The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_010999	Lacticaseibacillus paracasei, complete genome	3079196	20328	66670	3079196	protease,bacteriocin,holin,transposase	Planktothrix_phage(25.0%)	46	NA	NA
WP_003568480.1|20328_21186_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003568482.1|21265_21448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012490759.1|21498_21678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003572828.1|22175_23411_-	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_012490760.1|23614_26188_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003568488.1|26200_26902_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	3.9e-33
WP_012490761.1|27181_27733_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003584074.1|27776_28583_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003584076.1|28587_28908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003568543.1|29133_29814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012490762.1|29746_30250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012490763.1|30269_32420_-	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_012490764.1|32488_33376_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_014951491.1|33557_34163_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_003568507.1|34286_35180_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_012490766.1|35228_35867_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003568512.1|36095_37472_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_012490767.1|37694_38039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562540.1|38114_38474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012490768.1|38714_40157_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003577239.1|40351_40987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003577240.1|41036_41348_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003577242.1|41516_41705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003577243.1|41836_42448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003659032.1|42805_43279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003568611.1|43430_43769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012490769.1|44102_44813_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_003592450.1|44799_45129_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_012490770.1|46009_46225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012490771.1|46571_47447_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_012490772.1|47792_48443_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_012490773.1|48611_50027_-|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_003562575.1|50408_51101_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003562576.1|51799_52120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012490774.1|52308_53184_-	Rgg/GadR/MutR family transcriptional regulator	NA	A0A1X9I6E0	Streptococcus_phage	26.6	1.0e-11
WP_012490775.1|53276_54869_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.5	1.1e-11
WP_012490776.1|55206_56580_-	MFS transporter	NA	NA	NA	NA	NA
WP_011673959.1|56757_57081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012490777.1|57261_60573_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_003572929.1|60569_61172_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003572931.1|61422_61683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562592.1|61895_62558_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003562594.1|62557_63487_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003568628.1|63498_64128_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012490780.1|64130_65384_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	43.0	1.5e-14
WP_003577283.1|66016_66670_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NC_010999	Lacticaseibacillus paracasei, complete genome	3079196	337609	375069	3079196	protease,transposase	Staphylococcus_phage(50.0%)	35	NA	NA
WP_014566389.1|337609_338299_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_024109404.1|338362_339049_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_012490911.1|339131_339521_-	YxeA family protein	NA	NA	NA	NA	NA
WP_003577580.1|339552_340077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014566391.1|340066_340336_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012490773.1|340443_341859_+|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_016363600.1|342284_343010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003577587.1|343009_343690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012490915.1|343679_344468_-	membrane protein	NA	NA	NA	NA	NA
WP_012490917.1|344918_346445_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.3	7.4e-53
WP_012490918.1|346715_347837_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012490919.1|347829_348798_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003573439.1|348798_349110_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_012490920.1|349251_350538_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003604285.1|350554_350977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003563251.1|350998_351859_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_012490921.1|351971_352613_+	zeta toxin family protein	NA	NA	NA	NA	NA
WP_003563255.1|352899_353730_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003563257.1|353722_354592_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_012490922.1|354631_355627_+	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_003563261.1|356181_356961_+	alpha/beta hydrolase	NA	A0A291AV30	Mycobacterium_phage	25.4	1.0e-05
WP_012490923.1|358214_358949_+	KxYKxGKxW signal peptide domain-containing protein	NA	NA	NA	NA	NA
WP_003601683.1|358855_359854_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.8	1.8e-55
WP_012490924.1|359912_360794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012490925.1|360893_362375_+	bacterial Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_003563273.1|363986_364385_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_003563277.1|364497_364869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012490773.1|365330_366746_+|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_003563280.1|368450_369293_+	serine hydrolase	NA	NA	NA	NA	NA
WP_016364816.1|369389_369869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012490929.1|369868_370099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003586699.1|370182_371166_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003586701.1|371524_372349_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_012490930.1|372335_373073_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_003601683.1|374070_375069_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.8	1.8e-55
