The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_013716	Citrobacter rodentium ICC168, complete genome	5346659	226501	325686	5346659	plate,terminase,capsid,holin,head,transposase,tail,protease,tRNA	Escherichia_phage(12.5%)	102	NA	NA
WP_012904571.1|226501_228073_+|transposase	IS66-like element ISCro1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	5.4e-168
WP_012904572.1|229623_231762_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_024132475.1|231827_232217_+	VOC family protein	NA	NA	NA	NA	NA
WP_012904574.1|232278_233577_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_012904575.1|233661_233922_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_024132476.1|233908_234109_-	YaeP family protein	NA	NA	NA	NA	NA
WP_012904577.1|234297_234843_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_012904578.1|234839_235259_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_012904579.1|235292_235994_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_012904580.1|236569_237907_+	hypothetical protein	NA	G0YPW9	Erwinia_phage	55.1	6.5e-13
WP_024132477.1|238559_239669_+	porin	NA	Q1MVN1	Enterobacteria_phage	53.9	2.9e-99
WP_012904582.1|241197_242916_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012904583.1|243026_243734_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_012904584.1|243730_244135_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_012904585.1|244252_245068_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_012904586.1|245109_245763_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_012904587.1|245755_246787_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	8.0e-35
WP_012904588.1|246978_247545_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_012904589.1|254139_257151_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	47.7	3.0e-98
WP_012904590.1|258054_258858_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SKP9	Klosneuvirus	31.7	9.9e-33
WP_012904591.1|258862_259780_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012904592.1|260044_260845_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_012904593.1|260920_261691_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_012904594.1|261740_263108_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	35.1	1.7e-08
WP_012904595.1|263179_263935_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_012904596.1|263968_264703_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_012904597.1|264687_265155_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	60.6	2.5e-52
WP_012904598.1|265218_265950_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.3	9.0e-41
WP_012904599.1|267607_268378_-	amidohydrolase	NA	NA	NA	NA	NA
WP_012904600.1|268486_270931_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_012904601.1|271169_271748_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	29.6	2.8e-13
WP_012904602.1|271847_272615_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_012904603.1|272585_273326_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_042623030.1|273691_274426_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	39.2	1.5e-19
WP_148222055.1|274422_274719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012904605.1|274825_276919_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_012904606.1|276902_278042_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_012904607.1|278031_278814_-	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_012904608.1|278815_279088_-	flagellar biosynthetic protein FliQ	NA	NA	NA	NA	NA
WP_012904609.1|279099_279858_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_012904610.1|279854_280226_-	FliM/FliN family flagellar motor switch protein	NA	NA	NA	NA	NA
WP_012904611.1|280218_281085_-	FliM/FliN family flagellar motor switch protein	NA	NA	NA	NA	NA
WP_012904612.1|281694_282681_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_012904613.1|282717_283074_+	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_012904614.1|283078_284743_+	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_042623026.1|285653_286223_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	88.5	8.1e-90
WP_012904616.1|286222_287839_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q8W611	Enterobacteria_phage	44.7	1.6e-37
WP_000143149.1|287884_288460_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	61.0	8.0e-61
WP_012904617.1|288459_289443_-|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	58.5	6.9e-04
WP_012904618.1|289442_290015_-	DUF2313 domain-containing protein	NA	A0A2H4J9D6	uncultured_Caudovirales_phage	33.7	1.8e-20
WP_012904619.1|290018_291098_-|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	44.1	2.7e-73
WP_000372931.1|291097_291448_-	phage GP46 family protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	63.8	4.8e-32
WP_012904620.1|291501_292152_-|plate	phage baseplate assembly protein V	plate	F6MIL4	Haemophilus_phage	48.2	4.7e-41
WP_012904621.1|292151_293363_-|tail	tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	38.1	8.1e-71
WP_012904622.1|293346_294696_-	DNA circularization N-terminal domain-containing protein	NA	F6MIL2	Haemophilus_phage	26.5	1.2e-38
WP_012904623.1|294695_296978_-|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	36.1	2.7e-83
WP_000178828.1|296967_297126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172650.1|297140_297524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000023097.1|297520_297895_-	hypothetical protein	NA	F6MIK8	Haemophilus_phage	58.5	1.1e-31
WP_012904625.1|297907_299329_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B7SDP8	Haemophilus_phage	44.5	5.9e-97
WP_024132484.1|299321_299531_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_148222056.1|299544_300186_-	DUF1834 family protein	NA	NA	NA	NA	NA
WP_000119402.1|300194_300626_-	DUF1320 family protein	NA	A0A1X9SGZ3	Bradyrhizobium_phage	28.1	4.1e-09
WP_012904628.1|300629_300962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012904629.1|300965_301874_-|head	Mu-like prophage major head subunit gpT family protein	head	A0A2H4J778	uncultured_Caudovirales_phage	60.7	1.3e-102
WP_012904630.1|301884_302280_-	hypothetical protein	NA	A0A2H4IZH5	uncultured_Caudovirales_phage	37.0	4.1e-16
WP_024132486.1|302280_303396_-|protease	phage protease	protease	A0A2D1GNS3	Pseudomonas_phage	44.3	5.7e-63
WP_012904632.1|303605_304157_-	phage virion morphogenesis protein	NA	NA	NA	NA	NA
WP_012904633.1|304153_305320_-|capsid	minor capsid protein	capsid	A0A0M4UTA3	Ralstonia_phage	46.1	1.3e-57
WP_012904634.1|305306_306902_-	DUF935 domain-containing protein	NA	A0A0U5KSI0	unidentified_phage	46.4	2.4e-123
WP_012904635.1|306901_308542_-|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	63.3	2.3e-193
WP_012904636.1|308543_309284_-	DNA methylase	NA	Q775B4	Bordetella_phage	52.8	4.3e-67
WP_000312574.1|309330_309831_-	DUF1804 family protein	NA	A0A0M3VI86	Ralstonia_phage	47.2	4.9e-38
WP_012904637.1|309830_310151_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	51.5	1.5e-21
WP_012904638.1|310171_310354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012904639.1|310350_310896_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	86.2	3.7e-92
WP_000445983.1|310879_311176_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	50.5	8.1e-17
WP_001372993.1|311165_311558_-|holin	phage holin family protein	holin	Q9MBZ5	Enterobacteria_phage	55.7	1.6e-28
WP_024132487.1|311740_312019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012904641.1|312153_313491_+|transposase	IS4-like element ISCro3 family transposase	transposase	NA	NA	NA	NA
WP_024132489.1|313483_313954_-	mor transcription activator family protein	NA	A0A2D1GNW5	Pseudomonas_phage	40.3	2.4e-18
WP_012904642.1|314049_314463_-	regulatory protein GemA	NA	A0A2D1GNN4	Pseudomonas_phage	64.3	3.6e-39
WP_000687850.1|314434_314713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148222129.1|314793_315024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012904645.1|315181_315592_-	hypothetical protein	NA	A0A076G6X8	Escherichia_phage	68.6	1.1e-27
WP_001076058.1|315958_316147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012904647.1|316143_316434_-	DUF4752 family protein	NA	A0A088CD82	Shigella_phage	62.8	1.1e-23
WP_012904648.1|316423_316654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012904649.1|316880_317591_-	DUF2786 domain-containing protein	NA	NA	NA	NA	NA
WP_012904651.1|317970_318939_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	94.1	2.0e-176
WP_024132490.1|318984_319479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012904652.1|319560_319752_-	hypothetical protein	NA	A0A2D1GNV5	Pseudomonas_phage	47.4	1.4e-06
WP_012904653.1|319732_319966_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000206136.1|319967_320612_-	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	66.8	5.8e-76
WP_012904654.1|320641_320857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012904655.1|320846_321038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361028.1|321053_321278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148222057.1|321319_321652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012904658.1|321666_322560_-	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	53.6	1.4e-83
