|1626226_1626820_+	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001261034.1|1627122_1627791_+	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_071593600.1|1627825_1629037_-	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000429149.1|1629089_1629626_+	DNA-binding transcriptional regulator SutR	NA	NA	NA	NA	NA
WP_001314711.1|1629698_1631660_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.9	7.1e-24
WP_106425742.1|1631761_1633110_-|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.8	4.6e-75
>prophage 5
NC_017626	Escherichia coli 042, complete genome	5241977	1760789	1814145	5241977	terminase,capsid,transposase,head,tail,portal,integrase,lysis	Enterobacteria_phage(42.86%)	69	1771567:1771582	1823222:1823237
WP_000527823.1|1760789_1762250_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.6	6.6e-43
WP_000347485.1|1762339_1763623_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1764226_1764340_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1764408_1764642_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|1764959_1765550_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885584.1|1765647_1766223_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	8.5e-103
WP_000279152.1|1766222_1769186_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	92.3	2.6e-54
WP_001230379.1|1769250_1769850_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.6e-110
WP_000515372.1|1769919_1773333_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.4	0.0e+00
1771567:1771582	attL	CACGGCGGTGATGGCA	NA	NA	NA	NA
WP_000090891.1|1773393_1774026_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000194780.1|1773962_1774706_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_001152624.1|1774711_1775410_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	5.6e-133
WP_000847331.1|1775409_1775739_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000459457.1|1778306_1778741_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479153.1|1778722_1779145_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_014639191.1|1779160_1779901_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.6	2.3e-132
WP_000683105.1|1779908_1780304_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975067.1|1780300_1780879_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	3.5e-80
WP_000753007.1|1780890_1781244_-|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	99.1	4.4e-62
WP_000158906.1|1781255_1781654_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063277.1|1781695_1782721_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.7	2.7e-192
WP_001295978.1|1782776_1783109_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123272.1|1783118_1784438_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	1.5e-232
WP_001676384.1|1784418_1786020_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	3.8e-310
WP_001027316.1|1786219_1788145_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000453576.1|1788119_1788665_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_001368374.1|1789053_1789287_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1789344_1789755_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1789906_1790080_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1790251_1790407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1790486_1790552_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|1790554_1790743_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000072434.1|1790753_1790966_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	75.7	2.4e-23
WP_041031799.1|1791328_1791742_-	DUF2514 family protein	NA	NA	NA	NA	NA
WP_001092972.1|1791699_1792248_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.3	1.5e-96
WP_000189916.1|1792244_1792556_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1792560_1792776_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1793529_1793745_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1794045_1794258_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1794312_1794402_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|1794679_1795432_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|1795445_1796495_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|1796496_1796775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1796841_1797093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1797309_1797465_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1797536_1797824_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1797823_1798063_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1798087_1798393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211628.1|1798736_1798928_+	FlxA-like family protein	NA	NA	NA	NA	NA
WP_000589008.1|1799364_1800678_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000955178.1|1800855_1801038_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_001310834.1|1802344_1802701_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
WP_001151262.1|1802697_1803120_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_000054515.1|1803160_1804126_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.6	2.2e-55
WP_000705358.1|1804106_1804628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1804611_1804842_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1804925_1805333_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1805499_1805655_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171942.1|1805814_1806033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329848.1|1806036_1806201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1806600_1806789_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083297.1|1806785_1806977_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048341.1|1807069_1809541_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	4.2e-58
