The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_013198	Lactobacillus rhamnosus GG, complete genome	3010111	405975	526431	3010111	transposase	Faecalibacterium_phage(15.0%)	102	NA	NA
WP_014568877.1|405975_406992_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	1.2e-35
WP_014569064.1|408137_408995_+	transketolase	NA	NA	NA	NA	NA
WP_014569065.1|408987_410004_+	transketolase	NA	NA	NA	NA	NA
WP_014569066.1|410195_411050_+	ROK family protein	NA	NA	NA	NA	NA
WP_005714899.1|411099_411858_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_014569067.1|412098_412572_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_005714903.1|412576_412906_+	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_014569068.1|412930_414037_+	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_014568877.1|414200_415217_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	1.2e-35
WP_014569069.1|415297_416113_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_005714906.1|416134_417028_+	ketose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_005714907.1|417572_418049_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_014569071.1|418020_418449_-	PTS mannose transporter subunit IIB	NA	NA	NA	NA	NA
WP_014569072.1|418466_420155_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_005714910.1|420194_420905_-	transaldolase	NA	NA	NA	NA	NA
WP_014569073.1|421108_422140_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_014569074.1|422378_423293_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014569075.1|423325_423676_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_005714931.1|423677_424040_+	DUF2620 domain-containing protein	NA	NA	NA	NA	NA
WP_005714932.1|424100_425396_+	YhfT family protein	NA	NA	NA	NA	NA
WP_014569076.1|425425_426310_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005714935.1|426302_427409_+	PLP-dependent transferase	NA	NA	NA	NA	NA
WP_014569077.1|427399_428572_+	YhfX family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_014569078.1|428573_429803_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_014569079.1|430130_430967_+	S-adenosyl-l-methionine hydroxide adenosyltransferase family protein	NA	NA	NA	NA	NA
WP_005691490.1|431049_431610_+	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014569080.1|431611_433312_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	3.8e-18
WP_014569081.1|433308_434136_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_014569082.1|434487_435621_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_003660077.1|436450_438265_+	FIVAR domain-containing protein	NA	NA	NA	NA	NA
WP_014569083.1|438734_439646_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.0	8.4e-20
WP_003601979.1|439987_440638_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	37.6	1.5e-18
WP_002819966.1|440643_440928_+	BRCT domain-containing protein	NA	NA	NA	NA	NA
WP_076638850.1|441666_441882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016382272.1|442005_442404_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_014569086.1|442874_443954_-	class C sortase	NA	NA	NA	NA	NA
WP_014569087.1|444027_445032_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_014569088.1|445034_445760_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_014569089.1|445752_448440_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_014568877.1|448580_449597_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	1.2e-35
WP_014569090.1|450275_450833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569093.1|451871_453659_-	UvrD-helicase domain-containing protein	NA	U5PSZ2	Bacillus_phage	25.9	1.7e-08
WP_014569094.1|453655_455746_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_014569018.1|455863_457360_-|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
WP_014569095.1|457653_457905_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	92.8	1.1e-35
WP_014569096.1|457958_458750_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.9	2.0e-147
WP_014569097.1|459083_459932_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.1	1.3e-43
WP_101495030.1|460136_460484_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003582045.1|460535_460799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003587111.1|460858_463681_-	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.7	3.1e-73
WP_005688360.1|464785_465940_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_095691959.1|466446_467234_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014569099.1|467283_467958_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	1.2e-58
WP_029944056.1|468800_470357_-	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_003574021.1|470707_471628_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_014569101.1|471662_472916_-	MFS transporter	NA	NA	NA	NA	NA
