The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_011147	Salmonella enterica subsp. enterica serovar Paratyphi A str. AKU_12601, complete genome	4581797	537110	543141	4581797		Salmonella_virus(50.0%)	6	NA	NA
WP_106417237.1|537110_537257_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	73.9	1.1e-14
WP_106417236.1|537272_537416_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	87.8	9.0e-14
WP_000400612.1|538405_540328_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.5	1.9e-300
WP_000703599.1|540344_540599_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_001682026.1|540567_540957_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	91.5	6.9e-56
WP_000377775.1|542199_543141_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	87.5	2.7e-146
>prophage 2
NC_011147	Salmonella enterica subsp. enterica serovar Paratyphi A str. AKU_12601, complete genome	4581797	772308	781479	4581797	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569167.1|772308_773256_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824856.1|773239_773971_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|773951_774059_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|774118_774850_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272855.1|775072_776758_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	88.9	3.7e-279
WP_000598637.1|776754_777474_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|777520_777988_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001265354.1|778044_778575_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703141.1|778746_779205_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	71.9	2.4e-52
WP_000195335.1|779445_781479_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 3
NC_011147	Salmonella enterica subsp. enterica serovar Paratyphi A str. AKU_12601, complete genome	4581797	860007	867663	4581797		Enterobacteria_phage(50.0%)	8	NA	NA
WP_000697846.1|860007_861093_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023655.1|861092_861992_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	4.7e-31
WP_000857533.1|862039_862918_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.2	6.0e-108
WP_000973711.1|862918_863470_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
WP_000018223.1|863475_864450_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648782.1|864465_865239_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565907.1|865243_866323_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.7e-16
WP_000126347.1|866349_867663_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 4
NC_011147	Salmonella enterica subsp. enterica serovar Paratyphi A str. AKU_12601, complete genome	4581797	951393	958620	4581797		Morganella_phage(33.33%)	7	NA	NA
WP_000394197.1|951393_951813_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457650.1|951815_953084_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.7	1.3e-225
WP_000208509.1|953529_953742_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|953752_953941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080667.1|954201_955380_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.7	2.3e-107
WP_000377044.1|956420_957116_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.5	2.8e-07
WP_001157323.1|957189_958620_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 5
NC_011147	Salmonella enterica subsp. enterica serovar Paratyphi A str. AKU_12601, complete genome	4581797	1662098	1670291	4581797		Escherichia_phage(42.86%)	8	NA	NA
WP_000497451.1|1662098_1662338_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_011233072.1|1663211_1664021_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.4	4.2e-63
WP_001277616.1|1664093_1664471_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_000158843.1|1664618_1665161_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
WP_011233073.1|1665352_1666081_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.9	4.1e-62
WP_011233074.1|1666097_1666511_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
WP_000915986.1|1667457_1668582_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_000444503.1|1669040_1670291_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
>prophage 6
NC_011147	Salmonella enterica subsp. enterica serovar Paratyphi A str. AKU_12601, complete genome	4581797	1920712	1930242	4581797	integrase,protease	Ralstonia_phage(16.67%)	8	1915502:1915516	1928978:1928992
1915502:1915516	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_011233091.1|1920712_1921090_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	2.6e-20
WP_001117984.1|1921251_1921449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274276.1|1922849_1923380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|1923878_1926155_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|1926185_1926506_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|1926829_1927051_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125879.1|1927180_1929127_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