WP_012904659.1|322577_324620_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	48.7	1.8e-171
WP_000989761.1|324619_324856_-	helix-turn-helix domain-containing protein	NA	M1PVU4	Vibrio_phage	57.4	1.8e-14
WP_012904660.1|325038_325686_+	helix-turn-helix domain-containing protein	NA	A0A2I7S9A5	Vibrio_phage	39.0	2.0e-07
>prophage 2
NC_013716	Citrobacter rodentium ICC168, complete genome	5346659	744023	753832	5346659	transposase,tRNA	Stx2-converting_phage(50.0%)	7	NA	NA
WP_012905012.1|744023_745973_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.2e-07
WP_012904571.1|746122_747694_-|transposase	IS66-like element ISCro1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	5.4e-168
WP_012904570.1|747713_748061_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	3.4e-46
WP_012904569.1|748060_748738_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_012905013.1|748887_750555_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	95.8	0.0e+00
WP_012905014.1|751041_752448_+	chitoporin	NA	NA	NA	NA	NA
WP_012905015.1|752542_753832_-	tricarballylate/proton symporter TcuC	NA	Q6JIH2	Burkholderia_virus	34.9	2.4e-60
>prophage 3
NC_013716	Citrobacter rodentium ICC168, complete genome	5346659	979090	1051535	5346659	integrase,plate,capsid,holin,transposase,tail,protease,tRNA	Burkholderia_virus(30.77%)	71	987789:987804	1033285:1033300
WP_012905218.1|979090_979411_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	46.1	9.1e-14
WP_012905219.1|979441_981718_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.8e-164
WP_012905220.1|981786_982971_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012905221.1|982970_985145_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	29.4	1.1e-30
WP_024132564.1|985147_986605_-	TolC family protein	NA	NA	NA	NA	NA
WP_024132565.1|986712_990453_-	VCBS domain-containing protein	NA	NA	NA	NA	NA
987789:987804	attL	CGTCGCCGACGGTGCC	NA	NA	NA	NA
WP_012905223.1|990520_991081_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	73.2	6.0e-69
WP_012905224.1|991385_992957_-|transposase	IS66-like element ISCro1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	9.3e-168
WP_012904570.1|992976_993324_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	3.4e-46
WP_012904569.1|993323_994001_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_012905225.1|994226_994652_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	55.3	4.1e-30
WP_012905226.1|994623_995223_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	63.5	3.0e-66
WP_012905227.1|995222_996062_-|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	46.0	7.4e-47
WP_012905228.1|996064_996643_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	3.4e-67
WP_012905229.1|996635_997739_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	53.7	1.3e-104
WP_012905230.1|997729_998077_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	61.5	1.9e-33
WP_012905231.1|998132_998663_-|plate	phage baseplate assembly protein V	plate	Q6QIA1	Burkholderia_phage	47.6	7.5e-21
WP_012905232.1|998662_999832_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	48.3	1.1e-85
WP_012905233.1|999819_1000032_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.0	4.8e-19
WP_012905234.1|1000031_1000916_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.5	2.3e-51
WP_012905235.1|1000915_1003384_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	41.6	3.2e-167
WP_012905236.1|1003535_1003877_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_024132568.1|1003973_1004255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012905237.1|1004244_1004538_-	hypothetical protein	NA	A0A1B1PEE7	Pectobacterium_phage	40.2	2.8e-09
WP_167321450.1|1004540_1005065_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.8	6.2e-68
WP_012905239.1|1005061_1006489_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	78.0	2.4e-215
WP_024132569.1|1006478_1006730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012905241.1|1006729_1007194_-	Gp37 family protein	NA	Q6QIB2	Burkholderia_phage	53.7	6.7e-42
WP_012905242.1|1007193_1007640_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	53.0	4.2e-33
WP_012905243.1|1007641_1007998_-	DUF2190 family protein	NA	Q6QIB4	Burkholderia_phage	51.3	1.7e-16
WP_012905244.1|1008010_1008964_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.0	2.0e-64
WP_012905245.1|1008977_1010078_-	peptidase	NA	A4JWJ9	Burkholderia_virus	50.8	1.7e-96
WP_012905246.1|1010283_1010742_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	41.3	5.1e-26
WP_012905247.1|1010744_1011566_-|capsid	minor capsid protein	capsid	Q6QIB9	Burkholderia_phage	62.6	2.4e-98
WP_012905248.1|1011546_1013043_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	62.1	2.0e-175
WP_012905249.1|1013042_1014566_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.7	2.6e-183
WP_012905250.1|1014562_1015108_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	68.2	4.2e-59
WP_012905251.1|1015107_1015419_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	63.6	1.2e-31
WP_012905252.1|1015411_1015744_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	45.8	7.0e-17
WP_012905253.1|1015740_1016394_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	31.1	3.1e-08
WP_024132570.1|1016383_1017106_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	58.2	1.2e-61
WP_012905255.1|1017120_1017471_-|holin	putative holin	holin	A4JWP3	Burkholderia_virus	53.0	9.9e-22
WP_012905256.1|1017720_1018491_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	66.9	2.0e-99
WP_012905257.1|1018545_1019079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012905258.1|1019114_1019525_-	helix-turn-helix domain-containing protein	NA	E5FFF8	Burkholderia_phage	34.5	6.6e-09
WP_012905259.1|1019614_1019839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012905260.1|1019835_1020141_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	58.0	5.4e-24
WP_012905261.1|1020150_1021065_+	hypothetical protein	NA	A4JWN3	Burkholderia_virus	55.6	8.2e-76
WP_012905262.1|1021068_1022838_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	67.8	2.1e-229
WP_012905263.1|1022848_1024006_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	60.1	9.6e-122
WP_012905264.1|1024008_1024278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012905265.1|1024295_1024907_+	DUF3164 family protein	NA	A0A2D1GNM4	Pseudomonas_phage	69.5	2.5e-76
WP_024132571.1|1024985_1025174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024132572.1|1025170_1025443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012905267.1|1025457_1025754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012905268.1|1025740_1026436_+	DUF2786 domain-containing protein	NA	A0A1W6DYA0	Aeromonas_phage	35.1	7.8e-26
WP_012905270.1|1026633_1027059_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	48.2	4.3e-27
WP_012905271.1|1027055_1027445_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.7	8.4e-30
WP_024132574.1|1027599_1033845_-	Ig-like domain repeat protein	NA	NA	NA	NA	NA
1033285:1033300	attR	GGCACCGTCGGCGACG	NA	NA	NA	NA
WP_158304841.1|1033929_1034523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024132575.1|1034623_1035244_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001040187.1|1037046_1037265_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_012905274.1|1037562_1038267_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_012905275.1|1038309_1040031_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.8	1.0e-18
WP_012905276.1|1040031_1041798_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	22.6	5.4e-23
WP_012905277.1|1041912_1042881_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_000228469.1|1043425_1043920_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_012905278.1|1044061_1048042_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.5	2.2e-88
WP_012905279.1|1048187_1048799_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_012905280.1|1048807_1050151_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	41.4	1.9e-81
WP_012905281.1|1050242_1051535_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.2	4.3e-94
>prophage 4
NC_013716	Citrobacter rodentium ICC168, complete genome	5346659	1142100	1150814	5346659	transposase,protease	Stx2-converting_phage(37.5%)	9	NA	NA
WP_012905355.1|1142100_1142760_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	4.4e-47
WP_012904571.1|1144171_1145743_-|transposase	IS66-like element ISCro1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	5.4e-168
WP_012904570.1|1145762_1146110_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	3.4e-46
WP_012904569.1|1146109_1146787_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_012905356.1|1146861_1147917_+	hypothetical protein	NA	E5AGC7	Erwinia_phage	55.2	1.3e-16
WP_012905357.1|1147981_1148488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012905358.1|1148519_1149518_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	28.6	2.8e-21
WP_012905359.1|1149903_1150443_+	lysozyme	NA	K7PM52	Enterobacteria_phage	86.3	4.7e-87
WP_012905360.1|1150439_1150814_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	45.3	1.3e-14
