The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_013199	Lactobacillus rhamnosus Lc 705, complete genome	2968598	682104	711183	2968598	tail,head,integrase,terminase,portal,transposase,capsid	uncultured_Caudovirales_phage(25.0%)	29	672753:672767	706066:706080
672753:672767	attL	TGCCAACAAAGCCGT	NA	NA	NA	NA
WP_015764265.1|682104_683217_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_005691887.1|683517_684495_-	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	38.3	5.2e-52
WP_005691889.1|684525_686724_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_005691892.1|686710_687118_-	GtrA family protein	NA	NA	NA	NA	NA
WP_014571175.1|687837_688533_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.9	5.9e-34
WP_005684087.1|688529_689822_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_005684085.1|689964_690345_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_005691897.1|690626_691286_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_005691899.1|691325_692432_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_014571176.1|692704_695572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014571177.1|696263_697835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015764274.1|698243_699395_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	34.4	9.1e-56
WP_080515408.1|699454_700033_-	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	41.5	2.2e-05
WP_015764276.1|700157_700367_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015764277.1|700378_700654_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003604800.1|700733_701129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015764280.1|701478_701751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015764281.1|701747_701936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041247953.1|701919_702747_+	bifunctional DNA primase/polymerase	NA	Q854C1	Mycobacterium_phage	32.5	1.2e-12
WP_015764283.1|702739_704164_+	virulence protein	NA	A0A1W6JQD6	Staphylococcus_phage	37.8	1.7e-64
WP_015764284.1|704443_704866_+	hypothetical protein	NA	A0A2H4JHE6	uncultured_Caudovirales_phage	40.2	1.5e-11
WP_172619743.1|704947_705322_+	HNH endonuclease	NA	D2JLE2	Staphylococcus_phage	39.8	3.8e-11
WP_003593553.1|705446_705917_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_005716050.1|705913_707617_+|terminase	terminase	terminase	E9LUI0	Lactobacillus_phage	40.2	6.0e-120
706066:706080	attR	TGCCAACAAAGCCGT	NA	NA	NA	NA
WP_005690490.1|707582_707762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015764286.1|707766_708951_+|portal	phage portal protein	portal	A0A2H4JB06	uncultured_Caudovirales_phage	35.2	1.1e-59
WP_015764287.1|708937_710509_+|capsid	phage major capsid protein	capsid	A0A2H4J9X8	uncultured_Caudovirales_phage	34.8	2.7e-34
WP_003586097.1|710567_710858_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_013245616.1|710841_711183_+|head	phage head closure protein	head	I7AUE6	Enterococcus_phage	38.4	1.2e-08
>prophage 2
NC_013199	Lactobacillus rhamnosus Lc 705, complete genome	2968598	843136	920646	2968598	tail,head,integrase,terminase,tRNA,protease,portal,holin,capsid	Lactobacillus_phage(86.0%)	88	842574:842601	896124:896151
842574:842601	attL	GCGTGATGGCCGGTCTTTGGCCATTGCG	NA	NA	NA	NA
WP_015764314.1|843136_844264_-|integrase	site-specific integrase	integrase	B4XYR4	Lactobacillus_phage	97.6	2.4e-210
WP_015764315.1|844371_844635_-	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	40.2	1.9e-09
WP_015764316.1|844732_844990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005714764.1|845224_846406_-	restriction endonuclease subunit S	NA	E3T4D5	Cafeteria_roenbergensis_virus	25.5	2.0e-18
WP_005712700.1|846496_846715_-	S24 family peptidase	NA	NA	NA	NA	NA
WP_050751723.1|846786_847407_-	helix-turn-helix transcriptional regulator	NA	O64370	Lactobacillus_phage	65.4	5.1e-69
WP_015764318.1|847618_847861_+	helix-turn-helix transcriptional regulator	NA	B8R673	Lactobacillus_phage	56.1	7.6e-13
WP_015764319.1|847884_848589_+	phage antirepressor KilAC domain-containing protein	NA	B4XYR8	Lactobacillus_phage	88.7	9.1e-115
WP_015764320.1|848589_848850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015764321.1|848842_849148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015764322.1|849222_849579_+	DUF771 domain-containing protein	NA	U5U4L9	Lactobacillus_phage	91.5	1.5e-57
WP_015764324.1|849718_849937_+	hypothetical protein	NA	A0A0P0I7L5	Lactobacillus_phage	96.7	1.3e-08
WP_005716154.1|849938_850109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015764325.1|850120_850996_+	recombinase RecT	NA	A0A1X9I5N6	Streptococcus_phage	52.2	4.4e-58