>prophage 3
NC_010999	Lacticaseibacillus paracasei, complete genome	3079196	557259	639685	3079196	transposase,integrase	Lactobacillus_phage(60.71%)	95	557780:557795	589105:589120
WP_003577893.1|557259_558189_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	63.7	5.9e-106
557780:557795	attL	TCGTTGCTGGCGTCGG	NA	NA	NA	NA
WP_012491046.1|558382_558928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003569067.1|559248_560418_-|integrase	site-specific integrase	integrase	Q6J1W6	Lactobacillus_phage	98.2	6.6e-219
WP_003573997.1|560530_560791_-	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	40.7	2.5e-09
WP_003589914.1|560880_561501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491047.1|561484_561721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003589919.1|561913_562621_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_003572182.1|562779_563202_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0P0IJN5	Lactobacillus_phage	39.1	7.8e-21
WP_003572184.1|563194_563548_-	helix-turn-helix transcriptional regulator	NA	A0A141E1M3	Streptococcus_phage	40.9	7.7e-14
WP_003574003.1|563791_564040_+	hypothetical protein	NA	A0A0P0ID24	Lactobacillus_phage	97.5	2.7e-37
WP_003572187.1|564081_564282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572188.1|564252_565086_-	TIGR02391 family protein	NA	A0A1S5SBU1	Streptococcus_phage	37.8	2.8e-46
WP_010493122.1|565146_565905_+	ORF6C domain-containing protein	NA	A0A1B0YEA7	Lactobacillus_phage	49.4	1.9e-41
WP_003572193.1|565905_566085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572196.1|566077_566329_-	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_003572199.1|566394_566751_+	DUF771 domain-containing protein	NA	U5U4L9	Lactobacillus_phage	98.3	2.0e-62
WP_003572201.1|566835_567039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003586921.1|567021_567567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010493132.1|567747_568062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003589923.1|568054_568801_+	DnaD domain protein	NA	A0A0N7IRA7	Lactobacillus_phage	56.1	5.8e-35
WP_012491048.1|568815_569640_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	74.7	9.6e-116
WP_003574016.1|569639_570158_+	exonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_003564822.1|570204_570627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572217.1|570628_571366_+	hypothetical protein	NA	A0A097BY87	Enterococcus_phage	43.0	1.3e-47
WP_010493149.1|571377_571665_+	hypothetical protein	NA	Q8LTA8	Lactobacillus_phage	76.8	1.6e-38
WP_010493151.1|571734_572067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010493154.1|572581_573025_+	autolysin regulatory protein arpU	NA	A0A0P0IZI6	Lactobacillus_phage	97.3	1.2e-77
WP_003572221.1|573538_574192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491050.1|574442_575441_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.8	3.9e-55
WP_003573729.1|575636_575855_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010493173.1|577387_577723_+	ribonucleoside-diphosphate reductase	NA	A0A0N7IRA2	Lactobacillus_phage	90.6	6.8e-52
WP_076626284.1|577842_578175_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003582147.1|578204_578933_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	40.1	7.6e-32
WP_014951815.1|578866_579808_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	28.2	3.1e-17
WP_016364094.1|579853_580717_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	3.1e-24
WP_010493185.1|581446_581725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572355.1|581736_582003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572358.1|582021_582198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572360.1|582199_582427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010493190.1|582469_583711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010493192.1|583688_585239_+	DUF5011 domain-containing protein	NA	NA	NA	NA	NA
WP_012491056.1|585248_585668_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_012491057.1|585676_586255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491058.1|586281_588741_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_012491059.1|588737_590795_+	hypothetical protein	NA	NA	NA	NA	NA
589105:589120	attR	TCGTTGCTGGCGTCGG	NA	NA	NA	NA
WP_003582234.1|590800_591136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014566422.1|591119_591716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491061.1|591696_593625_+	type IV secretory pathway, VirB4 protein	NA	NA	NA	NA	NA
WP_012491062.1|593626_594637_+	C40 family peptidase	NA	A0A1X9SGZ2	Bradyrhizobium_phage	37.9	1.2e-14
WP_012491063.1|594652_595297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491064.1|595293_595701_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_014566423.1|595690_596512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491066.1|597106_597307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491067.1|597303_597561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491068.1|597599_598034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491069.1|598026_599271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016379926.1|599312_599558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014566424.1|599544_602091_+	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_012491073.1|602692_603082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003660106.1|603084_603228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012491077.1|603983_604430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012491078.1|604932_605814_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_012491079.1|605830_606190_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_012491080.1|606268_606940_+	class A sortase	NA	NA	NA	NA	NA
WP_012491081.1|607074_607305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041168760.1|607725_609282_+	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_095691935.1|609966_610754_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003586210.1|610708_611086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012491083.1|611121_611394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012491084.1|611453_614258_-	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.6	1.5e-72
WP_012491085.1|614799_615483_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.3	3.1e-59
WP_005688360.1|615957_617112_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_123796556.1|617120_617908_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012491088.1|618057_618678_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	52.9	4.9e-56