1928978:1928992	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
WP_001201759.1|1929123_1930242_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
>prophage 7
NC_011147	Salmonella enterica subsp. enterica serovar Paratyphi A str. AKU_12601, complete genome	4581797	2482315	2527024	4581797	holin,coat,terminase,portal,integrase,protease,lysis	Salmonella_phage(51.52%)	67	2513105:2513118	2524400:2524413
WP_000915523.1|2482315_2482678_+	GtrA family protein	NA	I1TED9	Salmonella_phage	100.0	3.9e-61
WP_000703606.1|2482674_2483607_+	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	99.7	1.2e-175
WP_000671498.1|2483596_2485054_+	glucosyltransferase domain-containing protein	NA	E7C9N7	Salmonella_phage	99.2	1.4e-239
WP_000129927.1|2485112_2487116_-	endorhamnosidase	NA	Q76H47	Enterobacteria_phage	99.9	0.0e+00
WP_000532177.1|2487251_2487500_+	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
WP_071533035.1|2487520_2487814_-	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	3.2e-50
WP_000868979.1|2487952_2489884_-	hypothetical protein	NA	I1TEJ6	Salmonella_phage	99.1	0.0e+00
WP_000190212.1|2489883_2491254_-	phage DNA ejection protein	NA	A0A1R3Y5Q4	Salmonella_virus	99.3	1.6e-248
WP_000964851.1|2491263_2491953_-	hypothetical protein	NA	I1TEJ4	Salmonella_phage	100.0	2.9e-81
WP_000627703.1|2491955_2492411_-	DUF2824 family protein	NA	E7C9U3	Salmonella_phage	100.0	1.8e-87
WP_000774919.1|2492410_2493049_-	hypothetical protein	NA	A8CGD2	Salmonella_phage	100.0	6.3e-91
WP_001122416.1|2493052_2494471_-	packaged DNA stabilization protein gp10	NA	A0A220NQZ5	Salmonella_phage	99.8	2.4e-276
WP_001166094.1|2494430_2494931_-	packaged DNA stabilization protein p27	NA	E7C9U0	Salmonella_phage	98.8	1.2e-89
WP_000538674.1|2494914_2495475_-	hypothetical protein	NA	E7C9T9	Salmonella_phage	100.0	1.3e-103
WP_001196936.1|2495515_2496808_-|coat	coat protein	coat	A0A075B8L2	Enterobacteria_phage	99.8	2.5e-243
WP_000433852.1|2496807_2497719_-	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_000774658.1|2497732_2499910_-|portal	portal protein p19	portal	I6R968	Salmonella_phage	98.6	0.0e+00
WP_000417866.1|2499909_2501409_-|terminase	terminase	terminase	A0A2H4FUR5	Salmonella_phage	100.0	4.8e-307
WP_000729925.1|2501386_2501875_-	hypothetical protein	NA	O80290	Bacteriophage	100.0	2.9e-88
WP_012532521.1|2501878_2502283_-	hypothetical protein	NA	A0A192Y6U9	Salmonella_phage	99.3	1.5e-66
WP_000808100.1|2502285_2502528_-	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	100.0	1.0e-33
WP_001028469.1|2502851_2503373_-	KilA-N domain-containing protein	NA	H6WRZ8	Salmonella_phage	100.0	1.9e-101
WP_011233123.1|2503585_2504035_-|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	87.8	3.0e-63
WP_001167374.1|2504052_2504490_-	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.9	6.3e-74
WP_000738703.1|2504473_2504800_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
WP_001235452.1|2505234_2505858_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	87.0	8.3e-96
WP_000994515.1|2505854_2506043_-	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
WP_001046347.1|2506039_2506402_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	98.3	7.8e-62
WP_000002244.1|2506398_2506689_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	100.0	1.0e-51
WP_001286918.1|2506681_2506894_-	hypothetical protein	NA	K7PK10	Enterobacteria_phage	98.6	4.7e-35
WP_000950962.1|2506886_2507063_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
WP_011233124.1|2507055_2507397_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	99.1	5.1e-63
WP_000113770.1|2507399_2507576_-	NinE family protein	NA	Q76H73	Enterobacteria_phage	100.0	1.0e-27
WP_000679702.1|2507542_2507716_-	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_000811302.1|2507712_2508159_-	recombination protein NinB	NA	I6R0N7	Salmonella_phage	98.6	7.8e-80
WP_000049340.1|2508115_2508412_-	hypothetical protein	NA	E7C9R7	Salmonella_phage	99.0	6.8e-48
WP_000344579.1|2508414_2508735_-	hypothetical protein	NA	I6R992	Salmonella_phage	59.4	1.1e-22
WP_000975822.1|2508746_2508902_-	hypothetical protein	NA	A0A2H4FWM4	Salmonella_phage	100.0	2.4e-20
WP_000248682.1|2508913_2509120_-	hypothetical protein	NA	I6RSI5	Salmonella_phage	100.0	1.1e-31
WP_000131495.1|2509195_2510632_-	AAA family ATPase	NA	A0A220NQX0	Salmonella_phage	99.2	3.0e-274
WP_000065656.1|2510621_2511521_-	hypothetical protein	NA	E7C9R4	Salmonella_phage	98.7	2.5e-154
WP_001125982.1|2511513_2511660_-	DUF2740 family protein	NA	A0A0M4S617	Salmonella_phage	100.0	1.9e-19
WP_001103491.1|2511694_2511976_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	98.9	1.6e-43
WP_000182204.1|2512086_2512302_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_000712403.1|2512412_2513102_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
2513105:2513118	attL	AGCCAATGGCCTGA	NA	NA	NA	NA
WP_000680395.1|2513459_2513705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786965.1|2513743_2513953_-	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	92.8	1.9e-28
WP_000216028.1|2514316_2514619_+	hypothetical protein	NA	B8K1E6	Salmonella_phage	97.0	8.2e-49
