The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_013282	Cronobacter turicensis z3032 complete genome	4384463	1202986	1279317	4384463	head,holin,integrase,plate,terminase	Cronobacter_phage(41.67%)	97	1204094:1204140	1250927:1250973
WP_007706347.1|1202986_1203853_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.7	3.8e-30
1204094:1204140	attL	CTTCTAAGCCGTGGGTCGCAGGTTCGAGTCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_012815617.1|1204153_1205317_-|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	86.9	1.2e-199
WP_081469637.1|1205172_1205598_-	helix-turn-helix domain-containing protein	NA	F1C5B3	Cronobacter_phage	81.7	1.2e-45
WP_012815618.1|1205575_1206202_-	hypothetical protein	NA	A0A220NQT7	Salmonella_phage	64.7	4.2e-79
WP_012815619.1|1206235_1206490_-	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	42.9	1.1e-09
WP_012815620.1|1206544_1206919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012815621.1|1206915_1207128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012815622.1|1207127_1207448_-	hypothetical protein	NA	A0A077KAZ4	Edwardsiella_phage	78.4	4.1e-38
WP_012815623.1|1207440_1207950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012815624.1|1207946_1208150_-	hypothetical protein	NA	R9TRD3	Aeromonas_phage	76.9	3.4e-22
WP_012815625.1|1208146_1208680_-	hypothetical protein	NA	F1C5B6	Cronobacter_phage	68.8	1.4e-51
WP_041923290.1|1208676_1209528_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	54.5	8.2e-86
WP_012815627.1|1209524_1209680_-	DUF2737 family protein	NA	Q9MCR2	Enterobacteria_phage	54.9	3.0e-07
WP_012815628.1|1209712_1209907_-	hypothetical protein	NA	A0A2H4IYD2	uncultured_Caudovirales_phage	62.3	5.7e-11
WP_012815629.1|1209912_1210395_-	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	68.1	2.2e-56
WP_012815630.1|1210378_1211284_-	DNA recombinase	NA	K7PKG9	Enterobacteria_phage	80.4	2.3e-134
WP_012815631.1|1211283_1211592_-	hypothetical protein	NA	F1C5B9	Cronobacter_phage	90.2	4.8e-44
WP_012815632.1|1211683_1211830_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	67.4	7.3e-11
WP_012815633.1|1212159_1212417_-	hypothetical protein	NA	S4TW48	Salmonella_phage	42.4	4.6e-08
WP_012815634.1|1212482_1212695_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_012815636.1|1212901_1213129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012815637.1|1213138_1213480_-	hypothetical protein	NA	F1C5C1	Cronobacter_phage	77.3	3.8e-34
WP_071820272.1|1213476_1214079_-	hypothetical protein	NA	M4Q138	Vibrio_phage	39.5	2.2e-24
WP_012815642.1|1215146_1215374_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	55.4	7.1e-13
WP_012815643.1|1215486_1215768_+	hypothetical protein	NA	K7PJN1	Enterobacteria_phage	80.4	1.5e-36
WP_012815644.1|1215941_1216838_+	replication protein	NA	A0A075B8J2	Enterobacteria_phage	86.2	3.2e-64
WP_012815645.1|1216837_1218175_+	DNA helicase	NA	A0A2I7S0U1	Vibrio_phage	36.3	3.2e-76
WP_012815646.1|1218200_1218506_+	hypothetical protein	NA	Q5G8S7	Enterobacteria_phage	69.2	1.9e-32
WP_012815647.1|1218508_1218751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012815650.1|1219716_1220202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012815652.1|1220334_1220607_+	hypothetical protein	NA	A0A220NQX3	Salmonella_phage	58.0	3.6e-19
WP_012815653.1|1220606_1220855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012815654.1|1220826_1221237_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	88.1	9.4e-64
WP_041923291.1|1221233_1221413_+	NinE family protein	NA	A0A220NRK6	Escherichia_phage	62.1	2.1e-12
WP_012815655.1|1221405_1221588_+	hypothetical protein	NA	A0A0M4S6T3	Salmonella_phage	70.0	2.4e-19
WP_032968661.1|1221565_1221847_+	hypothetical protein	NA	A0A0M3ULJ7	Salmonella_phage	98.9	9.3e-47
WP_012815657.1|1221843_1222239_+	RusA family crossover junction endodeoxyribonuclease	NA	F1C5C9	Cronobacter_phage	96.9	8.5e-70
WP_012815658.1|1222235_1222898_+	HNH endonuclease	NA	A0A2I7QND8	Vibrio_phage	47.0	3.7e-41
WP_012815659.1|1222894_1223086_+	protein ninH	NA	A0A1R3Y5V4	Salmonella_virus	57.1	4.0e-09
WP_012815660.1|1223082_1223262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012815661.1|1223258_1224023_+	antitermination protein	NA	G0ZNC6	Cronobacter_phage	98.4	6.1e-133