>prophage 5
NC_013716	Citrobacter rodentium ICC168, complete genome	5346659	2054311	2148438	5346659	integrase,protease,coat,tail	Enterobacteria_phage(63.64%)	107	2048985:2048999	2150187:2150201
2048985:2048999	attL	TTTTATCCGTTCAAT	NA	NA	NA	NA
WP_012906163.1|2054311_2055277_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_012906164.1|2055273_2057664_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_012906165.1|2057639_2058392_-	molecular chaperone	NA	NA	NA	NA	NA
WP_012906166.1|2058408_2058939_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_012906167.1|2058964_2059534_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_012906168.1|2059958_2061227_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_012906169.1|2061297_2061801_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_012906170.1|2061820_2063842_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_012906171.1|2063846_2064776_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_012906172.1|2064772_2065657_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_081442307.1|2065782_2066367_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_024132713.1|2066363_2066714_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_012906176.1|2067503_2067932_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_012906177.1|2067949_2069371_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_012906178.1|2069345_2070146_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_012906179.1|2070313_2071300_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_012906180.1|2072954_2073944_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_012906181.1|2074261_2074819_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_012906182.1|2075334_2075838_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_012906183.1|2075966_2076218_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_148222135.1|2076340_2076424_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_012906184.1|2076634_2078065_+	MFS transporter	NA	NA	NA	NA	NA
WP_012906185.1|2078094_2078733_-	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_012906186.1|2078994_2079330_+	YecR-like lipofamily protein	NA	NA	NA	NA	NA
WP_012906187.1|2079500_2079998_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_024132714.1|2080030_2080270_-	YecH family protein	NA	NA	NA	NA	NA
WP_012906189.1|2080465_2081677_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_012906190.1|2081729_2082395_-	YecA family protein	NA	NA	NA	NA	NA
WP_024132715.1|2082828_2083176_+	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	47.7	3.6e-24
WP_012906194.1|2085132_2085681_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_012906195.1|2085737_2087570_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_012906196.1|2087566_2088223_-	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_012906197.1|2088683_2088908_+	DUF2594 family protein	NA	NA	NA	NA	NA
WP_012906198.1|2088974_2089697_-	transcriptional regulator SdiA	NA	NA	NA	NA	NA
WP_012906199.1|2089926_2090679_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	7.6e-27
WP_012906200.1|2090675_2091344_-	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_012906201.1|2091359_2092346_-	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_012906202.1|2092451_2093252_-	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012906203.1|2093339_2093891_-	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
WP_012906204.1|2093947_2094667_-	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_012906205.1|2094860_2096066_-	flagellin lysine-N-methylase	NA	NA	NA	NA	NA
WP_024132716.1|2096275_2097067_-	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	52.4	9.7e-65
WP_001353016.1|2097011_2097209_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001519189.1|2097401_2097698_-	zinc-ribbon domain and TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	67.2	9.0e-16
WP_000078920.1|2097833_2097974_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_000488107.1|2098165_2098426_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_012906207.1|2098468_2099491_-|tail	phage tail protein	tail	A0A0A7NQ97	Enterobacteria_phage	92.1	1.3e-186
WP_012906208.1|2099648_2100833_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.0	5.8e-223
WP_000290462.1|2100832_2101345_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000651572.1|2101400_2101775_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_000333503.1|2101783_2101939_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_012906209.1|2101925_2104733_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	96.6	0.0e+00
WP_000979945.1|2104745_2105234_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000905061.1|2105262_2105862_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_012906210.1|2105920_2108713_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.7	0.0e+00
WP_012906211.1|2108719_2109085_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	8.7e-61
WP_012906212.1|2109323_2109935_-	ash family protein	NA	S5MQL6	Escherichia_phage	39.0	2.6e-09
WP_001561001.1|2109989_2110820_-	hypothetical protein	NA	A0A0A7NPW9	Enterobacteria_phage	99.6	1.9e-132
WP_001036813.1|2110816_2111020_-	hypothetical protein	NA	A0A0A7NQ74	Enterobacteria_phage	98.5	8.3e-29
WP_000104288.1|2111031_2111331_-	ead/Ea22-like family protein	NA	A0A0A7NRX6	Enterobacteria_phage	96.0	2.1e-44
WP_012906213.1|2111327_2111573_-	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	88.9	5.0e-36
WP_000985718.1|2111569_2111773_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	97.0	1.5e-30
WP_012906214.1|2111796_2112207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021656.1|2112300_2112414_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	2.5e-11
WP_000514277.1|2112410_2112653_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_012906215.1|2112664_2112952_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	75.8	3.9e-32
WP_012906216.1|2112962_2113313_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	83.6	1.5e-49
WP_012906218.1|2113656_2113980_+	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	72.9	2.5e-35
WP_012906219.1|2114046_2115027_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	78.5	1.1e-150
WP_024132721.1|2115144_2116404_-	flagellin FliC	NA	NA	NA	NA	NA
WP_012906220.1|2116643_2118044_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_012906221.1|2118059_2118467_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_012906222.1|2118466_2118838_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_012906223.1|2118905_2120393_+	alpha-amylase	NA	NA	NA	NA	NA
WP_012906224.1|2120430_2120844_-	lipoprotein	NA	NA	NA	NA	NA
WP_012906225.1|2121030_2122236_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_012906226.1|2122232_2122466_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_012906227.1|2122663_2123611_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_012906228.1|2123739_2124048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012906229.1|2124163_2124478_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_012906230.1|2124694_2126377_+	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_012906231.1|2126369_2127368_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_012906232.1|2127360_2128068_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_012906233.1|2128067_2129438_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_012906234.1|2129459_2129903_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_012906235.1|2129899_2131087_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_012906236.1|2131191_2131659_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_012906237.1|2131663_2132668_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_012906238.1|2132664_2133078_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_012906239.1|2133080_2133455_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_012906240.1|2133454_2134192_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_012906241.1|2134201_2134471_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_012906242.1|2134480_2135275_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_012906243.1|2135555_2136179_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_024132722.1|2136232_2136421_-	protein DsrB	NA	NA	NA	NA	NA
WP_012906245.1|2136549_2136777_+	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_012906246.1|2137065_2137881_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_012906247.1|2137877_2139572_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	34.6	2.2e-18
WP_024132723.1|2139689_2139875_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_024132724.1|2139951_2140863_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_012906250.1|2141040_2141961_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_012906251.1|2141952_2142420_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	50.7	8.9e-34
WP_012906252.1|2142400_2143834_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.9	5.4e-98
WP_012906253.1|2143884_2144583_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	30.5	5.6e-08