WP_001066166.1|2514631_2515219_-	super-infection exclusion protein B	NA	A0A0M4R594	Salmonella_phage	98.5	1.4e-84
WP_000213983.1|2515432_2515627_+	hypothetical protein	NA	A0A075B8G0	Enterobacteria_phage	100.0	2.5e-30
WP_000542409.1|2515663_2515957_+	hypothetical protein	NA	B8K1E3	Salmonella_phage	95.7	4.1e-45
WP_001200114.1|2516271_2516424_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	B8K1E2	Salmonella_phage	98.0	9.2e-25
WP_000156730.1|2516404_2516593_+	DUF5444 family protein	NA	A0A1R3Y5S5	Salmonella_virus	100.0	1.6e-31
WP_000902088.1|2516582_2516726_+	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	97.9	2.7e-18
WP_001046982.1|2516722_2517430_+	hypothetical protein	NA	A0A1R3Y600	Salmonella_virus	99.6	1.5e-138
WP_001111312.1|2517760_2518054_+	DUF2856 family protein	NA	A0A1R3Y5T7	Salmonella_virus	100.0	3.2e-50
WP_001214769.1|2518064_2518235_+	DUF2737 family protein	NA	I6S642	Salmonella_phage	94.6	5.7e-23
WP_000665851.1|2518231_2518891_+	hypothetical protein	NA	A0A1R3Y5S0	Salmonella_virus	61.6	2.2e-62
WP_001017879.1|2518887_2519388_+	ead/Ea22-like family protein	NA	A0A1R3Y5T1	Salmonella_virus	62.6	1.0e-64
WP_000582227.1|2519387_2520143_+	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	99.2	5.5e-150
WP_000208071.1|2520153_2521239_+	DUF550 domain-containing protein	NA	A0A1R3Y5Q8	Salmonella_virus	76.7	2.0e-153
WP_000002128.1|2521231_2521516_+	ASCH domain-containing protein	NA	A0A1R3Y5R3	Salmonella_virus	100.0	4.1e-50
WP_157804913.1|2521584_2521725_+	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	95.7	7.2e-16
WP_000051901.1|2521954_2523118_+|integrase	site-specific integrase	integrase	A0A220NQU7	Salmonella_phage	99.7	4.1e-229
WP_000893229.1|2523323_2524574_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.0e-97
2524400:2524413	attR	TCAGGCCATTGGCT	NA	NA	NA	NA
WP_001285277.1|2524585_2525689_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	9.0e-61
WP_001043666.1|2525971_2527024_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.3e-112
>prophage 8
NC_011147	Salmonella enterica subsp. enterica serovar Paratyphi A str. AKU_12601, complete genome	4581797	2595458	2722310	4581797	capsid,holin,terminase,tail,tRNA,head,portal,plate,integrase,lysis	Salmonella_phage(51.85%)	128	2657600:2657648	2723410:2723458
WP_000108009.1|2595458_2595953_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000371505.1|2595968_2597852_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000145239.1|2597848_2598844_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000367632.1|2598854_2599898_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_001670675.1|2600428_2601160_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	6.4e-39
WP_000917872.1|2601223_2601691_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	4.7e-51
WP_000801242.1|2601687_2602410_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052769.1|2602444_2603200_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644706.1|2603271_2604639_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	33.0	1.4e-10
WP_000207237.1|2604694_2605465_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230970.1|2605542_2606343_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_001127560.1|2606474_2607650_-	MFS transporter	NA	NA	NA	NA	NA
WP_000648518.1|2607754_2608669_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000154860.1|2608690_2609494_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	34.6	5.1e-37
WP_001235092.1|2615496_2618070_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
WP_000992634.1|2618199_2618931_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079130.1|2618927_2619908_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197660.1|2620039_2620777_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|2621048_2621387_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010989056.1|2621490_2621538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200087.1|2621637_2622798_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000210975.1|2622758_2623667_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225183.1|2623724_2624846_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|2624855_2625926_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212373.1|2626365_2626884_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030993.1|2626876_2628097_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	37.0	1.7e-07