WP_012491089.1|618865_619795_-	class I mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_012491090.1|619808_620639_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_012491091.1|620651_621506_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_012491092.1|621534_622029_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_012491093.1|622072_622492_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_012491094.1|622668_623391_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_012491095.1|623488_624226_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012491096.1|624530_624851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491097.1|624947_625535_+	recombinase family protein	NA	M4QQC6	Vibrio_phage	42.3	1.0e-18
WP_003591692.1|625702_627031_+	MFS transporter	NA	NA	NA	NA	NA
WP_003567312.1|627231_627789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123796556.1|628310_629098_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_123031263.1|629549_630293_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.4	1.5e-136
WP_003593245.1|630953_631871_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_003593246.1|632017_632626_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	52.8	1.8e-50
WP_010010565.1|632636_633905_+	NADPH-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	47.7	1.8e-49
WP_123031263.1|634582_635326_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.4	1.5e-136
WP_012491103.1|635530_637210_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_012491105.1|637556_637754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003585300.1|637728_638082_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_012491106.1|638182_639685_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_010999	Lacticaseibacillus paracasei, complete genome	3079196	894474	962575	3079196	terminase,head,tRNA,protease,capsid,transposase,integrase,tail,portal,holin	Lactobacillus_phage(94.23%)	73	921121:921137	967640:967656
WP_011674296.1|894474_895977_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_003564071.1|896271_896820_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_014566463.1|897199_898918_+	APC family permease	NA	NA	NA	NA	NA
WP_003569394.1|899204_900413_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003564079.1|900415_901444_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003564081.1|901456_902470_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_003564083.1|902505_902859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011674299.1|902944_904120_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_003564087.1|904365_904644_+	YkuJ family protein	NA	NA	NA	NA	NA
WP_012491223.1|904874_906968_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	46.9	6.1e-151
WP_003564091.1|907160_907601_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_003569415.1|913660_914308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003564111.1|914488_915673_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	66.0	1.5e-141
WP_003564114.1|915786_917280_+	MFS transporter	NA	NA	NA	NA	NA
WP_012491224.1|917374_917845_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003569431.1|918088_919567_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_003598039.1|919563_920289_+	DUF4811 domain-containing protein	NA	NA	NA	NA	NA
WP_003578172.1|920389_921073_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
921121:921137	attL	AAGGATCTTGGTCGCAA	NA	NA	NA	NA
WP_003578174.1|921651_924063_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	68.4	0.0e+00
WP_003564130.1|924328_925972_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_012491225.1|925976_926687_+	16S rRNA pseudouridine(516) synthase	NA	NA	NA	NA	NA
WP_003569458.1|926829_927045_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_003569460.1|927161_927983_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_012491226.1|927979_928483_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_012491227.1|928806_929946_-|integrase	site-specific integrase	integrase	A0A0P0IXL3	Lactobacillus_phage	100.0	2.4e-218
WP_003598052.1|930063_931131_-	Abi family protein	NA	A0A0N7IRA5	Lactobacillus_phage	100.0	1.1e-207
WP_003598055.1|931275_931707_-	hypothetical protein	NA	A0A0P0IJV8	Lactobacillus_phage	100.0	6.8e-73
WP_012491228.1|931776_932259_-	hypothetical protein	NA	A0A0P0IZP3	Lactobacillus_phage	100.0	2.1e-83
WP_003598059.1|932262_932556_-	hypothetical protein	NA	A0A0P0HRW5	Lactobacillus_phage	100.0	5.7e-47
WP_012491229.1|932739_933600_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0P0IV64	Lactobacillus_phage	100.0	2.8e-158
WP_012491230.1|933586_933955_-	helix-turn-helix domain-containing protein	NA	A0A0P0I3L3	Lactobacillus_phage	100.0	2.8e-59
WP_003578190.1|934205_934403_+	hypothetical protein	NA	A0A0P0IK60	Lactobacillus_phage	100.0	5.2e-28
WP_012491231.1|934399_935122_+	Rha family transcriptional regulator	NA	A0A0P0IDD0	Lactobacillus_phage	100.0	1.4e-126
WP_014951753.1|935129_935342_+	hypothetical protein	NA	A0A0N7IRA6	Lactobacillus_phage	100.0	7.8e-30
WP_003657835.1|935450_935675_+	DUF771 domain-containing protein	NA	A0A0P0IQT9	Lactobacillus_phage	100.0	2.6e-39
WP_012491233.1|935763_935976_+	hypothetical protein	NA	A0A0P0IXL9	Lactobacillus_phage	100.0	2.5e-36
WP_012491234.1|935985_936861_+	YqaJ viral recombinase family protein	NA	A0A0P0IJW5	Lactobacillus_phage	100.0	1.1e-170
WP_012491235.1|936863_937058_+	hypothetical protein	NA	A0A0P0IZQ2	Lactobacillus_phage	100.0	2.5e-30
WP_012491236.1|937057_937945_+	recombinase RecT	NA	A0A0P0HRX2	Lactobacillus_phage	100.0	8.6e-163
WP_012491237.1|937953_938199_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IV68	Lactobacillus_phage	100.0	2.6e-37
WP_012491238.1|938203_939049_+	DnaD domain protein	NA	A0A0N7IRA7	Lactobacillus_phage	100.0	1.0e-133
WP_012491239.1|939086_939908_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	100.0	6.1e-155
WP_012491240.1|939904_940204_+	hypothetical protein	NA	A0A0P0IK66	Lactobacillus_phage	100.0	2.1e-49
WP_014566466.1|940166_940451_+	hypothetical protein	NA	A0A0P0IDD7	Lactobacillus_phage	100.0	8.8e-45
WP_014566751.1|940419_940767_+	hypothetical protein	NA	A0A0P0IQU7	Lactobacillus_phage	100.0	1.5e-62
WP_012491243.1|940759_941338_+	HNH endonuclease	NA	A0A0P0I7T6	Lactobacillus_phage	100.0	1.1e-105
WP_012491244.1|941351_941774_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0IXM5	Lactobacillus_phage	100.0	5.5e-75
WP_012491245.1|941778_942042_+	hypothetical protein	NA	A0A0P0IJX1	Lactobacillus_phage	100.0	6.1e-40
WP_012491246.1|942065_942389_+	hypothetical protein	NA	A0A0N7IRA8	Lactobacillus_phage	100.0	9.7e-56
WP_012491247.1|942467_942917_+	hypothetical protein	NA	A0A0P0IZR0	Lactobacillus_phage	100.0	1.2e-80