WP_042623228.1|2144635_2144905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012906255.1|2145536_2146712_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.8	1.9e-109
WP_012906256.1|2147211_2148438_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.4	9.7e-80
2150187:2150201	attR	TTTTATCCGTTCAAT	NA	NA	NA	NA
>prophage 6
NC_013716	Citrobacter rodentium ICC168, complete genome	5346659	2270247	2276564	5346659		Enterobacteria_phage(66.67%)	6	NA	NA
WP_012906377.1|2270247_2270796_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.2	2.2e-52
WP_012906378.1|2270800_2271679_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.5e-106
WP_012906379.1|2271730_2272630_-	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	36.9	1.3e-28
WP_012906380.1|2272629_2273715_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	7.2e-103
WP_012906381.1|2274088_2274982_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	43.0	6.6e-46
WP_012906382.1|2275160_2276564_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.3	3.7e-19
>prophage 7
NC_013716	Citrobacter rodentium ICC168, complete genome	5346659	2662479	2794445	5346659	plate,portal,capsid,terminase,holin,head,transposase,tail,tRNA	Salmonella_phage(14.29%)	114	NA	NA
WP_012906703.1|2662479_2663517_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_024132776.1|2663723_2664143_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	39.6	9.8e-16
WP_012906705.1|2664213_2664912_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_012906706.1|2664947_2667608_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_012906707.1|2667721_2669077_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_012904641.1|2669106_2670444_-|transposase	IS4-like element ISCro3 family transposase	transposase	NA	NA	NA	NA
WP_012906708.1|2670561_2670885_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_012906709.1|2670881_2672180_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.6	2.0e-43
WP_012906710.1|2678378_2680952_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	7.6e-127
WP_012906711.1|2681081_2681813_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_012906712.1|2681809_2682790_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_012906713.1|2682922_2683660_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_024132779.1|2683931_2684270_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_187375663.1|2684373_2684421_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_012906715.1|2684519_2685680_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_012906716.1|2685676_2686549_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_012906717.1|2686670_2687927_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012906718.1|2687913_2688168_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_012906719.1|2688164_2689268_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_012906720.1|2689264_2690206_-	4-hydroxyproline epimerase	NA	NA	NA	NA	NA
WP_012906723.1|2690512_2691328_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012906724.1|2691466_2692387_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_012906725.1|2692401_2694033_+	aldehyde dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
WP_012906726.1|2694044_2695646_+	APC family permease	NA	NA	NA	NA	NA
WP_012906727.1|2695690_2696812_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_012906728.1|2696822_2697893_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	1.1e-90
WP_012906729.1|2698270_2698789_+	YfiR family protein	NA	NA	NA	NA	NA
WP_012906730.1|2698781_2700005_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	37.3	1.9e-06
WP_012906731.1|2700025_2700508_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065254.1|2700636_2700984_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_012906733.1|2701833_2702382_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_012134698.1|2702400_2702649_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_012906735.1|2702919_2704281_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_012906736.1|2704446_2705238_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_043013906.1|2705329_2706616_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_012906738.1|2706672_2707266_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_012906739.1|2707388_2708267_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_012906740.1|2708352_2710014_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_012906741.1|2710163_2710508_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_012906742.1|2710631_2710922_-	RnfH family protein	NA	NA	NA	NA	NA
WP_012906743.1|2710911_2711388_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_012906744.1|2711519_2712002_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
WP_012906745.1|2712619_2725570_+	BapA prefix-like domain-containing protein	NA	NA	NA	NA	NA
WP_012906746.1|2725652_2727059_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_012906747.1|2727055_2728822_+	ATP-binding cassette domain-containing protein	NA	F2Y302	Organic_Lake_phycodnavirus	35.6	1.6e-19
WP_012906748.1|2728829_2729993_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012906749.1|2730698_2730944_+	DinI family protein	NA	S5MQI1	Escherichia_phage	57.5	8.5e-20
WP_012906750.1|2731046_2731226_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	72.9	1.3e-17
WP_012906751.1|2731249_2731660_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	53.4	3.2e-35
WP_148222088.1|2731687_2732239_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_012906753.1|2732254_2732833_-|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	60.5	1.6e-61
WP_012906754.1|2732832_2733681_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	82.8	9.1e-37
WP_012906755.1|2733734_2734340_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_012906756.1|2734336_2735494_-|plate	baseplate J/gp47 family protein	plate	R9TN81	Rhizobium_phage	24.9	3.3e-13
WP_012906757.1|2735483_2735936_-	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	48.2	4.3e-17
WP_012906758.1|2735932_2736517_-|plate	phage baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	36.4	1.5e-06
WP_012906759.1|2736513_2737593_-|tail	tail protein	tail	Q8HAC0	Salmonella_phage	31.6	1.2e-41
WP_148222089.1|2737589_2738993_-	DNA circularization protein	NA	M1FPN5	Enterobacteria_phage	25.9	2.5e-23
WP_012906761.1|2739026_2740940_-	lytic transglycosylase domain-containing protein	NA	I6ZXX9	Escherichia_phage	49.3	4.2e-29
WP_012906763.1|2741081_2741360_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_012906764.1|2741362_2741734_-|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_012906765.1|2741737_2743240_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	44.6	4.2e-109
WP_012906766.1|2743236_2743401_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_012906767.1|2743403_2743949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012906768.1|2743945_2744296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012906769.1|2744298_2744604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012906770.1|2744605_2745655_-|capsid	major capsid protein	capsid	Q6UYI3	Burkholderia_phage	28.9	7.9e-30
WP_012906771.1|2745748_2746156_-|head	head decoration protein	head	NA	NA	NA	NA
WP_012906772.1|2746155_2746758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012906773.1|2746759_2747626_-	S49 family peptidase	NA	K4I1N3	Providencia_phage	46.6	4.3e-50
WP_012906774.1|2747625_2749269_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.8	1.0e-92
WP_012906775.1|2749268_2749532_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_043013946.1|2749540_2751496_-|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	47.1	7.5e-143
WP_012906777.1|2751485_2752091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012906778.1|2752261_2752903_-	hypothetical protein	NA	A0A0K1LLF3	Rhodobacter_phage	31.2	5.5e-18
WP_012906779.1|2752913_2753579_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	42.9	6.0e-44
WP_024132786.1|2753568_2754189_-	norphogenetic protein	NA	A0A077SK52	Escherichia_phage	57.2	2.6e-57
WP_012906781.1|2754095_2754698_-	hypothetical protein	NA	B5WZS6	Pseudomonas_phage	47.8	1.3e-42
WP_024132787.1|2755008_2755197_-	hypothetical protein	NA	A0A0P0IKM2	Acinetobacter_phage	75.4	7.2e-19
WP_012906783.1|2755177_2755732_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	47.0	2.9e-07
WP_012906784.1|2755735_2756143_-	hypothetical protein	NA	A0A0E3GMJ2	Enterobacteria_phage	55.4	3.6e-39
WP_012906785.1|2756139_2756472_-|holin	phage holin family protein	holin	A0A0M3ULH4	Salmonella_phage	53.6	4.2e-22
WP_012906786.1|2756649_2757702_-	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	82.3	1.9e-177
WP_012906787.1|2757851_2758043_-	winged helix-turn-helix domain-containing protein	NA	Q8SBE3	Shigella_phage	71.4	1.1e-17
WP_012906788.1|2758241_2758937_-	antitermination protein	NA	NA	NA	NA	NA
WP_012906789.1|2758958_2760026_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	54.3	6.6e-109
WP_012906790.1|2760022_2761750_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	58.7	3.9e-220
WP_012906791.1|2761742_2762624_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	77.9	3.7e-134