WP_000005555.1|1809613_1809865_+	excisionase family protein	NA	S4TND0	Salmonella_phage	48.7	1.1e-14
WP_000876958.1|1809899_1811180_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	3.3e-155
WP_001360138.1|1811199_1811310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836033.1|1811367_1812387_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	5.7e-17
WP_001295394.1|1812398_1813613_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_001314753.1|1813818_1814145_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.2e-23
1823222:1823237	attR	TGCCATCACCGCCGTG	NA	NA	NA	NA
>prophage 6
NC_017626	Escherichia coli 042, complete genome	5241977	2215623	2274966	5241977	terminase,protease,capsid,head,holin,tail,portal,integrase	Escherichia_phage(39.34%)	81	2246297:2246312	2288302:2288317
WP_000235966.1|2215623_2216328_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
WP_000654149.1|2216337_2216619_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	2.7e-17
WP_000741764.1|2216615_2219015_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	55.0	5.6e-132
WP_001228252.1|2219079_2219679_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	3.4e-102
WP_000515362.1|2219746_2223142_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.8	0.0e+00
WP_021539543.1|2223202_2223850_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.3	1.2e-110
WP_032202024.1|2223747_2224491_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.1	4.9e-143
WP_001152456.1|2224495_2225194_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	96.6	4.4e-130
WP_001330090.1|2225193_2225550_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_000224019.1|2225527_2228755_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.9	0.0e+00
WP_000978930.1|2228801_2229080_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.8	3.6e-43
WP_000164664.1|2229103_2229475_-	hypothetical protein	NA	A0A1B5FP91	Escherichia_phage	99.2	5.5e-63
WP_000097526.1|2229489_2230194_-	immunoglobulin domain-containing protein	NA	A0A1B5FP82	Escherichia_phage	94.4	3.7e-116
WP_001206303.1|2230254_2230599_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	95.6	6.7e-55
WP_000347792.1|2230595_2231042_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.4	3.9e-63
WP_001147814.1|2231041_2231380_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719066.1|2231388_2231706_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
WP_000766108.1|2231782_2233000_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.4	1.7e-161
WP_000999828.1|2233014_2233614_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000923133.1|2233606_2234833_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	82.6	2.0e-202
WP_000811487.1|2234822_2234984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127863.1|2236232_2237894_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	82.8	1.4e-278
WP_001353110.1|2237877_2238234_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	83.8	6.1e-51
WP_074150599.1|2238353_2238539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145897.1|2238522_2238963_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	76.0	9.1e-65
WP_001287826.1|2238962_2239262_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	62.1	2.1e-28
WP_000270250.1|2239254_2240469_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	86.5	1.7e-209
WP_000798771.1|2240470_2241031_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	84.9	5.7e-88
WP_000733258.1|2241085_2242255_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	75.5	1.1e-162
WP_001053661.1|2242541_2243048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001145405.1|2243083_2243332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000588636.1|2243364_2243661_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126643.1|2243676_2244102_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000761808.1|2244312_2246433_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	52.9	4.4e-173
2246297:2246312	attL	ATTTTGTCGCCGCGCT	NA	NA	NA	NA
WP_000810461.1|2246429_2246729_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000543729.1|2246734_2246968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609228.1|2246971_2247172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172943229.1|2247164_2248130_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001038671.1|2248382_2248961_-	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	63.6	9.2e-57
WP_001168899.1|2249018_2249297_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000614825.1|2249360_2249582_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001140908.1|2249559_2251983_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FP96	Escherichia_phage	99.1	7.3e-196
WP_014639227.1|2251982_2252465_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	96.9	9.6e-84
WP_001139555.1|2252613_2252964_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	99.1	1.5e-65
WP_077487348.1|2253068_2253251_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	73.8	4.2e-16
WP_000992099.1|2253467_2254001_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.8	1.8e-99
WP_000193283.1|2254064_2254415_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	4.2e-36
WP_000372595.1|2254419_2254635_-|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_001323614.1|2254784_2254946_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	91.3	5.4e-15