WP_014569018.1|473014_474511_+|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
WP_014569102.1|474512_475835_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_014569105.1|477194_480173_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.3	1.5e-147
WP_005714951.1|480205_481687_+	amino acid permease	NA	NA	NA	NA	NA
WP_015764844.1|481834_483292_+	amino acid permease	NA	NA	NA	NA	NA
WP_005714953.1|483559_484414_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_031541855.1|484562_486791_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014569108.1|487024_488224_+	MFS transporter	NA	NA	NA	NA	NA
WP_014569109.1|488247_489678_+	amidohydrolase	NA	NA	NA	NA	NA
WP_014569110.1|489763_490825_-	NAD/NADP octopine/nopaline dehydrogenase family protein	NA	NA	NA	NA	NA
WP_014569111.1|490821_491574_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.0	1.9e-22
WP_014569112.1|491583_492462_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014569113.1|492475_493144_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014569114.1|493140_493827_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014569115.1|494295_495033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569116.1|495759_496305_+	DNA-directed RNA polymerase subunit sigma-24	NA	NA	NA	NA	NA
WP_005686332.1|496421_496574_+	YvrJ family protein	NA	NA	NA	NA	NA
WP_014569117.1|496585_497350_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2P1CCE6	Lactobacillus_phage	52.0	2.3e-47
WP_014569118.1|497570_498368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569119.1|498618_499122_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014569120.1|499129_500191_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014569121.1|500195_500885_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	2.8e-28
WP_014569123.1|501173_502544_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.6	1.2e-09
WP_015764848.1|502790_503609_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_005691594.1|503731_504004_-	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_014569124.1|504152_504917_-	DUF4111 domain-containing protein	NA	NA	NA	NA	NA
WP_014569125.1|505326_505755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162467049.1|505748_505994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569126.1|505971_506328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015764850.1|506285_506450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003605947.1|507588_509007_-|transposase	IS5-like element ISLrh3 family transposase	transposase	NA	NA	NA	NA
WP_014569127.1|509531_510389_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014569128.1|510598_511615_+	linear amide C-N hydrolase	NA	M1H9I8	Acanthocystis_turfacea_Chlorella_virus	28.8	8.4e-21
WP_014569129.1|511794_512760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005714981.1|513030_514725_-	oleate hydratase	NA	NA	NA	NA	NA
WP_005691618.1|514953_515520_-	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_005686376.1|515609_515978_-	PTS-dependent dihydroxyacetone kinase phosphotransferase subunit DhaM	NA	NA	NA	NA	NA
WP_014569130.1|516253_516835_-	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_014569131.1|516821_517841_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_014569132.1|518034_518463_-	OsmC family protein	NA	NA	NA	NA	NA
WP_014569133.1|518921_519605_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.9	1.1e-24
WP_014569134.1|519611_520784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569018.1|521183_522680_-|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
WP_127817602.1|523524_523767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569137.1|524050_524887_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014569138.1|524934_526431_-|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_013198	Lactobacillus rhamnosus GG, complete genome	3010111	1102526	1142252	3010111	holin,tail,capsid,integrase,portal,terminase,head	Lactobacillus_phage(85.42%)	61	1090439:1090453	1139121:1139135
1090439:1090453	attL	TATTGAAGGTGGACA	NA	NA	NA	NA
WP_014569455.1|1102526_1103711_-|integrase	site-specific integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	99.2	7.3e-226
WP_005716132.1|1103881_1104088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014569456.1|1104055_1105057_-	hypothetical protein	NA	A0A1S5SA20	Streptococcus_phage	23.3	4.4e-06
WP_005716134.1|1105167_1105371_-	hypothetical protein	NA	A0A0P0IQK8	Lactobacillus_phage	85.1	8.6e-26
WP_015764910.1|1105394_1105820_-	pyridoxamine 5'-phosphate oxidase family protein	NA	A0A0P0I7K6	Lactobacillus_phage	94.3	2.5e-59
WP_016364973.1|1105953_1106121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003606997.1|1106202_1106424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003606998.1|1106424_1107180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569458.1|1107286_1107988_-	DUF3862 domain-containing protein	NA	A9D9J1	Lactobacillus_prophage	39.3	5.1e-25