WP_012906792.1|2762620_2763493_-	conserved phage C-terminal domain-containing protein	NA	K7PLZ7	Enterobacterial_phage	60.7	1.9e-37
WP_012906793.1|2763489_2763669_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_012906794.1|2763670_2764375_-	phage regulatory protein/antirepressor Ant	NA	A0A2I7R827	Vibrio_phage	58.7	2.3e-57
WP_024132789.1|2764355_2764553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012906795.1|2764549_2765107_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	67.0	7.3e-67
WP_012906796.1|2765099_2765363_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZCZ7	Stx2-converting_phage	52.9	3.6e-16
WP_012906797.1|2765461_2766157_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	69.1	3.5e-87
WP_024132791.1|2767149_2767521_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	93.5	4.8e-59
WP_012906803.1|2767577_2768405_+	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	92.4	9.2e-143
WP_012906804.1|2768543_2769086_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	81.9	1.9e-80
WP_012906805.1|2769070_2769271_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	49.2	8.2e-05
WP_012906806.1|2769267_2769594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012906807.1|2769590_2770322_+	site-specific DNA-methyltransferase	NA	A0A0H5BBV5	Pseudomonas_phage	65.7	2.7e-85
WP_012906810.1|2771125_2771332_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	75.4	4.0e-23
WP_012906811.1|2771292_2772459_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	66.3	1.1e-146
WP_024132794.1|2772516_2774250_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_012906813.1|2774329_2775211_+	DNA adenine methylase	NA	A0A0C5AMX6	Cyanophage	21.8	6.0e-07
WP_000537152.1|2776029_2776314_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081442266.1|2776310_2777165_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.5	5.2e-80
WP_012906815.1|2778995_2788622_+	DUF3491 domain-containing protein	NA	NA	NA	NA	NA
WP_012904571.1|2788991_2790563_-|transposase	IS66-like element ISCro1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	5.4e-168
WP_012904570.1|2790582_2790930_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	3.4e-46
WP_012904569.1|2790929_2791607_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_012904569.1|2791829_2792507_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_012904570.1|2792506_2792854_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	3.4e-46
WP_012904571.1|2792873_2794445_+|transposase	IS66-like element ISCro1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	5.4e-168
>prophage 8
NC_013716	Citrobacter rodentium ICC168, complete genome	5346659	2914926	2993369	5346659	transposase,plate,tRNA	Stx2-converting_phage(35.71%)	64	NA	NA
WP_012906926.1|2914926_2915430_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_012906927.1|2915416_2916214_-	ImpE family T6SS protein Cts1E	NA	NA	NA	NA	NA
WP_012906928.1|2916231_2917095_-	TagK domain-containing protein	NA	NA	NA	NA	NA
WP_024132817.1|2917078_2917342_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_024132818.1|2917402_2919712_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.4	1.6e-35
WP_012906930.1|2919749_2920403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012906931.1|2924257_2925613_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_012906932.1|2925612_2926959_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_148222092.1|2926962_2927523_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_012906934.1|2927580_2928066_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_012906935.1|2928225_2929725_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_012906936.1|2929746_2930265_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_012906937.1|2930355_2930904_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_024132819.1|2930894_2933492_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_012906939.1|2933528_2934284_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_012906940.1|2934369_2934909_-	fimbrial protein	NA	NA	NA	NA	NA
WP_024132820.1|2934993_2937684_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	32.6	7.5e-85
WP_012906942.1|2937986_2939867_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_012906943.1|2939863_2940895_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_012906944.1|2940891_2941962_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012906945.1|2941965_2942952_+	fimbrial protein	NA	NA	NA	NA	NA
WP_012906946.1|2942977_2944324_+	glycosyl transferase	NA	A0A292GJ55	Xanthomonas_phage	38.4	2.5e-68
WP_012906947.1|2944317_2946102_+	OmpA family protein	NA	NA	NA	NA	NA
WP_012906948.1|2946127_2946616_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_012906949.1|2946668_2947391_-	amino acid ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.2	4.3e-11
WP_012906950.1|2947377_2948142_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_012906951.1|2948205_2948973_-	basic amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012906952.1|2949777_2950698_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.3	8.3e-76
WP_012905025.1|2950794_2951970_+|transposase	IS4-like element ISCro2 family transposase	transposase	S5FM71	Shigella_phage	53.1	9.8e-114
WP_010723117.1|2952357_2952429_+	membrane protein YpdK	NA	NA	NA	NA	NA
WP_012906953.1|2952508_2953780_-	alanine transaminase	NA	NA	NA	NA	NA
WP_012906954.1|2954167_2955862_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_012906955.1|2955876_2956611_+	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	26.6	2.5e-14
WP_012906956.1|2956621_2957476_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012906957.1|2957484_2957967_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_024132823.1|2958046_2958586_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_012906959.1|2958853_2959411_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_012906960.1|2959535_2962031_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_012906961.1|2962054_2963095_-	aminopeptidase	NA	NA	NA	NA	NA
WP_012906962.1|2963094_2964177_-	aminopeptidase	NA	NA	NA	NA	NA
WP_012906963.1|2964193_2965441_-	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_012906964.1|2965461_2965788_-	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_012906965.1|2965997_2966963_-	glucokinase	NA	NA	NA	NA	NA
WP_162467718.1|2967013_2967238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012906966.1|2967168_2968404_+	ion channel protein	NA	NA	NA	NA	NA
WP_012906967.1|2968404_2970060_-	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
WP_012906968.1|2970242_2971241_+	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_012906969.1|2971368_2971701_+	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_012906970.1|2971755_2972994_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_012906972.1|2973337_2974540_+	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_012906973.1|2974606_2976814_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_024132824.1|2977773_2978139_+	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_012906975.1|2978144_2978543_+	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_012906976.1|2978600_2980016_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012906977.1|2980895_2982974_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	41.3	1.3e-23
WP_193352056.1|2987399_2987585_+	RHS repeat-associated core domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	56.9	6.0e-10
WP_012904571.1|2987588_2989160_-|transposase	IS66-like element ISCro1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	5.4e-168
WP_012904570.1|2989179_2989527_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	3.4e-46
WP_012904569.1|2989526_2990204_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_193352058.1|2990177_2990441_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_012906979.1|2990475_2991405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012906980.1|2991407_2991908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012904569.1|2992344_2993022_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_012904570.1|2993021_2993369_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	3.4e-46
>prophage 9
NC_013716	Citrobacter rodentium ICC168, complete genome	5346659	3067085	3143526	5346659	integrase,transposase	Salmonella_phage(37.5%)	58	3067054:3067113	3124334:3125391
3067054:3067113	attL	GGCTTTGTTGAATAAATCGAACTTTTGCTGAGTTGAAGGATCAGATCACGCATCCTCCCG	NA	NA	NA	NA
WP_012904651.1|3067085_3068054_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	94.1	2.0e-176
WP_012907039.1|3068951_3070130_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_012907040.1|3070354_3071584_+	transporter	NA	NA	NA	NA	NA
WP_148222094.1|3072344_3072932_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024132831.1|3072970_3073252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012907043.1|3073279_3073552_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_012907044.1|3073672_3074527_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_012907045.1|3074570_3074843_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_012907046.1|3074854_3075085_-	(4Fe-4S)-binding protein	NA	NA	NA	NA	NA