WP_012491248.1|943141_943522_+	HNH endonuclease	NA	A0A0P0HRY0	Lactobacillus_phage	100.0	2.5e-71
WP_003582259.1|943591_943966_+	hypothetical protein	NA	A0A1B0YE76	Lactobacillus_phage	100.0	3.6e-62
WP_012491250.1|943968_945699_+|terminase	terminase large subunit	terminase	A0A0P0IJU3	Lactobacillus_phage	100.0	0.0e+00
WP_012491251.1|945717_946953_+|portal	phage portal protein	portal	A0A0P0IZM3	Lactobacillus_phage	100.0	2.6e-234
WP_012491252.1|946930_947638_+|protease	Clp protease ClpP	protease	A0A0P0HRU7	Lactobacillus_phage	100.0	7.2e-128
WP_012491253.1|947642_948872_+|capsid	phage major capsid protein	capsid	A0A0P0IV50	Lactobacillus_phage	100.0	7.3e-229
WP_012491254.1|948945_949194_+	hypothetical protein	NA	A0A0P0I3K0	Lactobacillus_phage	100.0	9.1e-38
WP_003582271.1|949207_949534_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B0Y2R7	Lactobacillus_phage	100.0	7.0e-54
WP_012491255.1|949472_949811_+|head	phage head closure protein	head	A0A0N7IRA3	Lactobacillus_phage	100.0	2.2e-58
WP_012491256.1|949794_950124_+	hypothetical protein	NA	A0A0P0IDB8	Lactobacillus_phage	100.0	3.1e-57
WP_012491257.1|950113_950497_+	hypothetical protein	NA	A0A0P0IQS9	Lactobacillus_phage	100.0	4.5e-68
WP_012491258.1|950508_951156_+	hypothetical protein	NA	A0A0P0I7R6	Lactobacillus_phage	100.0	1.5e-119
WP_012491259.1|951232_951598_+	hypothetical protein	NA	A0A0P0IXK4	Lactobacillus_phage	100.0	4.6e-62
WP_003582283.1|951678_951840_+	hypothetical protein	NA	A0A0P0IJV2	Lactobacillus_phage	100.0	7.5e-25
WP_012491260.1|951859_954832_+	tape measure protein	NA	A0A0P0IZN3	Lactobacillus_phage	100.0	1.3e-292
WP_012491261.1|954838_955534_+	hypothetical protein	NA	A0A0P0HRV6	Lactobacillus_phage	100.0	8.3e-129
WP_012491262.1|955530_959937_+|tail	phage tail protein	tail	A0A0N7IRA4	Lactobacillus_phage	99.9	0.0e+00
WP_012491263.1|959965_960391_+	DUF1617 family protein	NA	A0A1B0Y2S1	Lactobacillus_phage	100.0	8.8e-73
WP_012491264.1|960393_960663_+	hypothetical protein	NA	A0A0P0I3K6	Lactobacillus_phage	100.0	2.4e-39
WP_012491265.1|960708_961002_+	hypothetical protein	NA	A0A0P0IK41	Lactobacillus_phage	100.0	4.0e-48
WP_012491266.1|960991_961426_+|holin	phage holin	holin	A0A0P0IDC6	Lactobacillus_phage	100.0	7.4e-51
WP_012491267.1|961425_961614_+	hypothetical protein	NA	A0A0P0IQT6	Lactobacillus_phage	100.0	6.7e-25
WP_012491268.1|961600_962575_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0P0I7S1	Lactobacillus_phage	100.0	9.1e-198
967640:967656	attR	AAGGATCTTGGTCGCAA	NA	NA	NA	NA
>prophage 5
NC_010999	Lacticaseibacillus paracasei, complete genome	3079196	1019698	1078175	3079196	terminase,head,protease,capsid,integrase,tail,portal,holin	Lactobacillus_phage(87.27%)	66	1043349:1043367	1078257:1078275
WP_003564220.1|1019698_1020034_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_003564222.1|1020225_1021185_+	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_003578277.1|1021186_1022014_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_003583985.1|1022024_1023080_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_012491289.1|1023145_1024099_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	47.9	8.9e-81
WP_012491290.1|1024682_1026410_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	54.9	3.3e-182
WP_003569557.1|1026644_1027292_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_014566477.1|1027284_1028295_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_016380029.1|1029065_1031432_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003564240.1|1031589_1032237_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_003578292.1|1032442_1034458_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_012491295.1|1034725_1037617_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	1.9e-307
WP_003564246.1|1037968_1038508_+	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_003564248.1|1038670_1039558_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.4	1.1e-08
WP_003564250.1|1039554_1040583_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	51.2	2.3e-90
WP_012491296.1|1040587_1041535_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.7	9.2e-54
WP_003564253.1|1041920_1042376_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003564255.1|1042492_1043083_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	52.3	1.1e-52
1043349:1043367	attL	TGTGCAATTTGTGTGCAAT	NA	NA	NA	NA
WP_012491297.1|1043487_1044639_-|integrase	site-specific integrase	integrase	Q8W767	Lactobacillus_phage	100.0	2.2e-219
WP_012491298.1|1044749_1045511_-	hypothetical protein	NA	A0A1B0YA83	Lactobacillus_phage	100.0	1.2e-144
WP_012491299.1|1045529_1045760_+	hypothetical protein	NA	U5U783	Lactobacillus_phage	100.0	7.2e-37
WP_012491300.1|1046015_1046795_-	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	100.0	9.1e-116
WP_012491301.1|1046866_1047271_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1B0Y2S4	Lactobacillus_phage	100.0	2.1e-76
WP_012491302.1|1047267_1047594_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Y3N1	Lactobacillus_phage	100.0	3.4e-56
WP_012491303.1|1047850_1048063_+	helix-turn-helix transcriptional regulator	NA	A0A1B0YC38	Lactobacillus_phage	100.0	3.7e-32
WP_012491304.1|1048065_1048839_+	ORF6N domain-containing protein	NA	A0A1B0YEA7	Lactobacillus_phage	100.0	1.3e-143
WP_012491305.1|1048870_1049194_+	DUF771 domain-containing protein	NA	A0A1B0Y6D5	Lactobacillus_phage	100.0	1.2e-58
WP_012491308.1|1049461_1049773_-	hypothetical protein	NA	A0A1B0YA89	Lactobacillus_phage	100.0	8.2e-52
WP_012491309.1|1049833_1050025_+	hypothetical protein	NA	A0A1B0Y2S8	Lactobacillus_phage	100.0	6.4e-31
WP_012491310.1|1050038_1050278_+	hypothetical protein	NA	A0A1B0Y2S6	Lactobacillus_phage	100.0	7.7e-34
WP_012491311.1|1050282_1050777_+	siphovirus Gp157 family protein	NA	A0A1B0Y2S7	Lactobacillus_phage	100.0	9.9e-84
WP_012491312.1|1050788_1051019_+	hypothetical protein	NA	A0A1B0Y3N2	Lactobacillus_phage	100.0	3.0e-35
WP_012491313.1|1051018_1052386_+	DEAD/DEAH box helicase	NA	A0A1B0YC45	Lactobacillus_phage	100.0	1.6e-264
WP_012491314.1|1052387_1053128_+	AAA family ATPase	NA	A0A1B0YEB5	Lactobacillus_phage	100.0	4.1e-134
WP_012491315.1|1053130_1053640_+	hypothetical protein	NA	A0A1B0Y6E2	Lactobacillus_phage	100.0	4.1e-93
WP_012491316.1|1053706_1054504_+	bifunctional DNA primase/polymerase	NA	A0A1B0Y4T1	Lactobacillus_phage	100.0	1.4e-151
WP_012491317.1|1054508_1055744_+	helicase	NA	A0A1B0Y896	Lactobacillus_phage	100.0	1.1e-237
WP_012491318.1|1056018_1056333_+	VRR-NUC domain-containing protein	NA	A0A1B0YA93	Lactobacillus_phage	100.0	1.4e-54
WP_012491319.1|1056339_1056624_+	hypothetical protein	NA	A0A1B0Y2T1	Lactobacillus_phage	100.0	6.8e-45
WP_014951787.1|1056592_1056940_+	hypothetical protein	NA	A0A1B0Y2S9	Lactobacillus_phage	99.1	2.2e-58