WP_000874243.1|2254942_2255131_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_000871291.1|2255391_2255727_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000562553.1|2256007_2256139_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000762891.1|2257034_2257856_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.0e-77
WP_000904111.1|2257870_2258227_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	6.1e-35
WP_001265033.1|2258239_2259289_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	2.2e-109
WP_014639230.1|2259290_2259569_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.5e-12
WP_000737636.1|2259865_2260258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2260401_2260557_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000207977.1|2260848_2261751_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	57.6	1.8e-78
WP_000224227.1|2261761_2262025_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_001167296.1|2262026_2262518_-	hypothetical protein	NA	G9L661	Escherichia_phage	92.0	3.7e-83
WP_001289987.1|2262520_2262880_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	76.5	9.2e-39
WP_000753053.1|2262876_2263053_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	3.3e-26
WP_001224665.1|2263045_2263228_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	9.1e-27
WP_001002672.1|2263356_2263668_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	97.1	1.1e-59
WP_000004324.1|2263660_2263915_-	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	92.9	5.3e-41
WP_001151132.1|2263911_2264334_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	75.5	2.6e-53
WP_000095671.1|2264374_2265337_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_000693845.1|2265359_2265785_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747951.1|2265768_2266011_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001420344.1|2266402_2266741_+	peptidase S24	NA	H9C160	Pectobacterium_phage	32.0	2.5e-06
WP_000379575.1|2267033_2267189_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171942.1|2267348_2267567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331716.1|2267570_2267735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|2268134_2268323_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070255.1|2268319_2268511_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102138.1|2268604_2271046_+	exonuclease	NA	V5UQJ3	Shigella_phage	47.0	2.7e-113
WP_000096344.1|2271104_2271308_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533615.1|2271307_2272333_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
WP_001325918.1|2272568_2273366_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_024165620.1|2273703_2274966_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.0	3.1e-73
2288302:2288317	attR	ATTTTGTCGCCGCGCT	NA	NA	NA	NA
>prophage 7
NC_017626	Escherichia coli 042, complete genome	5241977	2473838	2483281	5241977		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001615307.1|2473838_2474975_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	98.0	5.9e-164
WP_014639242.1|2474971_2476972_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001295429.1|2477096_2477558_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2477599_2478070_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2478116_2478836_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2478832_2480518_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240398.1|2480739_2481471_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001216963.1|2481530_2481638_+	protein YohO	NA	NA	NA	NA	NA
WP_000783137.1|2481618_2482350_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569373.1|2482354_2483281_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 8
NC_017626	Escherichia coli 042, complete genome	5241977	4198134	4211199	5241977	integrase	Morganella_phage(30.0%)	18	4193494:4193507	4213936:4213949
4193494:4193507	attL	GTGCTCCCCGCCAT	NA	NA	NA	NA
WP_014639344.1|4198134_4199394_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	77.9	1.9e-192
WP_000735991.1|4199489_4200335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001090781.1|4200447_4200651_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000412546.1|4200650_4201082_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	48.6	1.1e-27
WP_001019369.1|4201094_4201928_+	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_000476150.1|4201920_4202103_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000958748.1|4202096_4203164_+	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	44.1	5.7e-12
WP_001065661.1|4203156_4203351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001024677.1|4203347_4203611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000181940.1|4203607_4203829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001058740.1|4203821_4204424_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.3	2.6e-25
WP_000628970.1|4204434_4204776_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	61.5	2.5e-33
WP_001208876.1|4204768_4205140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001244106.1|4205126_4207883_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.3	1.8e-299
WP_001018524.1|4208467_4208629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420670.1|4208645_4209107_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	72.2	9.9e-62
WP_000909175.1|4209100_4209778_+	hypothetical protein	NA	Q2A0B2	Sodalis_phage	71.6	9.2e-56
WP_000246959.1|4209777_4211199_+	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	53.2	5.7e-124