WP_012815662.1|1224851_1225172_+|holin	holin	holin	F1C5D1	Cronobacter_phage	100.0	3.7e-55
WP_012815663.1|1225164_1225791_+	glycoside hydrolase family 19 protein	NA	F1C5D2	Cronobacter_phage	95.7	7.5e-113
WP_012815664.1|1225787_1226201_+	DUF2570 domain-containing protein	NA	F1C5D3	Cronobacter_phage	96.4	3.4e-53
WP_012815665.1|1226649_1227351_+	hypothetical protein	NA	Q5MBW0	Stx1-converting_phage	84.1	5.1e-102
WP_012815666.1|1227350_1227557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012815667.1|1227626_1227842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041923292.1|1227902_1228103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012815670.1|1228542_1229772_+|terminase	terminase	terminase	I6RSK1	Salmonella_phage	90.7	1.0e-198
WP_041923293.1|1229783_1231241_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	95.9	5.6e-260
WP_012815672.1|1231194_1232175_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	93.5	5.1e-156
WP_012815673.1|1232209_1232428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041923295.1|1232498_1233692_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	74.5	1.2e-162
WP_012125625.1|1233697_1234126_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	98.6	2.2e-71
WP_041923296.1|1234138_1235224_+	hypothetical protein	NA	F1C5E1	Cronobacter_phage	93.4	7.5e-193
WP_012815676.1|1235233_1235431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007847582.1|1235433_1235814_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	100.0	1.9e-63
WP_012815677.1|1235881_1236232_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	67.8	9.6e-41
WP_012815678.1|1236233_1236602_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	98.4	2.2e-59
WP_041923297.1|1236598_1236982_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	81.9	2.7e-57
WP_012815680.1|1237047_1237542_+	hypothetical protein	NA	G0ZNE6	Cronobacter_phage	92.4	1.3e-80
WP_041923298.1|1237581_1239033_+	glycosyltransferase	NA	F1C5E6	Cronobacter_phage	94.2	2.9e-277
WP_041923299.1|1239014_1239608_+	hypothetical protein	NA	F1C5E7	Cronobacter_phage	93.9	6.3e-109
WP_012815683.1|1239589_1240321_+	hypothetical protein	NA	F1C5E8	Cronobacter_phage	95.6	1.9e-123
WP_012815684.1|1240369_1240651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012815685.1|1240692_1243194_+	hypothetical protein	NA	A0A173GC04	Salmonella_phage	40.0	1.7e-102
WP_012815686.1|1243193_1243676_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	50.0	9.1e-42
WP_012815687.1|1243659_1244130_+	hypothetical protein	NA	A0A173GC55	Salmonella_phage	40.4	5.6e-28
WP_012815688.1|1244129_1244522_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	60.3	1.3e-41
WP_041923300.1|1244508_1247016_+	hypothetical protein	NA	F1C5A7	Cronobacter_phage	47.9	4.8e-211
WP_012815691.1|1249615_1250752_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	27.4	7.0e-24
WP_012815692.1|1251278_1251812_-	hypothetical protein	NA	NA	NA	NA	NA
1250927:1250973	attR	CTTCTAAGCCGTGGGTCGCAGGTTCGAGTCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_041923301.1|1252244_1252721_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	41.0	4.1e-18
WP_041923302.1|1252888_1253617_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.0	1.8e-20
WP_041923303.1|1253715_1254099_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041924127.1|1254195_1254675_+	RES domain-containing protein	NA	NA	NA	NA	NA
WP_041923304.1|1254679_1255033_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_041923305.1|1255102_1256296_-	MFS transporter	NA	NA	NA	NA	NA
WP_041923306.1|1256503_1256809_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041923307.1|1256810_1257344_+	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_012815701.1|1257458_1257944_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_041923308.1|1257936_1259547_-	OmpA family protein	NA	NA	NA	NA	NA
WP_012815703.1|1259547_1260150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012815704.1|1260143_1261484_-	glycosyl transferase	NA	A0A292GJ55	Xanthomonas_phage	35.3	4.8e-72
WP_012815705.1|1261495_1262491_-	fimbrial protein	NA	NA	NA	NA	NA
WP_012815706.1|1262495_1263539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049787139.1|1263592_1264621_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_012815708.1|1264620_1266501_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_041924129.1|1267066_1269748_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	31.9	2.5e-88