WP_014569459.1|1108047_1108470_-	toxin	NA	A0A1B0YA58	Lactobacillus_phage	93.5	5.1e-73
WP_003574523.1|1108459_1108798_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	98.2	6.6e-55
WP_014569460.1|1108932_1109175_+	helix-turn-helix transcriptional regulator	NA	A0A0P0HRP5	Lactobacillus_phage	95.0	4.6e-34
WP_029943629.1|1109171_1109420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014569461.1|1109416_1109644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569462.1|1109731_1109890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014569463.1|1109955_1110504_+	hypothetical protein	NA	A0A1B0YE60	Lactobacillus_phage	97.8	1.0e-97
WP_015764912.1|1110482_1110713_+	helix-turn-helix domain-containing protein	NA	A0A1B0Y6A3	Lactobacillus_phage	98.6	5.5e-37
WP_014569466.1|1110856_1111084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014569467.1|1111290_1112166_+	recombinase RecT	NA	A0A1X9I5N6	Streptococcus_phage	52.2	5.7e-58
WP_014569468.1|1112185_1112950_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	54.0	4.0e-76
WP_014569469.1|1112965_1113922_+	DnaD domain protein	NA	A0A1B0Y2R2	Lactobacillus_phage	90.9	2.0e-128
WP_014569470.1|1113934_1114420_+	single-stranded DNA-binding protein	NA	U5U726	Lactobacillus_phage	86.3	8.8e-61
WP_014569471.1|1114437_1114653_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IJY1	Lactobacillus_phage	91.4	6.1e-30
WP_015764330.1|1114649_1114841_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014569472.1|1115210_1115660_+	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	93.2	6.2e-69
WP_014569473.1|1115706_1115961_+	hypothetical protein	NA	A0A0P0IQP0	Lactobacillus_phage	94.0	4.6e-37
WP_014569474.1|1115957_1116359_+	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	71.5	2.6e-50
WP_014569475.1|1116371_1116836_+	hypothetical protein	NA	A0A0P0IXF6	Lactobacillus_phage	98.0	7.2e-20
WP_014569476.1|1116847_1117033_+	hypothetical protein	NA	Q6J1V0	Lactobacillus_phage	88.5	5.1e-25
WP_014569477.1|1117029_1117536_+	DUF1642 domain-containing protein	NA	Q8LTB6	Lactobacillus_phage	72.9	8.6e-59
WP_015764915.1|1117525_1117705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029943632.1|1117691_1117895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014569478.1|1117884_1118316_+	hypothetical protein	NA	C1KFE8	Lactobacillus_virus	69.9	1.1e-49
WP_101495024.1|1118309_1118675_+	hypothetical protein	NA	C1KFE5	Lactobacillus_virus	58.0	3.2e-31
WP_014569479.1|1118671_1118911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029943634.1|1118960_1119143_+	hypothetical protein	NA	A0A0P0I365	Lactobacillus_phage	61.7	1.6e-15
WP_005711378.1|1119437_1119866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014569480.1|1120893_1122042_+	hypothetical protein	NA	B4XYU0	Lactobacillus_phage	98.7	2.4e-221
WP_014569481.1|1122054_1122597_+	HNH endonuclease	NA	B4XYU1	Lactobacillus_phage	100.0	1.1e-107
WP_015764918.1|1122589_1122910_+	ribonucleoside-diphosphate reductase	NA	A8YQN5	Lactobacillus_phage	92.4	9.0e-54
WP_014569483.1|1122946_1123480_+|terminase	terminase small subunit	terminase	A0A0P0IUY4	Lactobacillus_phage	94.1	2.7e-63
WP_029943635.1|1123457_1124813_+|terminase	PBSX family phage terminase large subunit	terminase	A4L7R3	Lactococcus_phage	59.1	4.9e-149
WP_014569485.1|1124817_1126245_+|portal	phage portal protein	portal	A0A0P0IJV3	Lactobacillus_phage	90.6	2.7e-243
WP_014569486.1|1126210_1127203_+|capsid	minor capsid protein	capsid	A0A0P0ID43	Lactobacillus_phage	95.5	6.2e-178
WP_014569487.1|1127327_1127984_+	DUF4355 domain-containing protein	NA	A0A0P0ID10	Lactobacillus_phage	80.0	4.3e-58
WP_014569488.1|1127999_1129013_+	hypothetical protein	NA	A0A0A7RVZ1	Clostridium_phage	26.5	3.1e-23
WP_014569489.1|1129240_1129615_+|head,tail	phage head-tail connector protein	head,tail	A0A0P0IZF6	Lactobacillus_phage	91.9	3.2e-58
WP_014569490.1|1129619_1129922_+	hypothetical protein	NA	A0A0P0HRN0	Lactobacillus_phage	93.0	6.3e-49
WP_015764920.1|1129918_1130284_+	HK97 gp10 family phage protein	NA	A0A0P0IUZ3	Lactobacillus_phage	96.7	2.0e-57
WP_014569492.1|1130284_1130689_+	DUF3168 domain-containing protein	NA	A0A0P0I3C8	Lactobacillus_phage	98.5	3.0e-70
WP_014569493.1|1130700_1131303_+|tail	phage tail protein	tail	A0A0P0ID88	Lactobacillus_phage	93.5	2.4e-100
WP_014569494.1|1131389_1131722_+|tail	tail assembly chaperone	tail	A0A0P0IQQ6	Lactobacillus_phage	94.5	2.4e-49
WP_015764921.1|1131826_1132180_+	hypothetical protein	NA	A0A0P0I7N9	Lactobacillus_phage	96.6	5.3e-55
WP_014569496.1|1132172_1135262_+	tape measure protein	NA	A0A0P0IJD2	Lactobacillus_phage	88.0	1.4e-263
WP_015764922.1|1135264_1137253_+|tail	phage tail family protein	tail	B4XYQ4	Lactobacillus_phage	85.9	0.0e+00