WP_012491321.1|1056932_1057520_+	HNH endonuclease	NA	A0A1B0Y2T0	Lactobacillus_phage	100.0	9.9e-107
WP_012491322.1|1057506_1057761_+	hypothetical protein	NA	A0A1B0Y3N3	Lactobacillus_phage	100.0	2.3e-44
WP_012491323.1|1057757_1058162_+	transcriptional regulator	NA	A0A1B0YC57	Lactobacillus_phage	100.0	9.3e-72
WP_012491324.1|1058326_1058707_+	HNH endonuclease	NA	A0A1B0YEC6	Lactobacillus_phage	100.0	1.5e-71
WP_003582259.1|1058775_1059150_+	hypothetical protein	NA	A0A1B0YE76	Lactobacillus_phage	100.0	3.6e-62
WP_012491326.1|1059152_1060883_+|terminase	terminase large subunit	terminase	A0A1B0Y6B8	Lactobacillus_phage	100.0	0.0e+00
WP_012491327.1|1060901_1062137_+|portal	phage portal protein	portal	A0A1B0Y4Q9	Lactobacillus_phage	100.0	1.2e-234
WP_012491328.1|1062114_1062822_+|protease	Clp protease ClpP	protease	A0A1B0Y857	Lactobacillus_phage	100.0	1.4e-128
WP_012491329.1|1062826_1064056_+|capsid	phage major capsid protein	capsid	A0A1B0YA73	Lactobacillus_phage	100.0	4.3e-229
WP_012491330.1|1064129_1064378_+	hypothetical protein	NA	A0A1B0Y2R9	Lactobacillus_phage	100.0	7.0e-38
WP_003582271.1|1064391_1064718_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B0Y2R7	Lactobacillus_phage	100.0	7.0e-54
WP_012491255.1|1064656_1064995_+|head	phage head closure protein	head	A0A0N7IRA3	Lactobacillus_phage	100.0	2.2e-58
WP_012491331.1|1064978_1065308_+	hypothetical protein	NA	A0A1B0Y3M9	Lactobacillus_phage	100.0	3.1e-57
WP_012491332.1|1065297_1065681_+	hypothetical protein	NA	A0A1B0YC24	Lactobacillus_phage	100.0	2.6e-68
WP_012491333.1|1065692_1066340_+	hypothetical protein	NA	A0A1B0Y6C3	Lactobacillus_phage	100.0	1.2e-118
WP_003595114.1|1066416_1066782_+	hypothetical protein	NA	A0A1B0Y865	Lactobacillus_phage	100.0	4.6e-62
WP_012491334.1|1066862_1067024_+	hypothetical protein	NA	A0A1B0Y4R4	Lactobacillus_phage	100.0	5.7e-25
WP_012491335.1|1067043_1070214_+|tail	phage tail tape measure protein	tail	A0A1B0YA78	Lactobacillus_phage	100.0	0.0e+00
WP_012491336.1|1070220_1070916_+	hypothetical protein	NA	A0A1B0Y2S2	Lactobacillus_phage	100.0	8.3e-129
WP_012491337.1|1070912_1075316_+|tail	phage tail protein	tail	A0A1B0Y2S0	Lactobacillus_phage	100.0	0.0e+00
WP_012491263.1|1075344_1075770_+	DUF1617 family protein	NA	A0A1B0Y2S1	Lactobacillus_phage	100.0	8.8e-73
WP_012491338.1|1075772_1076042_+	hypothetical protein	NA	A0A1B0Y3N0	Lactobacillus_phage	100.0	1.3e-40
WP_012491339.1|1076089_1076476_+	hypothetical protein	NA	A0A1B0YC31	Lactobacillus_phage	100.0	5.6e-66
WP_004562059.1|1076456_1076663_+	hypothetical protein	NA	A0A1B0YE97	Lactobacillus_phage	100.0	1.4e-12
WP_012491341.1|1076659_1077121_+|holin	phage holin	holin	A0A1B0Y6C9	Lactobacillus_phage	100.0	1.2e-70
WP_012491342.1|1077122_1078175_+	peptidoglycan recognition protein	NA	A0A1B0Y4R9	Lactobacillus_phage	100.0	2.3e-207
1078257:1078275	attR	TGTGCAATTTGTGTGCAAT	NA	NA	NA	NA
>prophage 6
NC_010999	Lacticaseibacillus paracasei, complete genome	3079196	1217025	1294544	3079196	terminase,head,capsid,transposase,integrase,tail,portal,holin	Lactobacillus_phage(87.3%)	87	1217017:1217076	1294494:1295610
1217017:1217076	attL	GACGAATTGTCAACTCAAGTGCAACTTTTTACCCATGAAGACTTCTGATGGCGTCTTCCA	NA	NA	NA	NA
WP_003601683.1|1217025_1218024_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.8	1.8e-55
WP_012491408.1|1218082_1218964_+	DUF3324 domain-containing protein	NA	NA	NA	NA	NA
WP_012491409.1|1218938_1219259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014566766.1|1219272_1220886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491411.1|1221083_1222532_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_012491412.1|1222612_1224466_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_012491413.1|1224552_1225383_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_012491414.1|1226048_1228712_-	YfhO family protein	NA	NA	NA	NA	NA
WP_012491415.1|1229022_1230762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491416.1|1231113_1232043_-	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	47.7	3.9e-73
WP_012491417.1|1232129_1232768_-	YkyA family protein	NA	NA	NA	NA	NA
WP_012491418.1|1232895_1233861_+	membrane protein	NA	NA	NA	NA	NA
WP_080513729.1|1234008_1234137_+	transcription elongation factor GreAB	NA	NA	NA	NA	NA
WP_003566521.1|1234820_1235021_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	1.2e-19
WP_012491419.1|1235262_1235745_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003661214.1|1235744_1236386_+	glycoside hydrolase family 73 protein	NA	A0A0A7RUS8	Clostridium_phage	47.7	8.5e-27
WP_003566514.1|1236576_1237155_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003566511.1|1237161_1238490_+	purine permease	NA	Q9KX94	Enterobacteria_phage	31.7	1.6e-35
WP_003598329.1|1238510_1239620_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_012491420.1|1239689_1240985_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	28.5	4.4e-14
WP_012491421.1|1241106_1241676_-	branched-chain amino acid ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_003566502.1|1241685_1242432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012491422.1|1242517_1244773_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	44.6	4.7e-157
WP_003566498.1|1245238_1245844_+	VanZ family protein	NA	NA	NA	NA	NA
WP_003566496.1|1246015_1246873_+	GRP family sugar transporter	NA	NA	NA	NA	NA
WP_003566494.1|1247086_1248427_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_012491423.1|1248553_1249738_-|integrase	site-specific integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	100.0	6.6e-227
WP_012491424.1|1249867_1250197_-	hypothetical protein	NA	A0A0P0IJW6	Lactobacillus_phage	100.0	1.7e-39
WP_012491425.1|1250189_1250648_-	hypothetical protein	NA	A0A0P0ID57	Lactobacillus_phage	100.0	1.2e-86
WP_012491426.1|1250721_1250925_-	hypothetical protein	NA	A0A0P0IQK8	Lactobacillus_phage	100.0	8.5e-34
WP_012491427.1|1250948_1251374_-	pyridoxamine 5'-phosphate oxidase family protein	NA	A0A0P0I7K6	Lactobacillus_phage	100.0	9.8e-64
WP_012491428.1|1251472_1252366_-	hypothetical protein	NA	A0A1B0YE50	Lactobacillus_phage	100.0	4.3e-162
WP_014566771.1|1252416_1253760_-	DUF4041 domain-containing protein	NA	A0A1B0Y697	Lactobacillus_phage	100.0	7.6e-195
WP_012491430.1|1253849_1254200_-	hypothetical protein	NA	A0A1B0Y4P2	Lactobacillus_phage	100.0	3.3e-57
WP_012491431.1|1254256_1254835_-	hypothetical protein	NA	A0A1B0Y834	Lactobacillus_phage	100.0	8.8e-108
WP_012491432.1|1254893_1255313_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1B0YA58	Lactobacillus_phage	100.0	1.2e-77
WP_012491433.1|1255302_1255641_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Y2R0	Lactobacillus_phage	100.0	7.0e-57
WP_003585053.1|1255780_1255981_+	helix-turn-helix transcriptional regulator	NA	A0A1B0Y2Q9	Lactobacillus_phage	100.0	6.2e-29