WP_000065257.1|2628253_2628601_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469802.1|2628641_2629409_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|2629453_2630002_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|2630020_2630269_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460060.1|2630520_2631882_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|2632047_2632839_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127908301.1|2632858_2634145_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000271804.1|2634274_2634880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|2634920_2635511_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059155.1|2635633_2636512_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|2636597_2638259_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203433.1|2638407_2638746_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|2638911_2639202_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242604.1|2639191_2639668_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|2639816_2640299_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237661.1|2640917_2652392_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533854.1|2652456_2653866_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196156.1|2653862_2656043_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_000342601.1|2656050_2657214_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
2657600:2657648	attL	GAGGATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCA	NA	NA	NA	NA
WP_001039750.1|2657743_2658121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001775272.1|2658207_2658426_-	ogr/Delta-like zinc finger family protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
WP_001011749.1|2658493_2659594_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	91.8	3.0e-189
WP_000980405.1|2659590_2660076_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
WP_161976233.1|2660075_2662622_-|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	42.7	1.2e-113
WP_000763315.1|2662848_2662968_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	94.9	1.2e-14
WP_001280965.1|2662982_2663285_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
WP_001207653.1|2663339_2663855_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
WP_000046101.1|2663864_2665037_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
WP_000388790.1|2665139_2665358_-	Hin recombinase	NA	A0A1S6L009	Salmonella_phage	90.3	1.4e-29
WP_000161709.1|2665571_2666294_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000006337.1|2666491_2666899_-|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
WP_001274654.1|2666905_2668525_-|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	91.2	3.2e-155
WP_001086800.1|2668521_2669127_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	99.0	1.3e-117
WP_000268328.1|2669119_2670028_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	99.7	3.5e-159
WP_000177408.1|2670014_2670374_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
WP_000993747.1|2670370_2670949_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	99.0	1.1e-107
WP_000343944.1|2671017_2671464_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
WP_001039961.1|2671456_2671888_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
WP_024131238.1|2671983_2672412_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	97.9	3.3e-67
WP_000731034.1|2672408_2672786_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
WP_001069889.1|2672790_2673300_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.6	1.2e-92
WP_000171565.1|2673280_2673496_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_000868184.1|2673499_2673703_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000673540.1|2673702_2674167_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
WP_000059175.1|2674260_2674911_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
WP_000730751.1|2674914_2675979_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
WP_000216272.1|2675995_2676829_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
WP_001098454.1|2676971_2678738_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	96.3	0.0e+00
WP_011233140.1|2678737_2679781_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.0	1.2e-174
WP_000080839.1|2679829_2680525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000789325.1|2680544_2681609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000829584.1|2681605_2682670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835188.1|2682679_2682898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217561.1|2682993_2683227_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	2.2e-33
WP_001154438.1|2683238_2683427_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	96.8	7.9e-26
WP_000301196.1|2683594_2685997_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	95.5	0.0e+00
WP_000104130.1|2685987_2686848_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
WP_001090717.1|2686844_2687429_-	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
WP_000785510.1|2687425_2687653_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
WP_001244240.1|2687652_2687886_-	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
WP_000963479.1|2687953_2688295_-	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
WP_000956167.1|2688258_2688459_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
WP_000460852.1|2688466_2688976_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
WP_000102106.1|2689008_2689251_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
WP_000052560.1|2689367_2690000_+	helix-turn-helix domain-containing protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