WP_014569498.1|1137252_1139760_+|tail	phage tail protein	tail	B4XYQ5	Lactobacillus_phage	82.6	0.0e+00
1139121:1139135	attR	TATTGAAGGTGGACA	NA	NA	NA	NA
WP_005686996.1|1139769_1140093_+	hypothetical protein	NA	B4XYQ6	Lactobacillus_phage	98.1	1.1e-51
WP_014569499.1|1140085_1140217_+	XkdX family protein	NA	A0A0P0HRS7	Lactobacillus_phage	97.7	2.5e-18
WP_014569500.1|1140246_1140540_+	hypothetical protein	NA	B4XYQ7	Lactobacillus_phage	94.8	5.3e-45
WP_014569501.1|1140529_1140943_+|holin	phage holin	holin	A0A0P0IDC6	Lactobacillus_phage	97.9	1.4e-43
WP_014569502.1|1140953_1142252_+	LysM peptidoglycan-binding domain-containing protein	NA	B4XYQ9	Lactobacillus_phage	99.1	1.2e-232
>prophage 3
NC_013198	Lactobacillus rhamnosus GG, complete genome	3010111	1495537	1595490	3010111	holin,tail,transposase,tRNA,capsid,integrase,portal,terminase,head	Lactobacillus_phage(36.11%)	94	1528321:1528380	1562933:1563093
WP_005685893.1|1495537_1496836_-|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	28.2	2.9e-50
WP_005685894.1|1496859_1498035_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_005685895.1|1498087_1498579_-	DUF5590 domain-containing protein	NA	NA	NA	NA	NA
WP_005685896.1|1498853_1501655_-	ribonuclease H-like domain-containing protein	NA	A0A1X9I5C8	Streptococcus_phage	33.3	1.1e-54
WP_005685897.1|1501698_1505409_-	helicase-exonuclease AddAB subunit AddA	NA	S5MMD7	Bacillus_phage	22.2	6.4e-18
WP_005685898.1|1505405_1508945_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_005685900.1|1509359_1510295_+	mevalonate kinase	NA	NA	NA	NA	NA
WP_005685903.1|1510302_1511307_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_005685905.1|1511272_1512307_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_014569664.1|1512413_1513745_-	RsmF rRNA methyltransferase first C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_005685909.1|1513731_1514688_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005685911.1|1514889_1515633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005685914.1|1515748_1516099_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_005685917.1|1516132_1516321_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_005685919.1|1516778_1518284_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005685921.1|1518249_1519980_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	24.3	1.5e-06
WP_005685922.1|1520354_1521149_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_005685924.1|1521135_1521846_-|tRNA	tRNA (adenine(22)-N(1))-methyltransferase TrmK	tRNA	NA	NA	NA	NA
WP_005685926.1|1522034_1523285_-	RNA polymerase sigma factor RpoD	NA	F4YCU2	Synechococcus_phage	38.9	1.1e-38
WP_005685928.1|1523298_1525068_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	31.4	8.2e-56
WP_014569666.1|1525253_1527323_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_005685932.1|1527324_1528221_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
1528321:1528380	attL	TGCGCGGTTCCACCCTACTTCAGATAGACCGAATCTACCTGCAGCTTTGTCATTTGGTTC	NA	NA	NA	NA
WP_014569667.1|1528626_1529796_-|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	31.8	2.6e-42
WP_015764956.1|1529838_1530159_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014569668.1|1531000_1531387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569669.1|1531577_1532732_-	LysM peptidoglycan-binding domain-containing protein	NA	Q6J1W8	Lactobacillus_phage	66.2	9.9e-143
WP_014569670.1|1532734_1533067_-|holin	phage holin	holin	Q3L0R7	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	100.0	2.0e-32
WP_003579629.1|1533079_1533313_-	hypothetical protein	NA	Q3L0R9	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	98.7	2.6e-34
WP_005689480.1|1533337_1533469_-	XkdX family protein	NA	Q3L0S0	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	90.7	4.2e-18
WP_014569672.1|1533461_1533785_-	hypothetical protein	NA	B4XYQ6	Lactobacillus_phage	99.1	5.0e-52
WP_014569673.1|1533794_1536728_-|tail	phage tail protein	tail	B4XYQ5	Lactobacillus_phage	68.7	1.1e-311
WP_014569674.1|1536733_1538791_-|tail	phage tail family protein	tail	Q6J1X4	Lactobacillus_phage	48.1	1.3e-153
WP_015764958.1|1538791_1542958_-|tail	tail protein	tail	A8YQJ9	Lactobacillus_phage	79.4	0.0e+00
WP_021354705.1|1542963_1543194_-	hypothetical protein	NA	Q3L0S5	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	98.7	5.0e-38
WP_014569677.1|1543171_1543522_-|tail	tail protein	tail	Q6J1X6	Lactobacillus_phage	95.7	2.2e-53
WP_014569678.1|1543676_1544312_-|tail	phage tail protein	tail	Q3L0S7	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	89.6	9.1e-98
WP_015764960.1|1544312_1544693_-	DUF806 family protein	NA	Q3L0S8	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	92.9	9.0e-61
WP_014569680.1|1544689_1545109_-	HK97 gp10 family phage protein	NA	Q3L0S9	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	90.6	1.9e-64