WP_012815710.1|1269821_1270352_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_012815711.1|1270442_1271201_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_012815712.1|1271294_1273898_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_012815713.1|1273897_1274479_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_041923309.1|1275127_1276624_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_007791657.1|1276783_1277269_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_081469666.1|1277408_1277984_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_012815716.1|1277970_1279317_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 2
NC_013282	Cronobacter turicensis z3032 complete genome	4384463	1805599	1874448	4384463	tRNA,tail,protease,capsid,head,holin,portal,lysis,integrase,terminase	Cronobacter_phage(31.11%)	81	1808998:1809014	1865545:1865561
WP_015740882.1|1805599_1806709_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_015740883.1|1806902_1808852_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
1808998:1809014	attL	GGCGCAGCAGGAGTGCA	NA	NA	NA	NA
WP_041923452.1|1809120_1809570_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_007769570.1|1809580_1810237_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_015740885.1|1810352_1811603_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	3.0e-20
WP_015740886.1|1812077_1812266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015740887.1|1812670_1813819_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	59.8	1.5e-119
WP_071820287.1|1813799_1814045_-	excisionase	NA	NA	NA	NA	NA
WP_015740888.1|1814055_1814247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015740889.1|1814243_1814636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081469643.1|1814733_1814973_-	hypothetical protein	NA	U5P4J6	Shigella_phage	75.0	4.7e-07
WP_041924145.1|1815014_1815710_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	73.5	1.3e-89
WP_015740891.1|1815807_1816065_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	81.7	7.5e-27
WP_015740892.1|1816095_1816632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015740893.1|1816825_1816993_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_015740894.1|1816989_1817886_+	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	61.7	1.8e-38
WP_015740895.1|1817882_1818119_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_015740896.1|1818118_1819297_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	82.4	1.7e-105
WP_015740897.1|1819293_1819629_+	LexA family transcriptional regulator	NA	U5P451	Shigella_phage	51.0	2.0e-19
WP_015740898.1|1819723_1820062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041924146.1|1820281_1820665_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	77.2	2.9e-51
WP_015740900.1|1820680_1821406_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	54.4	7.5e-56
WP_041923453.1|1821402_1822389_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	60.7	5.9e-120
WP_015740902.1|1822407_1823238_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	43.5	8.6e-56
WP_015740904.1|1823451_1824177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015740905.1|1824299_1824680_+	membrane protein	NA	F1C592	Cronobacter_phage	80.2	9.4e-50
WP_015740906.1|1824666_1824951_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	51.1	1.6e-17
WP_041923454.1|1824947_1825571_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	89.9	4.9e-104
WP_015740908.1|1825570_1826035_+|lysis	lysis protein	lysis	F1C590	Cronobacter_phage	55.8	4.4e-33
WP_015740910.1|1826212_1826524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015740911.1|1827284_1827878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041923455.1|1828001_1828355_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	82.3	1.4e-52
WP_015740913.1|1828418_1828760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015740914.1|1828893_1829367_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	89.8	2.0e-78
WP_015740915.1|1829366_1831124_+|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	91.6	0.0e+00