4213936:4213949	attR	ATGGCGGGGAGCAC	NA	NA	NA	NA
>prophage 9
NC_017626	Escherichia coli 042, complete genome	5241977	4236862	4247256	5241977	integrase	Enterobacteria_phage(100.0%)	12	4236680:4236702	4247733:4247755
4236680:4236702	attL	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
WP_001218975.1|4236862_4238044_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	92.7	4.3e-210
WP_000334847.1|4238179_4239616_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000342409.1|4239624_4240551_+	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_001673082.1|4240754_4241327_-	hypothetical protein	NA	Q7M2A1	Enterobacteria_phage	98.9	3.1e-97
WP_000984202.1|4241341_4241587_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	98.8	3.9e-41
WP_001283018.1|4241583_4242318_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	99.2	3.6e-130
WP_001149160.1|4242870_4243137_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980247.1|4243133_4243724_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	98.5	8.2e-69
WP_001244665.1|4243716_4244004_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459306.1|4243996_4244452_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	8.0e-64
WP_000856729.1|4244587_4244908_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783678.1|4244922_4247256_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.6	0.0e+00
4247733:4247755	attR	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
>prophage 10
NC_017626	Escherichia coli 042, complete genome	5241977	4854953	4898699	5241977	plate	Cronobacter_phage(16.67%)	39	NA	NA
WP_000708638.1|4854953_4856291_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001040045.1|4856287_4856941_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000558483.1|4856943_4858674_+	OmpA family protein	NA	NA	NA	NA	NA
WP_001007313.1|4858679_4859171_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000431646.1|4859339_4861997_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.5	5.7e-93
WP_000148361.1|4861993_4862560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001403984.1|4862553_4863096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054503.1|4863082_4865608_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_000170556.1|4865604_4867287_+	T6SS effector phospholipase Tle1-EAEC	NA	NA	NA	NA	NA
WP_000196359.1|4867306_4867984_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-EAEC	NA	NA	NA	NA	NA
WP_000196358.1|4868127_4868805_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-EAEC	NA	NA	NA	NA	NA
WP_000033410.1|4868836_4869103_+	PAAR domain-containing protein	NA	E5E3Y0	Burkholderia_phage	39.0	6.9e-07
WP_001403985.1|4869106_4870255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001037088.1|4870247_4873637_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_000146515.1|4873636_4875235_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000115357.1|4875236_4875929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342463.1|4875936_4877700_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000553781.1|4877654_4878755_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000974469.1|4878735_4879272_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001137932.1|4879274_4879706_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_001403987.1|4879862_4880264_+	hypothetical protein	NA	A0A0R6PKW9	Moraxella_phage	71.9	1.5e-05
WP_000897032.1|4880419_4881664_+	GIY-YIG nuclease family protein	NA	Q9MC01	Enterobacteria_phage	60.6	8.1e-66
WP_024261658.1|4881899_4883645_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000200211.1|4884069_4885437_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000586175.1|4885651_4886212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370895.1|4886214_4887045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204642.1|4887085_4888318_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	32.3	2.3e-60
WP_000502863.1|4888302_4888947_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.0	3.0e-56
WP_000226517.1|4889025_4889295_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001387055.1|4889315_4889960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001387054.1|4890025_4890349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014966195.1|4891168_4891555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001420591.1|4891532_4891658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000072549.1|4893075_4893552_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000215053.1|4893554_4895033_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000233190.1|4895042_4895549_+	type VI secretion system protein AaiC/Hcp2	NA	NA	NA	NA	NA
WP_000555548.1|4895558_4895981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001390300.1|4895973_4897776_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001173973.1|4897766_4898699_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 11
NC_017626	Escherichia coli 042, complete genome	5241977	4903138	4981878	5241977	protease,plate,transposase,integrase,tRNA	Enterobacteria_phage(14.29%)	53	4917141:4917156	4960526:4960541
WP_001154665.1|4903138_4904551_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001028111.1|4904889_4905480_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_001403210.1|4905485_4908890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000029849.1|4908893_4911443_+	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	33.9	2.7e-92
WP_000587872.1|4914613_4915180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000359994.1|4915658_4916813_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