WP_029943782.1|1545111_1545456_-|head	phage head closure protein	head	A8YQJ4	Lactobacillus_phage	85.8	1.1e-49
WP_014569682.1|1545445_1545736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569683.1|1545807_1547736_-|capsid	phage major capsid protein	capsid	A0A2P0ZLF9	Lactobacillus_phage	46.1	1.2e-68
WP_015764961.1|1547735_1548836_-|portal	phage portal protein	portal	Q9AZM4	Lactococcus_phage	43.6	9.6e-79
WP_029943780.1|1548832_1549015_-	DUF1056 family protein	NA	NA	NA	NA	NA
WP_014569685.1|1549138_1551031_-|terminase	terminase large subunit	terminase	A0A0M7RDK9	Lactobacillus_phage	44.0	3.5e-153
WP_014569686.1|1551024_1551489_-|terminase	phage terminase small subunit P27 family	terminase	B8R648	Lactobacillus_phage	39.7	3.1e-23
WP_015764963.1|1551970_1552531_-	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	44.2	2.5e-35
WP_107755075.1|1552763_1552940_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_014569687.1|1552936_1553686_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_014569018.1|1553751_1555248_+|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
WP_014569688.1|1555904_1556183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015764964.1|1556175_1556616_-	HNH endonuclease	NA	B8R694	Lactobacillus_phage	54.0	9.3e-25
WP_015764965.1|1556714_1557119_-	single-stranded DNA-binding protein	NA	L0P8Q2	Lactobacillus_phage	40.0	1.4e-14
WP_014569689.1|1557105_1557873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015764966.1|1557873_1558080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048653167.1|1558140_1558722_-	HNH endonuclease	NA	M1NMU3	Moumouvirus	33.8	5.7e-14
WP_014569690.1|1559128_1560367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029944087.1|1560405_1560633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005685933.1|1563211_1563739_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1562933:1563093	attR	TGCGCGGTTCCACCCTACTTCAGATAGACCGAATCTACCTGCAGCTTTGTCATTTGGTTCGAAAACGCCAATCACATTCACCACCATCAGGCTTACACTATCCCTGACTCGCTTGGGTTTGGTACAAATGCGACCCTTTTTCTCATCACCGATTCAATTTC	NA	NA	NA	NA
WP_005685935.1|1563835_1564465_-	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_005685938.1|1564461_1565175_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	1.7e-12
WP_005687657.1|1565829_1566141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005687658.1|1566291_1567107_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_005687659.1|1567106_1568009_-	GTPase Era	NA	NA	NA	NA	NA
WP_005713928.1|1568005_1568395_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_005687661.1|1568398_1568797_-	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_005687662.1|1568780_1569239_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_005687663.1|1569242_1570229_-	PhoH family protein	NA	L7TP00	Rhizobium_phage	45.2	3.2e-49
WP_005687664.1|1570795_1571230_-	GatB/YqeY domain-containing protein	NA	A0A0K2FLI9	Brevibacillus_phage	39.0	9.5e-14
WP_005687665.1|1571257_1571434_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_005687666.1|1571706_1572537_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_005687667.1|1572533_1573421_-	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	27.0	2.1e-20
WP_005687668.1|1573568_1574489_-	YitT family protein	NA	NA	NA	NA	NA
WP_005687669.1|1574793_1575240_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_005687670.1|1575325_1577131_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_014569692.1|1577132_1578416_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_005687672.1|1578969_1580478_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005687673.1|1580474_1581350_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.0	5.4e-24
WP_005687674.1|1581549_1581996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005687675.1|1582083_1583406_+	N-acetylmuramoyl-L-alanine amidase	NA	J9PV86	Bacillus_phage	30.2	3.0e-10
WP_005687676.1|1583507_1584134_-	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_005687677.1|1584133_1584580_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_005687678.1|1584706_1586932_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	35.1	3.1e-07
WP_005687679.1|1587236_1587560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569694.1|1587597_1588326_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_005687681.1|1588364_1589309_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_005687682.1|1589389_1589884_-	DUF3013 family protein	NA	NA	NA	NA	NA
WP_005687683.1|1589880_1590486_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_005687684.1|1590591_1590840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005687685.1|1590908_1591295_-	YxeA family protein	NA	NA	NA	NA	NA