WP_015740916.1|1831123_1832428_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	87.6	2.7e-221
WP_015740917.1|1832436_1833291_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	72.5	9.6e-111
WP_015740918.1|1833304_1834525_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	92.1	8.1e-204
WP_015740919.1|1834576_1834762_+	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	63.6	1.7e-12
WP_015740920.1|1834771_1835098_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	50.0	1.2e-26
WP_015740921.1|1835094_1835436_+|head	phage head closure protein	head	A0A1J0GUY4	Halomonas_phage	42.5	1.3e-05
WP_015740922.1|1835432_1835882_+	HK97 gp10 family phage protein	NA	A0A220NRP5	Escherichia_phage	83.2	7.9e-64
WP_015740923.1|1835878_1836208_+	DUF3168 domain-containing protein	NA	A0A1P8DTJ3	Proteus_phage	52.7	5.5e-22
WP_007760125.1|1836254_1836710_+	hypothetical protein	NA	A0A1W6JP06	Morganella_phage	74.3	4.0e-55
WP_015740924.1|1836758_1837154_+|tail	phage tail protein	tail	F1C576	Cronobacter_phage	87.8	3.0e-59
WP_007760133.1|1837177_1837447_+	DUF4035 domain-containing protein	NA	K7PLY6	Enterobacterial_phage	62.1	3.1e-23
WP_015740926.1|1837594_1837915_+	hypothetical protein	NA	M1PRT9	Cellulophaga_phage	69.8	2.7e-34
WP_015740927.1|1837998_1841271_+|tail	phage tail tape measure protein	tail	F1C575	Cronobacter_phage	87.7	0.0e+00
WP_015740928.1|1841317_1841656_+|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	60.7	3.1e-36
WP_015740929.1|1841662_1842415_+|tail	phage minor tail protein L	tail	F1C574	Cronobacter_phage	98.4	9.9e-144
WP_015740930.1|1842417_1843122_+	C40 family peptidase	NA	F1C573	Cronobacter_phage	96.2	6.9e-139
WP_015740931.1|1843118_1843715_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	84.6	1.7e-85
WP_041923456.1|1843764_1846926_+	host specificity protein J	NA	F1C571	Cronobacter_phage	98.3	0.0e+00
WP_015740933.1|1847308_1847872_+	hypothetical protein	NA	F1C570	Cronobacter_phage	55.9	9.9e-56
WP_041923458.1|1847909_1849361_+|tail	tail fiber domain-containing protein	tail	F1C569	Cronobacter_phage	81.2	9.0e-218
WP_014728470.1|1849502_1849940_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	100.0	9.4e-78
WP_015740936.1|1849923_1851186_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	96.2	4.7e-239
WP_081469644.1|1851293_1851455_-	arsenate reductase	NA	NA	NA	NA	NA
WP_041923459.1|1851763_1852960_+	hypothetical protein	NA	A0A1L2BY82	Clostridium_phage	34.4	1.8e-54
WP_041923460.1|1853459_1854029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015740939.1|1854647_1854839_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	88.9	2.3e-20
WP_015740940.1|1855237_1856077_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015740941.1|1856176_1857073_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_015740943.1|1857781_1858180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049787174.1|1858427_1858895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015740946.1|1859574_1860309_+	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_015740947.1|1860522_1861407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041923464.1|1862065_1863604_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_015740949.1|1864424_1864898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071820290.1|1864965_1865643_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
1865545:1865561	attR	GGCGCAGCAGGAGTGCA	NA	NA	NA	NA
WP_007760255.1|1866162_1866375_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	75.7	4.9e-24
WP_015740951.1|1866358_1866583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004385763.1|1866719_1866956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007760259.1|1867502_1868471_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.7	1.5e-30
WP_081469668.1|1869074_1869935_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_007760268.1|1870452_1870758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015740956.1|1870754_1871111_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_041923467.1|1871318_1872026_+	CTP synthase	NA	NA	NA	NA	NA
WP_015740958.1|1872027_1873212_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_007760274.1|1873287_1873734_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_015740959.1|1873923_1874448_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