WP_003574526.1|1256017_1256329_+	hypothetical protein	NA	A0A1B0Y2Q8	Lactobacillus_phage	100.0	2.2e-52
WP_012491434.1|1256622_1256769_+	hypothetical protein	NA	A0A1B0YC03	Lactobacillus_phage	100.0	1.0e-20
WP_012491435.1|1256834_1257383_+	hypothetical protein	NA	A0A1B0YE60	Lactobacillus_phage	100.0	1.1e-99
WP_003594176.1|1257361_1257583_+	helix-turn-helix domain-containing protein	NA	A0A1B0Y6A3	Lactobacillus_phage	100.0	1.8e-37
WP_014951828.1|1257823_1258231_+	hypothetical protein	NA	A0A1B0Y842	Lactobacillus_phage	100.0	1.1e-75
WP_012491438.1|1258243_1259107_+	recombinase RecT	NA	A0A1B0YA63	Lactobacillus_phage	100.0	1.1e-159
WP_012491439.1|1259087_1259888_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	92.8	6.2e-144
WP_012491440.1|1259903_1260869_+	DnaD domain protein	NA	A0A1B0Y2R2	Lactobacillus_phage	100.0	1.3e-140
WP_012491441.1|1260995_1261376_-	DUF2513 domain-containing protein	NA	A0A0P0IV09	Lactobacillus_phage	100.0	1.4e-66
WP_012491442.1|1261710_1261923_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IJY1	Lactobacillus_phage	100.0	1.3e-32
WP_012491443.1|1261919_1262369_+	hypothetical protein	NA	A0A0P0ID70	Lactobacillus_phage	100.0	1.2e-72
WP_012491444.1|1262415_1262670_+	hypothetical protein	NA	A0A0P0IQP0	Lactobacillus_phage	100.0	2.6e-40
WP_003661419.1|1262666_1263032_+	endodeoxyribonuclease	NA	A0A0P0I7M2	Lactobacillus_phage	100.0	1.8e-66
WP_012491445.1|1263044_1263338_+	hypothetical protein	NA	A0A0P0IXF6	Lactobacillus_phage	100.0	2.6e-47
WP_012491447.1|1263343_1263541_+	hypothetical protein	NA	A0A1B0Y850	Lactobacillus_phage	100.0	2.8e-29
WP_012491448.1|1263911_1264355_+	autolysin regulatory protein arpU	NA	A0A0P0IZI6	Lactobacillus_phage	100.0	1.3e-79
WP_012491450.1|1265839_1266988_+	hypothetical protein	NA	A0A0P0I3G0	Lactobacillus_phage	100.0	4.6e-225
WP_016379922.1|1266980_1267304_+	phage-related protein, ribonucleoside-diphosphate reductase	NA	A0A0P0IJY9	Lactobacillus_phage	100.0	1.0e-57
WP_012491452.1|1267340_1267913_+|terminase	terminase small subunit	terminase	A0A0P0IUY4	Lactobacillus_phage	100.0	1.0e-84
WP_012491453.1|1267896_1269150_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0P0I3B0	Lactobacillus_phage	100.0	3.5e-250
WP_012491454.1|1269154_1270582_+|portal	phage portal protein	portal	A0A0P0IJV3	Lactobacillus_phage	99.8	2.8e-264
WP_012491455.1|1270547_1271540_+|capsid	minor capsid protein	capsid	A0A0P0ID43	Lactobacillus_phage	100.0	1.6e-186
WP_012491456.1|1271664_1272303_+	DUF4355 domain-containing protein	NA	A0A0P0IQJ5	Lactobacillus_phage	100.0	7.2e-87
WP_003605853.1|1272315_1272630_+	hypothetical protein	NA	A0A0N7IR89	Lactobacillus_phage	100.0	2.7e-50
WP_012491457.1|1272643_1273684_+|capsid	major capsid protein	capsid	A0A0P0I7J2	Lactobacillus_phage	100.0	6.7e-191
WP_003605849.1|1273813_1274191_+	hypothetical protein	NA	A0A0P0IXC0	Lactobacillus_phage	100.0	7.4e-31
WP_012491458.1|1274194_1275073_+	hypothetical protein	NA	A0A0P0IJL6	Lactobacillus_phage	100.0	5.9e-180
WP_012491459.1|1275072_1275447_+|head,tail	phage head-tail connector protein	head,tail	A0A0P0IZF6	Lactobacillus_phage	100.0	1.0e-64
WP_012491460.1|1275451_1275754_+	hypothetical protein	NA	A0A0P0HRN0	Lactobacillus_phage	100.0	4.7e-52
WP_012491461.1|1275750_1276116_+|head,tail	phage head-tail joining protein	head,tail	A0A0P0IUZ3	Lactobacillus_phage	100.0	1.6e-59
WP_003566400.1|1276116_1276521_+	DUF3168 domain-containing protein	NA	A0A0P0I3C8	Lactobacillus_phage	100.0	4.6e-71
WP_012491462.1|1276532_1277132_+|tail	phage tail protein	tail	A0A0N7IR90	Lactobacillus_phage	100.0	6.1e-104
WP_003566397.1|1277270_1277606_+|tail	tail assembly chaperone	tail	A0A0P0IJV9	Lactobacillus_phage	100.0	9.4e-54
WP_003595195.1|1277704_1278058_+	hypothetical protein	NA	A0A0P0ID51	Lactobacillus_phage	100.0	8.7e-58
WP_012491464.1|1278050_1281386_+|tail	phage tail tape measure protein	tail	A0A0P0IQK3	Lactobacillus_phage	100.0	0.0e+00
WP_012491465.1|1281388_1283353_+|tail	phage tail family protein	tail	A0A0P0I7K0	Lactobacillus_phage	100.0	0.0e+00
WP_012491466.1|1283349_1286469_+|tail	phage tail protein	tail	A0A0P0IXD5	Lactobacillus_phage	100.0	0.0e+00
WP_012491467.1|1286478_1286802_+	hypothetical protein	NA	A0A0P0IJM9	Lactobacillus_phage	100.0	3.5e-53
WP_003573798.1|1286794_1286926_+	XkdX family protein	NA	A0A0P0HRS7	Lactobacillus_phage	100.0	6.5e-19
WP_003581984.1|1286981_1287257_+	hypothetical protein	NA	A0A0P0IZF9	Lactobacillus_phage	100.0	7.5e-49
WP_003594199.1|1287271_1287685_+|holin	phage holin	holin	A0A0N7IR91	Lactobacillus_phage	100.0	3.1e-46
WP_012491470.1|1287695_1288880_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0P0HRN9	Lactobacillus_phage	100.0	5.1e-227
WP_012491471.1|1288924_1289149_+	hypothetical protein	NA	A0A0P0IUZ5	Lactobacillus_phage	100.0	7.2e-34
WP_012491472.1|1289790_1290570_-	DUF1829 domain-containing protein	NA	NA	NA	NA	NA
WP_003564892.1|1290671_1290959_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_012491473.1|1291140_1291671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012491474.1|1291751_1292603_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_003564898.1|1292599_1293349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003601683.1|1293545_1294544_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.8	1.8e-55
1294494:1295610	attR	TGGAAGACGCCATCAGAAGTCTTCATGGGTAAAAAGTTGCACTTGAGTTGACAATTCGTCCCAGAAAAAAAGCCCGGCGACAAGCACCGAGCTAGCTTCACAGTCAGTTTTTTAGGATTTGACCACATCGACATTAGCATACAAGTTTGCAATGATTGCCAGCATGTCTTTTTCAGTCCGGTCCCAGCCGATCGTTTTAAGAAAGGCTTGACCATTTTGGACTTGGTTGCTGATCGCGTCAGGGTTGGCACAAGCATTTGCAAGCGTTTTGGCCAGATCTCGTTCATCAAGGTGACTGGCAAAATAGGTCCCGTCTTTCAAGAAGTAGCTTCCTGTGCCTTCCTTAAAATCAATGAGTGGCAGGCCAGTGCTCATCATTTCATAAGGGACAAGCGAAAAATTGGTCATAGATGGCGCGATCCCGAAATCAGCACTTTGGTAAAGTCGATTTAATTCCGGGGGAGTCAGCTTACCAAGGTTTTCACCATTGATGAATCGTTTGCTGCGGCCGGTACCGAAGTATTGAATTTTGAGATCGATTCCTTTGGCGCGCAGTAACTGGCGGCAATTTTCGAGGACAATCTGAATGTTGATGGGTGCGCGCCGCGGGCTGCTCCACTTGGTATAGACAGCAAGCTTGATTTGCTTCTTTTGTTGATAAGGTCCCATGTCGCGTTCCTTGAATGGATACCGTGCGACATCGACAGGAAAGTTAATCACATCAATAGGACTGTGAACCTTGCAATGCATGGTGATCATGTGGGCACACCATGGACCAAGCGATACCATGTGCAGACCTAGACTGTAAGTTCGTCGCGCCATCTGATAGCGATCGCCATATGGATAGAAATACGGTTCGTAATCTTGAACAAAATACATTTTGTACCCCGGTTTGTTCTTGATCACATAAACGGATTCCCATAACGTGGCGACCCAAATATCGGAACGATGGGACTCAAGTTCGCCCATTGGCAGACAGGTTCCTTTGTAACCGGGATAATTAAATTCAGCATTCTGAATCATTTCGTCTTGGCTTTGTGGGACATAGCTTAAATAGTAGACATCGTAACCGGCGTTGGCCAGCAGCGTACCTAGATGCAGCATCGTTGTTTGACCG	NA	NA	NA	NA
>prophage 7
NC_010999	Lacticaseibacillus paracasei, complete genome	3079196	1385499	1441196	3079196	lysis,tRNA,transposase	Leptospira_phage(28.57%)	54	NA	NA
WP_003599410.1|1385499_1386429_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