WP_005687686.1|1591579_1591759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005687687.1|1591758_1592145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005687688.1|1592562_1593153_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005687689.1|1593155_1593713_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080515089.1|1593993_1595490_+|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_013198	Lactobacillus rhamnosus GG, complete genome	3010111	2108745	2115618	3010111		Lactococcus_phage(33.33%)	9	NA	NA
WP_014569868.1|2108745_2109675_-	DUF4065 domain-containing protein	NA	Q9AZG0	Lactococcus_phage	38.1	4.5e-53
WP_101495023.1|2109686_2110013_-	type II toxin-antitoxin system MqsR family toxin	NA	Q9AZG1	Lactococcus_phage	39.6	4.8e-10
WP_005715269.1|2110306_2110807_-	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	29.3	4.7e-09
WP_014569870.1|2110923_2111637_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_005712952.1|2111633_2111858_-	DUF2829 domain-containing protein	NA	G3MBC9	Bacillus_virus	40.4	4.3e-10
WP_005686244.1|2112138_2112450_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014569871.1|2112697_2113336_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_005692769.1|2113580_2114564_-	ATP-binding cassette domain-containing protein	NA	Q6GZ03	Mycoplasma_phage	33.0	1.7e-10
WP_005692768.1|2114565_2115618_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.9	5.7e-20
>prophage 5
NC_013198	Lactobacillus rhamnosus GG, complete genome	3010111	2398547	2470447	3010111	bacteriocin,tRNA,protease	Bacillus_phage(27.27%)	60	NA	NA
WP_014570035.1|2398547_2399954_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	31.5	2.1e-54
WP_005686130.1|2400097_2400973_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005686125.1|2403473_2404043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005686122.1|2404679_2406173_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_014570039.1|2406723_2407554_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_014570040.1|2407567_2408584_-	membrane protein	NA	NA	NA	NA	NA
WP_014570041.1|2408580_2408967_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014570042.1|2409098_2410727_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_015765046.1|2411224_2412541_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_005686113.1|2413641_2414757_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_014570045.1|2414777_2416142_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_005686110.1|2416161_2416701_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	48.0	4.4e-37
WP_014570047.1|2417341_2417632_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_014570048.1|2417926_2419246_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	35.8	2.3e-63
WP_005714538.1|2419390_2420737_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	38.5	1.3e-72
WP_014570049.1|2420953_2422054_+	ABC transporter	NA	NA	NA	NA	NA
WP_014570050.1|2422050_2423247_+	ABC transporter	NA	NA	NA	NA	NA
WP_005686102.1|2423260_2424136_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.9	2.1e-12
WP_014570051.1|2424287_2426342_+	KUP/HAK/KT family potassium transporter	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	32.9	2.1e-63
WP_014570052.1|2426548_2429179_-	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	38.9	2.8e-84
WP_076638835.1|2429478_2430066_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005692313.1|2430237_2430909_-	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_014570054.1|2431066_2432185_+	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_005686095.1|2432203_2432488_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_014570055.1|2432733_2433849_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005686092.1|2434011_2434221_-	CsbD family protein	NA	NA	NA	NA	NA
WP_014570056.1|2434786_2434975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570057.1|2434986_2435184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005686089.1|2435978_2436236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005686086.1|2436425_2436632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570058.1|2436860_2437076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015764702.1|2437645_2438878_+	MFS transporter	NA	NA	NA	NA	NA
WP_014570059.1|2438947_2440204_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	55.6	6.0e-109
WP_005698939.1|2440284_2441121_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.9	7.4e-47
WP_005692296.1|2441569_2441755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570061.1|2442331_2442874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570062.1|2443103_2443928_-	class C sortase	NA	NA	NA	NA	NA