>prophage 3
NC_013282	Cronobacter turicensis z3032 complete genome	4384463	1921888	1932089	4384463	tRNA	Tupanvirus(28.57%)	11	NA	NA
WP_007760428.1|1921888_1923817_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	4.5e-132
WP_015741001.1|1923820_1924363_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.3	1.4e-14
WP_001124225.1|1924460_1924658_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_007760430.1|1924705_1925062_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_007760431.1|1925450_1926434_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.7	1.4e-33
WP_015741002.1|1926449_1928837_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	27.1	2.1e-06
WP_007676383.1|1928841_1929141_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_041923474.1|1929218_1930220_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_015741004.1|1930249_1930801_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_015741005.1|1930800_1931547_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.5	4.9e-10
WP_007760440.1|1931624_1932089_+	endopeptidase	NA	S5MM68	Bacillus_phage	36.0	6.1e-11
>prophage 4
NC_013282	Cronobacter turicensis z3032 complete genome	4384463	2778814	2787824	4384463		Burkholderia_phage(33.33%)	10	NA	NA
WP_041923705.1|2778814_2780485_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.6	2.3e-23
WP_007769259.1|2780686_2780869_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_041923706.1|2780958_2781873_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_015741722.1|2782051_2782963_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_041923707.1|2782966_2783464_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	49.0	2.7e-33
WP_081469649.1|2783447_2784881_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.8	2.2e-99
WP_041923709.1|2784941_2785640_-	phosphohydrolase	NA	S4W232	Pandoravirus	26.3	9.6e-08
WP_015741726.1|2785853_2786180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041923710.1|2786305_2787430_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	54.9	1.4e-104
WP_081469650.1|2787539_2787824_+	DinI family protein	NA	K7PKM2	Enterobacterial_phage	86.1	2.3e-32
>prophage 5
NC_013282	Cronobacter turicensis z3032 complete genome	4384463	3309242	3406697	4384463	tRNA,tail,capsid,head,portal,lysis,integrase,plate,terminase	Salmonella_phage(22.0%)	89	3373859:3373905	3407484:3407530
WP_041923830.1|3309242_3309980_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_015742145.1|3310108_3311443_+	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	29.7	1.4e-44
WP_007763323.1|3311518_3311902_-	autonomous glycyl radical cofactor GrcA	NA	A0A1W5N098	Cronobacter_phage	69.9	8.0e-33
WP_041923831.1|3312208_3312898_+	uracil-DNA glycosylase	NA	A0A1R3T3N6	Sphenicid_alphaherpesvirus	50.0	3.2e-56
WP_041923832.1|3312954_3314022_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_041923833.1|3314231_3314663_+	thioredoxin TrxC	NA	V9SJ74	Achromobacter_phage	36.7	4.2e-14
WP_041923834.1|3314732_3315434_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_041923835.1|3315467_3318128_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_041923836.1|3318240_3319596_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_015742152.1|3319649_3319973_+	YfiM family lipoprotein	NA	B5AX59	Iodobacteriophage	39.0	1.6e-05
WP_041923837.1|3319969_3321271_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.6	5.3e-44
WP_041924195.1|3321389_3321845_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	48.3	2.1e-32
WP_007763352.1|3322003_3323800_+	thiamine pyrophosphate-requiring protein	NA	NA	NA	NA	NA
WP_041923838.1|3323840_3324308_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071820351.1|3330043_3330229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015742157.1|3330346_3332920_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	7.6e-127
WP_041923839.1|3333049_3333778_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_041923840.1|3333774_3334755_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_007763376.1|3334884_3335622_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_041923841.1|3335674_3336880_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_015742162.1|3337234_3337579_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_015742163.1|3337828_3338989_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_041923842.1|3339020_3339899_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_015742165.1|3339965_3341087_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_041923843.1|3341097_3342168_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0B6VT43	Edwardsiella_phage	51.2	4.0e-90