WP_012491515.1|1386867_1387578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491519.1|1389469_1390051_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_012491520.1|1390146_1391226_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_012491521.1|1391230_1392163_-	SIR2 family protein	NA	NA	NA	NA	NA
WP_012491522.1|1392231_1392552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012491523.1|1392733_1394488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012491524.1|1395093_1395282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491525.1|1395283_1395463_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_012491526.1|1395577_1396186_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157847124.1|1396110_1396500_+|transposase	transposase	transposase	S5VLC8	Leptospira_phage	37.1	5.1e-11
WP_016364311.1|1396390_1396855_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014951865.1|1396851_1397058_+|transposase	transposase domain-containing protein	transposase	S5VTD3	Leptospira_phage	40.7	2.9e-05
WP_003565106.1|1397364_1397976_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_012491531.1|1398151_1398634_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_003565110.1|1398810_1400514_+	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_003574834.1|1400822_1401980_+	cysteine desulfurase	NA	NA	NA	NA	NA
WP_012491532.1|1401996_1403214_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_003570094.1|1403519_1404173_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_003565119.1|1404546_1407189_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	41.4	9.2e-152
WP_012491533.1|1407481_1408759_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_003565122.1|1408950_1409595_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003565124.1|1409656_1410325_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_003565127.1|1410464_1411466_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_012491534.1|1411554_1412415_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003574845.1|1412416_1412947_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_012491535.1|1412960_1413617_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_003565134.1|1413617_1414415_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_003565136.1|1415080_1415737_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003565139.1|1415749_1416388_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.5	2.6e-28
WP_003565141.1|1416384_1417197_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012491536.1|1417429_1418863_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_003565145.1|1418947_1419067_-	DUF4044 domain-containing protein	NA	NA	NA	NA	NA
WP_003565147.1|1419417_1419750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003565149.1|1419925_1420357_+	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_003565152.1|1420359_1421301_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_003565154.1|1421313_1421679_+	cell division protein FtsL	NA	NA	NA	NA	NA
WP_012491538.1|1421675_1423823_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_003565157.1|1423837_1424803_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_012491540.1|1424833_1426213_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_003570121.1|1426212_1427304_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_003565163.1|1427309_1428164_+	cell division protein FtsQ/DivIB	NA	NA	NA	NA	NA
WP_003565166.1|1428273_1429620_+	cell division protein FtsA	NA	NA	NA	NA	NA
WP_003574874.1|1429644_1430904_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_003565171.1|1430921_1431377_+	cell division protein SepF	NA	NA	NA	NA	NA
WP_003565173.1|1431388_1431682_+	YggT family protein	NA	NA	NA	NA	NA
WP_012491541.1|1431688_1432468_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_012491542.1|1432525_1433308_+	DivIVA domain-containing protein	NA	NA	NA	NA	NA
WP_012491543.1|1433554_1436341_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	27.0	5.4e-86
WP_003570139.1|1436353_1436575_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_003565182.1|1436711_1437617_-	phosphate ABC transporter substrate-binding protein PstS family protein	NA	NA	NA	NA	NA
WP_003658327.1|1437792_1439229_+	MFS transporter	NA	NA	NA	NA	NA
WP_003565187.1|1439325_1440537_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	26.3	1.5e-32
WP_003578969.1|1440533_1441196_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis family protein	lysis	NA	NA	NA	NA
>prophage 8
NC_010999	Lacticaseibacillus paracasei, complete genome	3079196	2052834	2074674	3079196	protease,transposase	unidentified_phage(40.0%)	18	NA	NA
WP_012491745.1|2052834_2053596_+|protease	matrixin family metalloprotease	protease	G9I094	Helicoverpa_zea_nudivirus	53.1	1.7e-05
WP_003599410.1|2053763_2054693_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
WP_012491746.1|2054817_2055585_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_012491747.1|2055897_2057493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003566275.1|2058193_2058523_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012491748.1|2058899_2059544_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_012491750.1|2061093_2061738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012491751.1|2061718_2062009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123796558.1|2062438_2063225_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012491754.1|2063923_2064445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101869771.1|2064617_2065734_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.6	1.0e-27
WP_003595460.1|2066993_2067902_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_003599410.1|2068185_2069115_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
WP_012491757.1|2069228_2070125_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_016370780.1|2070128_2070986_-	M55 family metallopeptidase	NA	NA	NA	NA	NA
WP_012491759.1|2070985_2072071_-	M42 family peptidase	NA	NA	NA	NA	NA
WP_012491760.1|2072099_2073719_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002816607.1|2073990_2074674_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	2.1e-60
>prophage 9
NC_010999	Lacticaseibacillus paracasei, complete genome	3079196	2514830	2576694	3079196	protease,bacteriocin,transposase	unidentified_phage(28.57%)	65	NA	NA