WP_005711350.1|851015_851780_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	53.6	2.6e-75
WP_015764327.1|851795_852752_+	DnaD domain protein	NA	A0A1B0Y2R2	Lactobacillus_phage	91.8	2.8e-127
WP_015764328.1|852764_853250_+	single-stranded DNA-binding protein	NA	U5U726	Lactobacillus_phage	87.0	8.0e-62
WP_015764329.1|853558_853774_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IJY1	Lactobacillus_phage	67.1	1.3e-19
WP_015764330.1|853770_853962_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015764331.1|854331_854781_+	hypothetical protein	NA	A0A0P0ID70	Lactobacillus_phage	87.9	2.7e-64
WP_015764332.1|854827_855082_+	hypothetical protein	NA	A8YQM4	Lactobacillus_phage	95.2	1.2e-37
WP_015978893.1|855078_855492_+	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	100.0	5.9e-74
WP_015764333.1|855504_855969_+	hypothetical protein	NA	A0A0P0IXF6	Lactobacillus_phage	98.0	7.2e-20
WP_015764334.1|856350_856761_+	hypothetical protein	NA	Q6J1U9	Lactobacillus_phage	80.9	6.8e-62
WP_015764335.1|856757_857198_+	hypothetical protein	NA	C1KFF0	Lactobacillus_virus	42.6	2.2e-26
WP_015764337.1|857392_857725_+	hypothetical protein	NA	A0A2D1GPA2	Lactobacillus_phage	67.9	5.0e-31
WP_014569479.1|857721_857961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015764338.1|857957_858350_+	hypothetical protein	NA	B4XYT8	Lactobacillus_phage	96.9	2.5e-66
WP_015992527.1|858782_859211_+	DUF1492 domain-containing protein	NA	B4XYT9	Lactobacillus_phage	100.0	1.3e-76
WP_015764340.1|859675_860341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015764341.1|860983_862201_+	hypothetical protein	NA	A0A2D1GPQ9	Lactobacillus_phage	97.3	1.8e-235
WP_015764342.1|862187_862718_+	HNH endonuclease	NA	A0A0P0IX70	Lactobacillus_phage	61.5	7.2e-56
WP_015764343.1|862820_863144_+	hypothetical protein	NA	Q8LT99	Lactobacillus_phage	91.6	1.1e-48
WP_015764344.1|863161_863326_+	hypothetical protein	NA	A8YQN6	Lactobacillus_phage	100.0	6.7e-05
WP_015764345.1|863362_864157_+	HNH endonuclease	NA	B4XYU4	Lactobacillus_phage	95.8	6.6e-146
WP_005686963.1|864357_864813_+|terminase	P27 family phage terminase small subunit	terminase	B4XYP1	Lactobacillus_phage	98.0	6.7e-79
WP_015764346.1|864834_866547_+|terminase	terminase large subunit	terminase	B4XYP2	Lactobacillus_phage	97.4	0.0e+00
WP_003661399.1|866558_866750_+	hypothetical protein	NA	A0A2D1GPE7	Lactobacillus_phage	100.0	3.0e-28
WP_015764347.1|866755_868009_+|portal	phage portal protein	portal	Q8LTC2	Lactobacillus_phage	95.7	1.5e-229
WP_015764348.1|867962_868592_+|head,protease	HK97 family phage prohead protease	head,protease	B4XYP5	Lactobacillus_phage	100.0	3.3e-116
WP_015764349.1|868633_869836_+|capsid	phage major capsid protein	capsid	B4XYP6	Lactobacillus_phage	95.7	9.8e-210
WP_005712764.1|869853_870093_+	Ig-like domain-containing protein	NA	A0A2D1GPN4	Lactobacillus_phage	97.5	1.6e-31
WP_015764350.1|870103_870463_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5U4K5	Lactobacillus_phage	97.5	1.2e-59
WP_041247957.1|870452_870782_+|head,tail	head-tail adaptor protein	head,tail	P94213	Lactobacillus_phage	97.2	1.5e-56
WP_015764352.1|870781_871168_+	HK97 gp10 family phage protein	NA	B4XYP9	Lactobacillus_phage	98.4	5.0e-67
WP_015764353.1|871167_871554_+	hypothetical protein	NA	U5U3W4	Lactobacillus_phage	96.9	7.0e-69
WP_015764354.1|871587_872205_+|tail	phage-related major tail protein	tail	U5U3Z7	Lactobacillus_phage	97.5	3.8e-109
WP_003661382.1|872304_872718_+	hypothetical protein	NA	A0A2D1GPL7	Lactobacillus_phage	100.0	6.4e-52
WP_015764355.1|872840_877706_+|tail	phage tail tape measure protein	tail	Q9T0X1	Lactobacillus_phage	92.5	0.0e+00
WP_015764356.1|877706_879629_+|tail	phage tail family protein	tail	B4XYQ4	Lactobacillus_phage	81.6	1.5e-305
WP_015764357.1|879628_882130_+|tail	phage tail protein	tail	B4XYQ5	Lactobacillus_phage	74.0	0.0e+00
WP_015764358.1|882126_882414_+	hypothetical protein	NA	Q3L0S1	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	48.9	4.2e-18
WP_014569500.1|882567_882861_+	hypothetical protein	NA	B4XYQ7	Lactobacillus_phage	94.8	5.3e-45
WP_015764360.1|882850_883264_+|holin	phage holin	holin	A0A0N7IR91	Lactobacillus_phage	94.2	1.6e-42
WP_015764361.1|883274_884459_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0P0HRN9	Lactobacillus_phage	88.3	9.6e-202
WP_005688600.1|885177_885831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005713641.1|886009_887194_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	66.0	1.1e-141
WP_005688606.1|887723_889217_+	MFS transporter	NA	NA	NA	NA	NA