WP_015742167.1|3342366_3343734_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_015742168.1|3343787_3344228_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_006178051.1|3344392_3344740_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_007700948.1|3344785_3345559_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_032805623.1|3345589_3346138_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_007763399.1|3346156_3346405_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_015742170.1|3346663_3348025_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_007763416.1|3348187_3348979_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_041923844.1|3348997_3350287_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_041923845.1|3350344_3350938_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_071601017.1|3350902_3351046_+	inorganic polyphosphate kinase	NA	NA	NA	NA	NA
WP_007700972.1|3351060_3351939_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_041923846.1|3352025_3353687_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_015742176.1|3353904_3354249_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_015742177.1|3354354_3354645_-	RnfH family protein	NA	NA	NA	NA	NA
WP_007763442.1|3354634_3355072_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_007700985.1|3355220_3355703_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	48.1	1.4e-29
WP_015742178.1|3355952_3357122_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_015742179.1|3357131_3359267_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	29.1	2.2e-26
WP_081469655.1|3360727_3372739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071820312.1|3372990_3373188_+	hypothetical protein	NA	NA	NA	NA	NA
3373859:3373905	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
WP_071601018.1|3374025_3374244_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	78.9	2.3e-29
WP_015742185.1|3374343_3374757_+	hypothetical protein	NA	S4TTB4	Salmonella_phage	49.6	3.4e-29
WP_015742186.1|3374815_3375967_-	phage late control D family protein	NA	S4TRX8	Salmonella_phage	76.3	1.8e-160
WP_015742187.1|3375966_3376449_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	68.2	3.1e-58
WP_015742188.1|3376461_3378939_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	56.6	1.6e-219
WP_071601019.1|3378931_3379087_-|tail	GpE family phage tail protein	tail	Q7Y4C9	Escherichia_virus	72.5	1.4e-15
WP_015742189.1|3379083_3379365_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	79.1	2.6e-28
WP_015742190.1|3379425_3379947_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	82.0	9.5e-77
WP_015742191.1|3379960_3381148_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	85.2	5.7e-194
WP_015742193.1|3381551_3382253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015742194.1|3382581_3383184_-|tail	tail assembly protein	tail	A0A218M4J2	Erwinia_phage	49.7	4.2e-52
WP_015742195.1|3383183_3384497_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	56.3	9.2e-145
WP_015742196.1|3384493_3385105_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	79.1	4.8e-88
WP_015742197.1|3385097_3386006_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	79.8	1.8e-131
WP_015742198.1|3386011_3386359_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	74.6	1.1e-41
WP_015742199.1|3386355_3386991_-|plate	phage baseplate assembly protein V	plate	S4TUB5	Salmonella_phage	70.2	4.2e-79
WP_049787157.1|3387077_3388172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015742201.1|3388189_3388645_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	66.4	8.0e-48
WP_015742202.1|3388637_3389105_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	75.5	3.7e-64
WP_041923848.1|3389067_3389226_-	hypothetical protein	NA	A0A218M4L1	Erwinia_phage	75.0	3.4e-14
WP_015742203.1|3389200_3389626_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0M4R2N5	Salmonella_phage	72.3	2.4e-22