WP_024132832.1|3075672_3076515_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_042623283.1|3076531_3076990_+	membrane protein	NA	NA	NA	NA	NA
WP_152622872.1|3077027_3077507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012907050.1|3077861_3078485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024132834.1|3078650_3078983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012907052.1|3079432_3080038_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	56.0	2.4e-55
WP_012907053.1|3080504_3081101_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	50.0	8.6e-50
WP_012907054.1|3081595_3082144_+	type 1 fimbrial major subunit FimA	NA	NA	NA	NA	NA
WP_012907055.1|3082212_3082752_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_049794260.1|3082781_3083513_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_012907057.1|3083586_3086223_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_012907058.1|3086233_3086761_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_012907059.1|3086773_3087274_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_024132836.1|3087290_3088190_+	fimbrial protein	NA	NA	NA	NA	NA
WP_024132837.1|3088176_3089631_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_012907062.1|3090135_3090729_+	fimbrillin MatB	NA	NA	NA	NA	NA
WP_012907063.1|3090784_3091462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012907064.1|3091525_3094012_+	CS1-pili formation C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012907065.1|3094015_3095632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012907066.1|3095628_3096330_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_024132838.1|3096706_3098137_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_012907068.1|3098203_3098839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012907069.1|3098934_3099291_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_012904651.1|3099332_3100301_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	94.1	2.0e-176
WP_012907070.1|3100388_3100928_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A088CE87	Shigella_phage	28.4	2.0e-13
WP_012907071.1|3101164_3101653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012907072.1|3101625_3102366_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_012907073.1|3102381_3103923_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_012907074.1|3104103_3104610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012907075.1|3104582_3105332_-	membrane protein	NA	NA	NA	NA	NA
WP_012907076.1|3106395_3107157_+	fimbrial chaperone	NA	NA	NA	NA	NA
WP_012907077.1|3107137_3109696_+	fimbrial outer membrane usher protein	NA	NA	NA	NA	NA
WP_012907078.1|3109699_3121216_+	fimbrial usher protein StbD	NA	NA	NA	NA	NA
WP_148222141.1|3122453_3123194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012907083.1|3123198_3123573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024132841.1|3123882_3124344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012904651.1|3124365_3125334_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	94.1	2.0e-176
WP_043013344.1|3125712_3125970_+	hypothetical protein	NA	NA	NA	NA	NA
3124334:3125391	attR	GGCTTTGTTGAATAAATCGAACTTTTGCTGAGTTGAAGGATCAGATCACGCATCCTCCCGACAACACAGACCATTCCGTGGCAAAGCAAAAGTTCAGAATCACCAACTGGTCCACCTACAACAAAGCTCTCATCAACCGTGGCTCCCTCACTTTCTGGCTGGATGATGAGGCGATTCAGGCCTGGTATGAGTCGGCAACACCTTCATCACGAGGAAGGCCCCAGCGCTATTCTGATCTCGCCATCACCACCGTTCTGGTGATTAAACGCGTATTCCGGCTGACCCTGCGGGCTGCGCAGGGTTTTATTGATTCCATTTTTGCCCTGATGAACGTTCCGTTGCGCTGCCCGGATTACACCAGTGTCAGTAAGCGGGCAAAGTCGGTTAATGTCAGTTTCAAAACGTCCACCCGGGGTGAAATCGCACACCTGGTGATTGATTCCACCGGGCTGAAGGTCTTTGGTGAAGGCGAATGGAAAGTCAGAAAGCACGGCAAAGAGCGCCGTCGTATCTGGCGAAAGTTGCATCTTGCTGTTGACAGCAACACACATGAAGTTGTCTGTGCAGACCTGTCGCTGAATAACGTCACGGACTCAGAAGCCTTCCCGGGCCTTATCCGGCAGACTCACAGAAAAATCAGGGCAGCCGCGGCAGACGGGGCTTACGATACCCGGCTCTGTCACGATGAACTGCGCCGCAAAAAAATCAGCGCGCTTATTCCTCCCCGAAAAGGTGCGGGTTACTGGCCCGGTGAATATGCAGACCGTAACCGTGCAGTGGCTAATCAGCGAATGACCGGGAGTAATGCGCGGTGGAAATGGACAACAGATTACAACCGTCGCTCGATAGCGGAAACGGCGATGTACCGGGTAAAACAGCTGTTCGGGGGTTCACTGACGCTGCGTGACTACGATGGTCAGGTTGCGGAGGCTATGGCCCTGGTACGAGCGCTGAACAAAATGACGAAAGCAGGTATGCCTGAAAGCGTGCGTATTGCCTGAAAACACAACCCGCTACGGGGGAGACTTACCCGAAATCTGATTTATTCAACAAAGCCG	NA	NA	NA	NA
WP_012907087.1|3126408_3126609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012907088.1|3126936_3127629_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012907089.1|3127644_3128280_-	N-acyl homoserine lactone synthase CroI	NA	NA	NA	NA	NA
WP_148222095.1|3128652_3128934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012907092.1|3129020_3129791_+	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_024132842.1|3130678_3131137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081442316.1|3131264_3136139_+	GA module-containing protein	NA	NA	NA	NA	NA
WP_012907096.1|3136315_3137812_+	TolC family protein	NA	NA	NA	NA	NA
WP_148222096.1|3137816_3139961_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	25.1	3.8e-23
WP_012907098.1|3140025_3141306_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_081442317.1|3142671_3143526_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.5	5.2e-80
>prophage 10
NC_013716	Citrobacter rodentium ICC168, complete genome	5346659	3558417	3620682	5346659	transposase,plate	Enterobacteria_phage(22.22%)	46	NA	NA
WP_000537152.1|3558417_3558702_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081442266.1|3558698_3559553_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.5	5.2e-80
WP_012907448.1|3559868_3560192_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_012907450.1|3560568_3561441_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_012907451.1|3561841_3565057_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012907452.1|3565069_3565528_+	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	38.8	9.3e-20
WP_042623306.1|3565588_3566185_+	CTP--molybdopterin cytidylyltransferase	NA	NA	NA	NA	NA
WP_081442324.1|3566211_3568359_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	6.3e-26
WP_012907455.1|3568493_3569966_-	purine permease	NA	Q9KX94	Enterobacteria_phage	28.2	6.3e-25
WP_012907456.1|3570457_3572398_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_012907457.1|3572394_3572871_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_012907458.1|3572931_3574260_-	putative aminohydrolase SsnA	NA	NA	NA	NA	NA
WP_012907459.1|3574262_3577367_-	putative selenate reductase subunit YgfK	NA	NA	NA	NA	NA
WP_012907461.1|3577879_3578737_+	XdhC family protein	NA	NA	NA	NA	NA
WP_012907462.1|3578801_3579734_-	carbamate kinase	NA	NA	NA	NA	NA
WP_012907463.1|3579746_3581153_-	dihydropyrimidinase	NA	NA	NA	NA	NA
WP_012907464.1|3581203_3582415_-	YgeY family selenium metabolism-linked hydrolase	NA	NA	NA	NA	NA
WP_012907465.1|3582474_3583674_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_012907466.1|3583734_3584922_-	knotted carbamoyltransferase YgeW	NA	NA	NA	NA	NA
WP_012907467.1|3585405_3587187_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_012907468.1|3587373_3588120_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_012907469.1|3588119_3589010_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_012907470.1|3589020_3589278_-	YjhX family toxin	NA	NA	NA	NA	NA
WP_012907471.1|3589656_3589923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012907472.1|3590039_3590510_+	Hsp20 family protein	NA	A0A218MKI2	uncultured_virus	29.5	2.0e-09
WP_012907473.1|3590564_3590957_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_012907474.1|3590953_3591874_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_012907475.1|3595416_3596163_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_012907476.1|3596146_3597481_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_012907477.1|3597482_3597953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012907478.1|3598319_3598832_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_012907479.1|3598850_3600332_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_012907480.1|3600350_3600836_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_012907481.1|3600835_3601216_+	anti-adapter protein IraD	NA	NA	NA	NA	NA
WP_012907482.1|3601235_3602957_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_012907483.1|3602920_3603856_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_012907484.1|3603846_3606354_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.5	9.2e-77
WP_012907485.1|3606558_3608523_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.7	3.5e-39
WP_024132911.1|3608533_3609055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012907487.1|3609278_3611639_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	24.5	3.9e-29
WP_012907488.1|3611638_3612979_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_012907489.1|3612975_3616218_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_012907490.1|3616330_3617419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024132912.1|3617411_3618254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148222102.1|3618237_3618837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012904571.1|3619110_3620682_-|transposase	IS66-like element ISCro1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	5.4e-168