WP_000027757.1|2690003_2691029_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
WP_001177838.1|2691272_2691521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000136561.1|2693145_2694264_-	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_000977532.1|2694943_2696647_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	80.9	9.2e-222
WP_000200793.1|2696646_2697192_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.5	1.9e-59
WP_000267952.1|2697163_2697889_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.8	2.3e-68
WP_000421117.1|2697878_2698406_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	3.1e-51
WP_000084304.1|2698423_2700451_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	47.9	1.2e-154
WP_001001826.1|2700460_2701048_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	2.4e-89
WP_000136924.1|2701040_2702225_-|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	77.6	2.8e-177
WP_001002797.1|2702221_2702551_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000811085.1|2702547_2704518_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.1	5.6e-271
WP_000411339.1|2704705_2704963_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_000376372.1|2705109_2705442_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	2.6e-35
WP_000175560.1|2705441_2705783_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_001154425.1|2705779_2706073_-|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000166742.1|2706082_2706538_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	71.5	2.1e-56
WP_000220202.1|2706534_2707662_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.5	5.6e-175
WP_000560074.1|2707658_2708366_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	75.2	6.3e-100
WP_000084220.1|2708362_2708869_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
WP_001680743.1|2708865_2709318_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	1.6e-64
WP_001218536.1|2709414_2710116_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	67.2	3.2e-88
WP_000550496.1|2710119_2711142_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_000018798.1|2711203_2712004_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	54.8	3.2e-76
WP_001151947.1|2712164_2713940_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	82.6	7.0e-289
WP_000038210.1|2713936_2714998_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	76.8	6.7e-162
WP_001552031.1|2714994_2715318_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000960960.1|2715291_2715510_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	49.1	2.8e-06
WP_001137729.1|2715622_2717374_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	75.0	2.2e-255
WP_016504913.1|2717500_2717644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011233149.1|2717684_2718497_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	84.3	8.8e-122
WP_000057334.1|2718487_2718718_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000022786.1|2718785_2719187_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000643374.1|2719601_2719829_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_023211710.1|2719838_2720342_-	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	72.5	4.5e-60
WP_000687097.1|2720724_2721297_+	phage repressor protein CI	NA	F1BUN8	Cronobacter_phage	53.8	1.7e-58
WP_012532529.1|2721296_2722310_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUN9	Cronobacter_phage	85.1	2.5e-174
2723410:2723458	attR	GAGGATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCA	NA	NA	NA	NA
>prophage 9
NC_011147	Salmonella enterica subsp. enterica serovar Paratyphi A str. AKU_12601, complete genome	4581797	4455030	4465704	4581797	integrase	Enterobacteria_phage(60.0%)	13	4451451:4451467	4460119:4460135
4451451:4451467	attL	GCCCGCGATGATAAAAA	NA	NA	NA	NA
WP_000152556.1|4455030_4456050_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	7.9e-43
WP_000772671.1|4456520_4457780_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.2	4.8e-74
WP_000970946.1|4457833_4458829_-	site-specific DNA-methyltransferase	NA	S0A236	Cellulophaga_phage	24.2	3.5e-19
WP_010376679.1|4458884_4459121_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000667328.1|4459117_4459681_+	type II restriction endonuclease PvuII	NA	A0A1B0UXL9	Roseobacter_phage	42.9	7.2e-30
WP_000210078.1|4459900_4460467_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	7.7e-56
4460119:4460135	attR	TTTTTATCATCGCGGGC	NA	NA	NA	NA
WP_000984211.1|4460483_4460729_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
WP_000198637.1|4460725_4461463_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.9	3.4e-80
WP_000556591.1|4462000_4462267_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	1.7e-29
WP_000980371.1|4462263_4462815_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	60.9	2.0e-24
WP_001216601.1|4462811_4463039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000743148.1|4463035_4463356_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783718.1|4463370_4465704_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	84.1	0.0e+00