WP_041923849.1|3389622_3390132_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	75.7	9.3e-69
WP_041923850.1|3390115_3390337_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	53.4	1.8e-13
WP_015742206.1|3390327_3390531_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	85.1	4.5e-27
WP_015742207.1|3390530_3391025_-|head	head completion/stabilization protein	head	M1SNN6	Escherichia_phage	76.7	8.4e-59
WP_015742208.1|3391120_3391867_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	78.5	1.2e-96
WP_015742209.1|3391870_3392959_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	81.0	6.0e-166
WP_041923851.1|3393011_3393689_-	hypothetical protein	NA	Q94MB7	Escherichia_virus	64.8	5.5e-93
WP_015742211.1|3393855_3395628_+|terminase	terminase ATPase subunit family protein	terminase	A0A0M4RE51	Salmonella_phage	86.2	1.2e-304
WP_041923852.1|3395624_3396644_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	79.9	2.2e-162
WP_015742213.1|3396691_3397258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015742214.1|3397250_3398669_-	ATP-binding protein	NA	A0A2I7RNF1	Vibrio_phage	30.1	6.0e-41
WP_015742215.1|3398987_3399251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015742216.1|3399458_3399650_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	77.4	1.9e-19
WP_015742218.1|3402045_3403056_-	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	45.2	1.5e-70
WP_015742219.1|3403052_3403277_-	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	73.0	1.8e-24
WP_015742220.1|3403276_3403510_-	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	58.4	5.4e-16
WP_041923853.1|3403580_3403955_-	hypothetical protein	NA	F1BUS4	Erwinia_phage	46.5	3.9e-24
WP_015742222.1|3403951_3404143_-	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	62.9	7.1e-14
WP_015742223.1|3404151_3404661_-	phage regulatory CII family protein	NA	A0A218M4I4	Erwinia_phage	65.7	1.1e-58
WP_071601023.1|3404696_3404936_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	82.3	3.0e-30
WP_041923854.1|3405052_3405676_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	68.6	6.6e-77
WP_015742225.1|3405677_3406697_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.5	1.1e-188
3407484:3407530	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
>prophage 6
NC_013282	Cronobacter turicensis z3032 complete genome	4384463	3567427	3580307	4384463	plate	Salmonella_phage(61.11%)	19	NA	NA
WP_015742364.1|3567427_3568111_-	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	64.4	6.5e-25
WP_015742365.1|3568110_3568776_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	68.2	1.8e-88
WP_041923891.1|3568772_3569972_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	64.6	8.1e-140
WP_015742367.1|3569971_3570325_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	75.2	2.6e-46
WP_015742368.1|3570321_3571077_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	63.7	1.8e-84
WP_015742369.1|3571149_3572136_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	45.7	5.4e-81
WP_015742370.1|3572132_3572435_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	49.0	7.7e-23
WP_015742371.1|3572435_3572999_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	54.1	9.3e-46
WP_049787159.1|3572998_3574690_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	32.7	3.1e-60
WP_015742373.1|3574689_3574857_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	59.6	5.4e-10
WP_015742374.1|3574868_3575288_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	56.3	1.4e-33
WP_015742375.1|3575291_3575732_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	70.5	1.5e-51
WP_015742376.1|3575741_3577223_-	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	51.0	1.3e-131
WP_015742377.1|3577227_3577761_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	42.5	1.0e-25
WP_081469657.1|3577757_3578018_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	59.3	2.5e-06
WP_015742379.1|3578210_3578699_-	lysozyme	NA	G0ZNC8	Cronobacter_phage	63.5	4.4e-52
WP_015742380.1|3578679_3578988_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	57.4	6.3e-20
WP_015742381.1|3579026_3579227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041923892.1|3579626_3580307_+	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	46.7	3.3e-45