WP_005688608.1|889392_889863_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005687221.1|890084_891563_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_005688612.1|891559_892285_+	DUF4811 domain-containing protein	NA	NA	NA	NA	NA
WP_005688613.1|892349_893021_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_005687226.1|893441_895853_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	69.1	0.0e+00
WP_005688618.1|898021_898732_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
896124:896151	attR	GCGTGATGGCCGGTCTTTGGCCATTGCG	NA	NA	NA	NA
WP_005688621.1|898817_899033_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_005688624.1|899163_899994_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_005687236.1|899990_900491_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_005688627.1|900887_901361_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_015764365.1|901467_902676_+	putative C-S lyase	NA	NA	NA	NA	NA
WP_015764366.1|902803_904132_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_005687240.1|904347_904614_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_005688634.1|904768_906112_+	PFL family protein	NA	NA	NA	NA	NA
WP_014571209.1|906278_907346_+	competence protein	NA	NA	NA	NA	NA
WP_005687248.1|907586_908222_-	DsbA family protein	NA	NA	NA	NA	NA
WP_005688639.1|908291_908885_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_005713649.1|909051_909729_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_005687253.1|909730_910528_+	NAD kinase	NA	NA	NA	NA	NA
WP_005688644.1|910527_911430_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_005688645.1|911573_912632_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_005688646.1|912849_913488_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_005688647.1|913507_914326_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_005688649.1|914530_915571_-	lactonase family protein	NA	NA	NA	NA	NA
WP_005688651.1|915814_916189_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_003564153.1|916238_916508_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_005713651.1|916622_917612_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	71.6	1.1e-137
WP_005688657.1|918807_919650_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_072137696.1|919916_920135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005688659.1|920136_920646_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
>prophage 3
NC_013199	Lactobacillus rhamnosus Lc 705, complete genome	2968598	1009674	1064425	2968598	tail,head,integrase,terminase,tRNA,portal,capsid	Lactobacillus_phage(17.65%)	55	1003378:1003393	1058883:1058898
1003378:1003393	attL	AGCACAACGCCGGATG	NA	NA	NA	NA
WP_005688741.1|1009674_1010139_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_005688742.1|1010344_1011241_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.5	4.5e-18
WP_005688746.1|1012681_1013224_-	exonuclease	NA	A0A1S5SFA9	Streptococcus_phage	41.0	8.2e-23
WP_014571235.1|1013235_1013994_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	48.1	6.2e-61
WP_014571236.1|1014519_1015383_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_005688750.1|1015419_1017534_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_005684568.1|1017756_1018296_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005688752.1|1018309_1019398_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	46.0	1.4e-37
WP_005684570.1|1019491_1020316_+	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	26.7	8.9e-13
WP_005684571.1|1020305_1021139_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005684572.1|1021122_1022196_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005688758.1|1022405_1022978_-	DUF5067 domain-containing protein	NA	Q6SEF8	Lactobacillus_prophage	48.1	2.1e-29
WP_005688760.1|1023005_1023371_-	hypothetical protein	NA	A0A0P0I7G8	Lactobacillus_phage	77.8	3.9e-45
WP_005688762.1|1023692_1023884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005688764.1|1024076_1026869_-	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	29.3	1.5e-72
WP_005688766.1|1026944_1027625_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015764389.1|1027658_1028798_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005688770.1|1028787_1029522_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.2	1.4e-25
WP_005684581.1|1029781_1030639_+	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_005688772.1|1030635_1031733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005688773.1|1031761_1033126_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_014571238.1|1033554_1035366_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1I9J5	Paramecium_bursaria_Chlorella_virus	37.2	2.0e-89
WP_015764390.1|1035515_1037321_-	M3 family oligoendopeptidase	NA	NA	NA	NA	NA