>prophage 11
NC_013716	Citrobacter rodentium ICC168, complete genome	5346659	3790859	3874867	5346659	integrase,plate,terminase,holin,capsid,portal,head,transposase,tail,tRNA	Enterobacteria_phage(62.3%)	95	3790667:3790691	3881774:3881798
3790667:3790691	attL	CTGATAAGCGTAGCGCCATCAGGCA	NA	NA	NA	NA
WP_012904434.1|3790859_3791840_-|transposase	IS110-like element ISCro4 family transposase	transposase	A0A1S7J231	Thermus_phage	34.0	2.9e-26
WP_012907638.1|3792073_3793375_-	inorganic triphosphatase	NA	NA	NA	NA	NA
WP_012907639.1|3793615_3794230_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_012907640.1|3794295_3795528_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	48.1	2.6e-93
WP_012907641.1|3795650_3797222_-	polysaccharide degrading enzyme	NA	A0A1X9VNM7	Mimivirus	27.4	1.1e-30
WP_012907642.1|3797504_3798326_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_012907643.1|3798425_3798791_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_012907644.1|3798897_3799515_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_012907645.1|3799560_3800496_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012907646.1|3800706_3801618_+	L(+)-tartrate dehydratase subunit alpha	NA	NA	NA	NA	NA
WP_012907647.1|3801614_3802220_+	L(+)-tartrate dehydratase subunit beta	NA	NA	NA	NA	NA
WP_012907648.1|3802268_3803732_+	anion permease	NA	NA	NA	NA	NA
WP_024132942.1|3803941_3804682_+	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_012907650.1|3804692_3804995_+	urease subunit gamma	NA	NA	NA	NA	NA
WP_012907651.1|3805004_3805325_+	urease subunit beta	NA	NA	NA	NA	NA
WP_012907652.1|3805317_3807021_+	urease subunit alpha	NA	NA	NA	NA	NA
WP_012907653.1|3807030_3807489_+	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_012907654.1|3807488_3808163_+	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_012907655.1|3808172_3808790_+	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_012907656.1|3808829_3809843_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	4.5e-107
WP_001144069.1|3810071_3810287_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_012907657.1|3810400_3812149_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.6	5.4e-76
WP_012907658.1|3812299_3814144_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_012907659.1|3814248_3814755_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_024132944.1|3815142_3815544_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.7	2.5e-13
WP_012904569.1|3815580_3816258_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_012904570.1|3816257_3816605_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	3.4e-46
WP_012904571.1|3816624_3818196_+|transposase	IS66-like element ISCro1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	5.4e-168
WP_012907660.1|3819711_3820143_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	36.6	5.9e-16
WP_012907661.1|3820506_3822387_-	RNA-directed DNA polymerase	NA	A0A0U4J920	Pseudomonas_phage	34.6	5.0e-27
WP_012907662.1|3823001_3823532_-	single-stranded DNA-binding protein SSB1	NA	A0A291LCB6	Klebsiella_phage	83.6	4.3e-53
WP_012907663.1|3823785_3826608_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.3	7.8e-311
WP_012907664.1|3826765_3827209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024132945.1|3827192_3827525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012907666.1|3827526_3827874_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_012907667.1|3827876_3828293_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_012907668.1|3828399_3829113_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_012907669.1|3829313_3830507_-	aromatic amino acid transaminase	NA	NA	NA	NA	NA
WP_012907670.1|3830805_3831885_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.3	6.2e-30
WP_012907671.1|3832036_3833452_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.8	4.4e-201
WP_012907672.1|3833516_3834500_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_012907673.1|3834679_3834922_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_012907674.1|3835055_3836093_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_012907676.1|3836785_3837103_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_001504485.1|3838471_3839365_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_012907677.1|3839369_3839702_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_000078910.1|3839966_3840107_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	95.7	1.0e-17
WP_000488107.1|3840297_3840558_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_012907678.1|3840600_3841710_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.0	2.4e-194
WP_012906208.1|3841867_3843052_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.0	5.8e-223
WP_000290462.1|3843051_3843564_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000651572.1|3843619_3843994_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_000333503.1|3844002_3844158_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_012906209.1|3844144_3846952_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	96.6	0.0e+00
WP_000979945.1|3846964_3847453_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000905061.1|3847481_3848081_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_001171270.1|3848185_3849022_+	hypothetical protein	NA	Q7Y4D4	Escherichia_virus	94.6	4.9e-152
WP_012907679.1|3849025_3849553_+|tail	tail fiber assembly protein	tail	A0A0A7NRZ7	Enterobacteria_phage	94.9	2.6e-90
WP_000972170.1|3849581_3850115_-|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	99.4	5.5e-96
WP_012907680.1|3850117_3851971_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	77.3	5.6e-172
WP_012907681.1|3851973_3852504_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.7e-94
WP_012907682.1|3852496_3853393_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	5.7e-154
WP_001067548.1|3853396_3853726_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_174435674.1|3853743_3854310_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	95.7	1.1e-97
WP_000356347.1|3854321_3854957_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	2.4e-114
WP_000920594.1|3854949_3855417_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_012907684.1|3855554_3855962_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	91.1	1.7e-60
WP_012907685.1|3855958_3856504_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	86.2	3.7e-92
WP_012907686.1|3856558_3856882_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	91.6	2.4e-46
WP_000864897.1|3856884_3857085_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_012907687.1|3857084_3857579_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.8	1.0e-88
WP_000632330.1|3857681_3858482_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	88.0	2.4e-124
WP_001055104.1|3858527_3859580_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
WP_012907688.1|3859603_3860440_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.9	8.7e-149
WP_000613783.1|3860594_3862346_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_000087812.1|3862345_3863392_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_024132951.1|3864104_3864602_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_012907691.1|3864692_3865004_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	94.2	1.9e-48
WP_000686539.1|3865008_3865968_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	5.8e-181
WP_012907692.1|3866044_3868867_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.9	0.0e+00
WP_000599402.1|3868873_3869239_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	95.9	1.9e-60
WP_012907693.1|3869235_3869853_-	ash family protein	NA	S5MQL6	Escherichia_phage	47.8	3.1e-10
WP_000769444.1|3869862_3870414_-	hypothetical protein	NA	A0A2I7QQL0	Vibrio_phage	36.8	2.7e-05
WP_000104288.1|3870428_3870728_-	ead/Ea22-like family protein	NA	A0A0A7NRX6	Enterobacteria_phage	96.0	2.1e-44
WP_000153674.1|3870724_3870970_-	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
WP_000985716.1|3870966_3871170_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	94.0	1.3e-29
WP_000543041.1|3871193_3871604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021656.1|3871697_3871811_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	2.5e-11
WP_000514277.1|3871807_3872050_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159450.1|3872061_3872349_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.9	6.0e-33
WP_000813104.1|3872359_3872710_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	79.3	8.9e-47
WP_000203260.1|3872829_3873036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004248.1|3873042_3873330_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	53.7	6.7e-24
WP_000581442.1|3873445_3873766_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	46.2	9.1e-14
WP_000023399.1|3873862_3874867_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	55.0	1.1e-97
3881774:3881798	attR	CTGATAAGCGTAGCGCCATCAGGCA	NA	NA	NA	NA
>prophage 12
NC_013716	Citrobacter rodentium ICC168, complete genome	5346659	4943271	5039140	5346659	plate,holin,head,transposase,tail,protease	Shigella_phage(53.49%)	89	NA	NA