WP_003567328.1|2514830_2515109_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003580845.1|2515132_2515417_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003588783.1|2515610_2515907_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003567335.1|2516008_2517364_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003580849.1|2517669_2517981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567340.1|2518053_2518404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012491940.1|2518577_2519957_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_012491943.1|2522625_2522763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016370360.1|2523131_2524250_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_003567351.1|2524254_2525061_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016370359.1|2525422_2525620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014566639.1|2526166_2526406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003599800.1|2526678_2526852_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003591780.1|2526890_2527064_-|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_012491945.1|2527385_2527610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014566641.1|2527924_2528089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012491947.1|2528326_2529127_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_012491948.1|2529415_2529574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003599808.1|2529689_2530022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014566643.1|2530277_2530946_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003588837.1|2530926_2531118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003580886.1|2531436_2531772_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003580888.1|2531890_2532487_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_012491950.1|2532757_2533066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567374.1|2533201_2533417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567376.1|2533413_2533647_-|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003567378.1|2533918_2534872_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	24.6	6.3e-10
WP_003580891.1|2535076_2535811_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012491951.1|2535836_2537000_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_012491952.1|2537510_2538887_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_012491953.1|2539019_2539778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567390.1|2540069_2541677_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_003596096.1|2542064_2544782_+	HAD-IC family P-type ATPase	NA	M1HJQ2	Paramecium_bursaria_Chlorella_virus	29.1	1.2e-61
WP_003580900.1|2545081_2545447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003585579.1|2545600_2546974_-	MFS transporter	NA	NA	NA	NA	NA
WP_012491954.1|2547013_2548543_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_003567401.1|2548788_2548980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567403.1|2549108_2549747_+	cation transporter	NA	NA	NA	NA	NA
WP_003567405.1|2549767_2550100_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003567408.1|2550220_2551162_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012491956.1|2551158_2552055_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003567413.1|2552051_2552795_-	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	1.1e-12
WP_012491957.1|2553070_2554537_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_012491958.1|2554737_2555007_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_003599410.1|2555174_2556104_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
WP_003567418.1|2556142_2556262_-	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_003576335.1|2556462_2557380_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003567422.1|2557619_2558261_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012491959.1|2558378_2559011_-	NUDIX hydrolase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003599857.1|2559167_2559692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012491960.1|2559954_2561790_+	membrane protein	NA	NA	NA	NA	NA
WP_003585593.1|2561940_2562843_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003567431.1|2563086_2563236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012491961.1|2563840_2566234_-	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
WP_012491962.1|2566408_2567593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014566650.1|2567827_2569669_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_012491964.1|2569835_2570189_-	CrcB family protein	NA	NA	NA	NA	NA
WP_003567441.1|2570182_2570593_-	CrcB family protein	NA	NA	NA	NA	NA
WP_014566651.1|2571182_2571470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012491966.1|2571644_2571905_+	2-phosphoglycerate dehydratase	NA	W6LP63	Streptococcus_phage	61.8	5.0e-10
WP_003567447.1|2572286_2573234_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003567449.1|2573293_2574067_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	1.6e-24
WP_003567451.1|2574066_2574849_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_003606005.1|2574845_2575649_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_003599410.1|2575764_2576694_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
>prophage 10
NC_010999	Lacticaseibacillus paracasei, complete genome	3079196	3032887	3044256	3079196	terminase,head,capsid,tail,portal	uncultured_Caudovirales_phage(37.5%)	17	NA	NA
WP_012492208.1|3032887_3033526_-	helix-turn-helix domain-containing protein	NA	L0P7E1	Lactobacillus_phage	27.6	2.4e-05
WP_003594046.1|3033693_3033969_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012492209.1|3034036_3034258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012492211.1|3034368_3034560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012492212.1|3034606_3034897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014566704.1|3034893_3035082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014566705.1|3035065_3035878_+	bifunctional DNA primase/polymerase	NA	Q854C1	Mycobacterium_phage	34.2	6.7e-13
WP_012492215.1|3035890_3037477_+	primase	NA	A0A1B1P7L5	Bacillus_phage	27.9	4.0e-25
WP_012492216.1|3037802_3038138_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_012492217.1|3038142_3038328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014952495.1|3038324_3038747_+	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	45.4	1.2e-21
WP_010489224.1|3038863_3039334_+|terminase	phage terminase small subunit P27 family	terminase	M1PKP2	Streptococcus_phage	26.5	4.6e-06
WP_012492218.1|3039330_3041034_+|terminase	terminase	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	42.1	2.3e-116
WP_014952496.1|3040999_3041179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010489222.1|3041183_3042365_+|portal	phage portal protein	portal	A0A2H4JB06	uncultured_Caudovirales_phage	35.5	2.8e-60
WP_012492220.1|3042351_3043908_+|capsid	phage major capsid protein	capsid	A0A2H4J9X8	uncultured_Caudovirales_phage	32.0	4.6e-34
WP_003574397.1|3043962_3044256_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