4917141:4917156	attL	TGTTATTACTTTTTAT	NA	NA	NA	NA
WP_000555380.1|4918127_4919261_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_077577697.1|4919300_4919663_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	62.5	6.4e-40
WP_000555401.1|4920244_4921378_+|transposase	IS110-like element ISEc45 family transposase	transposase	NA	NA	NA	NA
WP_000624688.1|4923086_4923437_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
WP_001309734.1|4923433_4923868_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_001045649.1|4924839_4928958_-|protease	serine protease autotransporter toxin Pic	protease	Q9LA54	Enterobacteria_phage	45.8	0.0e+00
WP_000227970.1|4929744_4930821_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001254932.1|4931763_4932915_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000747051.1|4932834_4933185_-|transposase	transposase	transposase	Q716C1	Shigella_phage	98.9	1.8e-39
WP_001091149.1|4933254_4933548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000081336.1|4933636_4936507_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_000126413.1|4938146_4940534_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_001273465.1|4940543_4941524_-	ATP-binding protein	NA	A0A1B2RW50	Lymphocystis_disease_virus	30.2	4.2e-17
WP_001218809.1|4947381_4948644_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	43.1	6.9e-81
WP_001188520.1|4949023_4949599_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000068915.1|4949635_4951333_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_000883400.1|4951308_4951647_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000961959.1|4951761_4953063_-	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_000069437.1|4953180_4954617_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_001267445.1|4954953_4955430_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000015852.1|4955445_4956702_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001026276.1|4956977_4957271_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|4957314_4958961_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_000558209.1|4959098_4959452_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_001008025.1|4959501_4960371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000940541.1|4960605_4961634_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
4960526:4960541	attR	ATAAAAAGTAATAACA	NA	NA	NA	NA
WP_000257278.1|4961675_4962242_+	elongation factor P	NA	NA	NA	NA	NA
WP_000977754.1|4962293_4962419_+	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000239596.1|4962529_4962676_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000118482.1|4962850_4963168_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001238369.1|4963164_4963698_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_001376670.1|4963786_4964920_-	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_000609663.1|4964982_4965342_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_000208763.1|4965352_4965748_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000829498.1|4965758_4966493_-	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_001192973.1|4966485_4968294_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000004771.1|4968618_4969596_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001120837.1|4969814_4971317_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_001276175.1|4971414_4971729_+	YjeO family protein	NA	NA	NA	NA	NA
WP_001236795.1|4971757_4975081_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_000934917.1|4975102_4976071_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_000041955.1|4976167_4977220_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_001295188.1|4977314_4977860_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_101679539.1|4978723_4978777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294232.1|4978759_4979899_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_014639398.1|4979897_4981445_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|4981416_4981878_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
>prophage 12
NC_017626	Escherichia coli 042, complete genome	5241977	5048382	5113688	5241977	protease,transposase,holin,integrase,tRNA	Enterobacteria_phage(26.32%)	54	5060140:5060154	5091617:5091631
WP_001162162.1|5048382_5049735_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001232240.1|5049790_5050177_+	cytochrome b562	NA	NA	NA	NA	NA
WP_001106222.1|5050221_5050686_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	1.1e-52
WP_000187778.1|5050843_5052982_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001311336.1|5053375_5055031_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_001299664.1|5055080_5056502_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001181328.1|5056621_5057569_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	6.0e-13
WP_001387276.1|5057753_5057807_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471847.1|5057947_5060644_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
5060140:5060154	attL	TATTCAGAACCTGCT	NA	NA	NA	NA
WP_000047539.1|5060849_5061236_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|5061308_5061770_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013063.1|5061782_5062718_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_001296693.1|5062721_5062856_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230273.1|5063136_5063532_-	RidA family protein	NA	NA	NA	NA	NA