WP_005716007.1|1037394_1037886_+	VanZ family protein	NA	NA	NA	NA	NA
WP_005684587.1|1037956_1038688_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005688784.1|1039165_1040119_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005684590.1|1040121_1040442_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_005688785.1|1040438_1040861_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_005688787.1|1040830_1041142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014569400.1|1041101_1041569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005688791.1|1041565_1041889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015764392.1|1042293_1043307_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_005688795.1|1043575_1044031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005684599.1|1044245_1045610_+	amino acid permease	NA	NA	NA	NA	NA
WP_005688798.1|1045641_1046406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014571241.1|1046402_1047242_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_005688802.1|1047242_1048199_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_005688804.1|1048195_1049068_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_014571243.1|1049291_1051586_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_005716031.1|1052251_1053400_-|integrase	site-specific integrase	integrase	A0A097BYJ7	Leuconostoc_phage	28.9	1.0e-30
WP_005716033.1|1053493_1054147_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015764393.1|1054275_1054554_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015764394.1|1054621_1055017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064559732.1|1055121_1055319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015764397.1|1055366_1055636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021354504.1|1055619_1056447_+	bifunctional DNA primase/polymerase	NA	Q854C1	Mycobacterium_phage	32.9	1.2e-12
WP_015764399.1|1056439_1057864_+	virulence protein	NA	A0A1W6JQD6	Staphylococcus_phage	38.1	1.3e-64
WP_013245609.1|1058138_1058480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171032397.1|1058562_1058937_+	HNH endonuclease	NA	D2JLE2	Staphylococcus_phage	39.8	6.5e-11
1058883:1058898	attR	AGCACAACGCCGGATG	NA	NA	NA	NA
WP_003593553.1|1059061_1059532_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_015764401.1|1059528_1061232_+|terminase	terminase	terminase	E9LUI0	Lactobacillus_phage	40.4	2.0e-120
WP_013245613.1|1061197_1061377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015764402.1|1061381_1062566_+|portal	phage portal protein	portal	A0A2H4J5A4	uncultured_Caudovirales_phage	34.5	1.7e-60
WP_015764403.1|1062552_1064079_+|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	26.1	6.0e-39
WP_015764404.1|1064134_1064425_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
>prophage 4
NC_013199	Lactobacillus rhamnosus Lc 705, complete genome	2968598	2424885	2443107	2968598	bacteriocin,protease	Bacillus_phage(50.0%)	19	NA	NA
WP_005692260.1|2424885_2425176_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_005692258.1|2425303_2426386_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_005692255.1|2426685_2428041_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_005692253.1|2428220_2428631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005692250.1|2430082_2432275_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	25.7	1.6e-37
WP_005692249.1|2432523_2432658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005692247.1|2433314_2434148_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_005692246.1|2434140_2434917_+	LytTR family transcriptional regulator DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014571574.1|2435036_2435297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005692238.1|2436764_2437064_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_005692236.1|2437242_2437401_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_005686851.1|2437869_2438055_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_005686849.1|2438114_2438300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005692232.1|2438685_2438871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005692230.1|2438920_2439727_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005692227.1|2440047_2440488_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_005692225.1|2440542_2441970_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	26.4	4.6e-33
WP_005692222.1|2442142_2442475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014571576.1|2442765_2443107_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