WP_012908575.1|4943271_4944132_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	3.0e-51
WP_012908576.1|4944294_4945068_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.1	2.9e-21
WP_012908577.1|4946047_4946602_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001575658.1|4946778_4947009_+	helix-turn-helix domain-containing protein	NA	A0A0C4UQU0	Shigella_phage	40.8	1.8e-08
WP_012908578.1|4947011_4949099_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	46.9	2.6e-165
WP_012908579.1|4949174_4950107_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	49.0	1.4e-70
WP_012908580.1|4950109_4950331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012908581.1|4950343_4950763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001536811.1|4950749_4950980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012908582.1|4951054_4951330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012908583.1|4951334_4951628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012908584.1|4951639_4952170_+	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	56.6	2.5e-48
WP_012908585.1|4952254_4952833_+	DUF5420 family protein	NA	NA	NA	NA	NA
WP_012908586.1|4952836_4953370_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	68.9	7.4e-69
WP_012908587.1|4953369_4953885_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	53.0	2.1e-44
WP_012908588.1|4953888_4954440_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_012908589.1|4954436_4954769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012908591.1|4954906_4955194_+	hypothetical protein	NA	A0A0C4UQY6	Shigella_phage	48.9	1.3e-16
WP_012908592.1|4955174_4955414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012908593.1|4955484_4955997_+	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	46.9	2.0e-26
WP_012904641.1|4956102_4957440_+|transposase	IS4-like element ISCro3 family transposase	transposase	NA	NA	NA	NA
WP_000852372.1|4957508_4957931_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_012908594.1|4958002_4958503_+	lysozyme	NA	A0A2H4J3P8	uncultured_Caudovirales_phage	42.0	5.0e-27
WP_148222122.1|4958537_4958966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024133070.1|4958949_4959168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342741.1|4959178_4959406_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_012908596.1|4959386_4959698_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279080.1|4959690_4959981_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	2.1e-25
WP_000360581.1|4959983_4960565_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_012908597.1|4960564_4962229_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.0	3.4e-229
WP_012908598.1|4962228_4963818_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.8	1.1e-168
WP_012908599.1|4963801_4965133_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	63.0	2.3e-167
WP_012908600.1|4965254_4965728_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	54.6	6.0e-38
WP_012908601.1|4965904_4967029_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.6	1.7e-78
WP_012908603.1|4967028_4967976_+|head	Mu-like prophage major head subunit gpT family protein	head	A0A0C4UQR9	Shigella_phage	67.2	7.1e-123
WP_012908604.1|4968019_4968439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104960.1|4968435_4968855_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	54.3	6.1e-34
WP_012908605.1|4968851_4969415_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.1	2.8e-42
WP_000207438.1|4969418_4969697_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_012908606.1|4969696_4971178_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0C4UQS0	Shigella_phage	53.1	2.0e-135
WP_012908607.1|4971186_4971552_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_012908608.1|4971566_4972046_+|tail	phage tail assembly protein	tail	A0A0C4UR03	Shigella_phage	49.2	2.3e-21
WP_012908609.1|4972173_4974231_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	38.7	3.2e-75
WP_012908610.1|4974217_4975576_+	DNA circularization protein	NA	A0A0C4UR32	Shigella_phage	30.3	3.4e-49
WP_012908611.1|4975559_4976687_+|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.0	4.4e-95
WP_073520730.1|4976676_4977291_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	50.8	1.2e-51
WP_012908613.1|4977283_4977721_+	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	58.3	3.1e-41
WP_001146843.1|4977720_4978803_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_012908614.1|4978793_4979354_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	49.1	6.0e-45
WP_012908615.1|4979353_4980244_+	hypothetical protein	NA	C9DGQ8	Escherichia_phage	43.4	1.3e-30
WP_012908616.1|4980295_4980817_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	48.0	3.6e-44
WP_012908617.1|4981278_4981851_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	76.9	1.7e-74
WP_012908618.1|4981936_4983988_+	hypothetical protein	NA	S5MDQ7	Escherichia_phage	63.3	1.6e-228
WP_012908619.1|4984122_4984305_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	59.6	1.2e-10
WP_012908620.1|4984340_4984598_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_012908622.1|4985211_4985412_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_012908623.1|4985365_4986103_+	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	79.5	3.4e-104
WP_012908624.1|4986725_4988099_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_012908625.1|4988103_4988388_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_012908626.1|4988417_4988882_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_012908627.1|4988896_4990168_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_012908628.1|4990219_4991074_-	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_012908629.1|4991254_4992826_-	galactarate dehydratase	NA	NA	NA	NA	NA
WP_012908630.1|4993338_4994109_+	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_012908631.1|4994139_4995030_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_012908632.1|4995130_4996276_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	3.7e-49
WP_012908633.1|4997294_4998458_+	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_024133074.1|4998491_5000987_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	31.3	6.8e-88
WP_012908635.1|5001695_5002634_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_012908636.1|5002732_5003722_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_012908637.1|5003756_5005088_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_012908638.1|5005119_5006328_+	propionate kinase	NA	NA	NA	NA	NA
WP_012908639.1|5006359_5008654_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.0e-156
WP_012908640.1|5008741_5010106_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_024133075.1|5010417_5011749_+	HAAAP family serine/threonine permease	NA	NA	NA	NA	NA
WP_012908642.1|5011770_5013081_+	serine dehydratase subunit alpha family protein	NA	NA	NA	NA	NA
WP_167321447.1|5013159_5013321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012908644.1|5013340_5014042_-	pirin family protein	NA	NA	NA	NA	NA
WP_012908645.1|5014146_5015043_+	DNA-binding transcriptional regulator YhaJ	NA	NA	NA	NA	NA
WP_012908646.1|5015093_5015453_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_012908647.1|5015676_5016042_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_012904571.1|5017160_5018732_-|transposase	IS66-like element ISCro1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	5.4e-168
WP_012904570.1|5018751_5019099_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	3.4e-46
WP_012904569.1|5019098_5019776_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_012908649.1|5020203_5030295_-	DUF3491 domain-containing protein	NA	NA	NA	NA	NA
WP_012908650.1|5032099_5035480_-	DUF4765 family protein	NA	A0A0N7KZG3	Stx2-converting_phage	75.3	0.0e+00
WP_024133082.1|5037834_5038227_-	DoxX family protein	NA	NA	NA	NA	NA
WP_012908653.1|5038461_5038746_-	YqjK-like family protein	NA	NA	NA	NA	NA
WP_012908654.1|5038735_5039140_-|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 1
NC_013717	Citrobacter rodentium ICC168 plasmid pCROD1, complete sequence	54449	45874	54449	54449	transposase	Stx2-converting_phage(37.5%)	11	NA	NA
WP_012908941.1|45874_46504_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	28.7	8.1e-06
WP_012908943.1|47599_48241_+	ParA family protein	NA	A4JWV7	Burkholderia_virus	25.5	2.8e-06
WP_012908944.1|48332_48665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148222157.1|49279_49984_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	2.1e-23
WP_012904571.1|50081_51653_-|transposase	IS66-like element ISCro1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	5.4e-168
WP_012904570.1|51672_52020_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	3.4e-46
WP_012904569.1|52019_52697_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_042623357.1|52751_53165_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	40.6	2.4e-19
WP_024133143.1|53210_53420_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_012908946.1|53457_54144_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_012908947.1|54140_54449_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	39.0	4.3e-13