WP_000500696.1|5063662_5064376_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000256667.1|5064446_5065040_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000583470.1|5065184_5065637_+	toxin-antitoxin biofilm protein TabA	NA	NA	NA	NA	NA
WP_001074114.1|5065759_5067271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000012902.1|5067435_5068440_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|5068601_5069018_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001059402.1|5069063_5069567_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000079651.1|5069759_5070956_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_000416392.1|5071011_5073867_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
WP_000786399.1|5073866_5074310_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|5074469_5075981_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584117.1|5076247_5077348_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|5077347_5078430_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001385011.1|5078590_5080093_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	2.1e-84
WP_014639402.1|5080222_5081242_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.1	2.4e-44
WP_001218936.1|5081721_5082975_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	40.9	3.0e-84
WP_001273407.1|5083243_5085628_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000354454.1|5085630_5087475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000136568.1|5087623_5088463_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0F7L647	uncultured_marine_virus	34.7	2.7e-25
WP_000160682.1|5088455_5091788_-	hypothetical protein	NA	NA	NA	NA	NA
5091617:5091631	attR	TATTCAGAACCTGCT	NA	NA	NA	NA
WP_000929962.1|5091780_5092671_-	DUF4007 family protein	NA	NA	NA	NA	NA
WP_000416151.1|5093502_5094534_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	1.4e-18
WP_000916805.1|5094804_5095248_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000705930.1|5095263_5095551_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000345350.1|5095563_5096820_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001327567.1|5097066_5097321_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	62.2	8.0e-21
WP_000107474.1|5097741_5098755_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000998350.1|5098766_5100083_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000350265.1|5100110_5101031_-	ribokinase	NA	NA	NA	NA	NA
WP_001295538.1|5101336_5102119_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000422741.1|5104395_5104821_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|5104817_5105168_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|5105198_5106812_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_001422798.1|5107193_5107322_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000251886.1|5107502_5107877_-	TetR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001424065.1|5108048_5109071_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	7.8e-200
WP_001323403.1|5109070_5109850_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_000145479.1|5109900_5110119_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001409274.1|5110257_5111628_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001293435.1|5111690_5113688_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
>prophage 1
NC_017627	Escherichia coli 042 plasmid pAA, complete sequence	113346	11679	48410	113346	integrase,protease,transposase	Stx2-converting_phage(25.0%)	24	8490:8504	15290:15304
8490:8504	attL	CACTTTCATTAACCT	NA	NA	NA	NA
WP_158303805.1|11679_12069_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	96.1	2.1e-65
WP_144335553.1|12220_12373_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000016964.1|12611_13418_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.5	3.0e-53
WP_001159871.1|13418_13724_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813634.1|13725_13944_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_032489528.1|15558_16401_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
15290:15304	attR	AGGTTAATGAAAGTG	NA	NA	NA	NA
WP_011666408.1|16403_17492_+	putative hexosyltransferase CapU	NA	NA	NA	NA	NA
WP_014639423.1|17496_18447_+	virulence factor VirK	NA	NA	NA	NA	NA
WP_001016257.1|19398_20145_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	48.5	5.0e-55
WP_173281272.1|20276_21490_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	8.4e-169
WP_000715633.1|22553_22994_-	aggregative adherence fimbria II minor subunit AafB	NA	NA	NA	NA	NA
WP_049794100.1|23010_25536_-	aggregative adherence fimbria II usher protein AafC	NA	NA	NA	NA	NA
WP_014639426.1|28072_31960_+|protease	serine protease autotransporter toxin Pet	protease	Q9LA58	Enterobacterial_phage	39.4	3.7e-226
WP_173281274.1|33295_34508_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	3.2e-168
WP_000343713.1|34511_34682_-	hypothetical protein	NA	F6MIM4	Haemophilus_phage	71.1	2.1e-09
WP_000030202.1|34765_35074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001144036.1|35160_35805_-	ParA family protein	NA	NA	NA	NA	NA
WP_064717075.1|36886_37372_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_014639428.1|38498_39248_+	aggregative adherence fimbria II chaperone AafD	NA	NA	NA	NA	NA
WP_014639430.1|39651_40134_+	aggregative adherence fimbria II major subunit AafA	NA	NA	NA	NA	NA
WP_000769456.1|41079_41877_-	aggregative adherence transcriptional regulator AggR	NA	NA	NA	NA	NA
WP_000721278.1|42683_43034_-	dispersin Aap	NA	NA	NA	NA	NA
WP_000643554.1|46245_46437_+	AggR-activated transcriptional regulator Aar	NA	NA	NA	NA	NA
WP_000381465.1|46838_48410_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