WP_014570063.1|2443934_2445488_-	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_014570064.1|2445478_2446834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570065.1|2446835_2449787_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_014570066.1|2450061_2450619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570067.1|2450787_2451996_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_014570068.1|2452188_2453244_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_014570069.1|2453536_2454184_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	38.7	2.2e-06
WP_005687855.1|2454314_2454647_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014570070.1|2454643_2455429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014570071.1|2455472_2456249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014570072.1|2456276_2456567_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_048653151.1|2456694_2457777_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_005711099.1|2458079_2459435_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_005692253.1|2459611_2460022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570076.1|2460082_2461462_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_014570077.1|2461474_2463667_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	25.5	3.6e-37
WP_005692249.1|2463915_2464050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570078.1|2464225_2465539_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_014570079.1|2465531_2466320_+	LytTR family transcriptional regulator DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_162467050.1|2467700_2467955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570081.1|2469158_2469458_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_005686855.1|2469634_2469793_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_014570083.1|2470261_2470447_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 6
NC_013198	Lactobacillus rhamnosus GG, complete genome	3010111	2933790	2961208	3010111	transposase,capsid,integrase,portal,terminase	Lactobacillus_phage(22.22%)	31	2948923:2948943	2963052:2963072
WP_107755086.1|2933790_2934684_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.7	1.9e-37
WP_005685752.1|2934877_2936272_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_029944068.1|2936418_2936994_-	YdeI/OmpD-associated family protein	NA	NA	NA	NA	NA
WP_005685750.1|2937107_2937527_-	YjdF family protein	NA	NA	NA	NA	NA
WP_005685749.1|2937810_2938101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005685748.1|2938194_2938443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570217.1|2939889_2941215_-	2-hydroxycarboxylate transporter family protein	NA	A0A140XAH4	Dickeya_phage	52.9	2.1e-16
WP_014570218.1|2941361_2942897_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005685744.1|2942893_2943583_+	response regulator	NA	NA	NA	NA	NA
WP_005685743.1|2943768_2944284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570220.1|2945157_2946012_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005685739.1|2946334_2946733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005685738.1|2946905_2947586_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_005685737.1|2947764_2948694_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
2948923:2948943	attL	CTATTCTGGGTGGTCAGGGGA	NA	NA	NA	NA
WP_014570221.1|2949040_2950198_-|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	33.2	1.3e-46
WP_014570222.1|2950315_2950927_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_029944073.1|2951041_2951254_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014570223.1|2951278_2951554_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014570224.1|2951621_2951843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014570225.1|2951953_2952145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014570226.1|2952189_2952462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015765113.1|2952458_2952647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014570227.1|2952630_2953458_+	bifunctional DNA primase/polymerase	NA	Q854C1	Mycobacterium_phage	34.9	4.5e-12
WP_014570228.1|2953450_2954875_+	virulence protein	NA	A0A1W6JQD6	Staphylococcus_phage	37.6	6.6e-64
WP_014570229.1|2955154_2955577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172619743.1|2955658_2956033_+	HNH endonuclease	NA	D2JLE2	Staphylococcus_phage	39.8	3.8e-11
WP_014570231.1|2956157_2956628_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_014570232.1|2956624_2958328_+|terminase	terminase	terminase	E9LUI0	Lactobacillus_phage	40.6	5.4e-121
WP_015765114.1|2958293_2958473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014570233.1|2958477_2959662_+|portal	phage portal protein	portal	A0A2H4JB06	uncultured_Caudovirales_phage	34.4	2.4e-59
WP_014570234.1|2959648_2961208_+|capsid	phage major capsid protein	capsid	A0A2H4J9X8	uncultured_Caudovirales_phage	29.8	3.3e-32
2963052:2963072	attR	CTATTCTGGGTGGTCAGGGGA	NA	NA	NA	NA
