The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_011750	Escherichia coli IAI39, complete genome	5132068	487489	589935	5132068	tail,transposase,head,protease,tRNA	Escherichia_phage(35.48%)	97	NA	NA
WP_001260691.1|487489_489208_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001189111.1|489872_491381_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_001051720.1|492797_493616_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000239176.1|493645_494356_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635526.1|494369_494792_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185283.1|494788_495334_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|495499_495700_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062315.1|495686_495947_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_102818574.1|496025_497373_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
WP_012602204.1|497538_498318_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_001298568.1|498304_498982_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	1.2e-26
WP_000904502.1|499127_500045_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_000970320.1|500041_500500_+	NfeD family protein	NA	NA	NA	NA	NA
WP_001001644.1|500602_500965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000859802.1|501330_502347_+	adhesin	NA	NA	NA	NA	NA
WP_001361687.1|502400_502823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000664216.1|502819_503023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000483766.1|503123_504470_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_001026753.1|504458_504872_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_164930344.1|505628_507029_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|507085_508387_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_012602207.1|508408_509554_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	43.0	2.2e-49
WP_000540951.1|509683_510469_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_012602208.1|510479_511715_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703915.1|511736_512786_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_001015004.1|513103_514771_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495385.1|514780_516040_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152513.1|516050_516866_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855388.1|516862_517756_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815540.1|517988_519056_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|519052_519562_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212239.1|519679_520402_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000256006.1|520404_520899_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_165442301.1|521127_522340_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	97.0	9.7e-165
WP_000912345.1|522383_523769_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143509.1|523804_524326_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|524433_524646_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729161.1|524647_525514_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|525985_526528_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988385.1|526746_527439_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_012602209.1|527469_530079_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691075.1|530091_531099_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_032142694.1|531125_531626_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805414.1|531628_532261_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_139371347.1|532897_534111_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000737991.1|535078_535306_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001049530.1|535375_535912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001588496.1|536262_536565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000929262.1|536773_537139_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000999171.1|537131_537356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000790823.1|537358_537646_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000125506.1|539750_539996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126719.1|539992_540442_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000228109.1|540659_541700_+	hypothetical protein	NA	C6ZCY2	Enterobacteria_phage	42.4	2.0e-65
WP_000190772.1|541709_542051_+|head	head decoration protein	head	NA	NA	NA	NA
WP_001178674.1|542062_542446_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000688840.1|543044_544187_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_021521694.1|544420_545185_+	hypothetical protein	NA	C6ZCY2	Enterobacteria_phage	99.2	4.0e-140
WP_000158914.1|545226_545625_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	94.7	1.4e-59
WP_000752996.1|545636_545990_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	1.5e-62
WP_000975065.1|546001_546580_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	3.5e-80
WP_000683128.1|546576_546972_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_021521695.1|546979_547720_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	99.2	2.9e-132
WP_000479153.1|547735_548158_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459482.1|548139_548598_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	1.8e-63
WP_000730013.1|548566_551113_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.2	0.0e+00
WP_000847348.1|551109_551439_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	1.8e-57
WP_001152615.1|551438_552137_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	1.6e-132
WP_000140722.1|552142_552886_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.7e-149
WP_000090891.1|552822_553455_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000515353.1|553515_556995_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.1	0.0e+00
WP_001228262.1|557062_557662_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	93.0	4.4e-102
WP_000741758.1|557726_560126_+	hypothetical protein	NA	A0A0E3M194	Enterobacteria_phage	55.2	3.9e-133
WP_000654151.1|560122_560404_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	3.1e-18
WP_000235984.1|560413_561118_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	9.2e-59
WP_000355609.1|561128_561422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000239881.1|561615_562284_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001226375.1|562822_564307_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|564493_565447_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177457.1|565958_566720_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
WP_001224582.1|566902_567793_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_012602218.1|567793_570766_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000253852.1|573139_574582_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.2	2.3e-11
WP_000770953.1|574571_575255_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000074212.1|575411_576794_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000709873.1|576817_577150_+	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000717104.1|577165_578389_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000574011.1|578400_581544_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	1.7e-59
WP_000786337.1|581645_583022_+	phenylalanine transporter	NA	NA	NA	NA	NA
WP_001153128.1|583102_584350_-	mechanosensitive ion channel YbdG	NA	NA	NA	NA	NA
WP_000351499.1|584457_585111_-	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_000360950.1|585189_585573_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000682505.1|585637_585886_-	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_001130675.1|585951_587070_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_024190521.1|587521_587674_+	type I toxin-antitoxin system toxin HokE	NA	NA	NA	NA	NA
WP_077627367.1|587795_588416_-	enterobactin synthase subunit EntD	NA	NA	NA	NA	NA
WP_102818574.1|588587_589935_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
>prophage 2
NC_011750	Escherichia coli IAI39, complete genome	5132068	903232	943349	5132068	transposase,tail	Enterobacteria_phage(52.94%)	31	NA	NA
WP_000868863.1|903232_904258_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000691708.1|904759_904843_-	protein YohP	NA	NA	NA	NA	NA
WP_000079542.1|906555_907317_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001296821.1|907435_908014_-	DedA family protein	NA	NA	NA	NA	NA
WP_012602251.1|908183_908771_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_001295432.1|908944_909877_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_024190524.1|909915_911631_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_000871525.1|911827_914125_+	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_001131263.1|914376_915294_+	glycine betaine ABC transporter substrate-binding protein OsmF	NA	NA	NA	NA	NA
WP_000221779.1|915300_916458_+	glycine betaine ABC transporter permease YehY	NA	NA	NA	NA	NA
WP_000569342.1|916450_917377_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
WP_000783120.1|917381_918113_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|918093_918201_-	protein YohO	NA	NA	NA	NA	NA
WP_042030043.1|918260_918947_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.9	8.6e-102
WP_001189111.1|920042_921551_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_000807940.1|925921_926263_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_012602253.1|926262_926961_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.1	1.6e-127
WP_000194709.1|926971_927715_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	8.6e-148
WP_072037205.1|927660_928293_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.0	1.4e-103
WP_000514728.1|928636_932329_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.8	0.0e+00
WP_001228261.1|932397_932997_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	92.5	4.4e-102
WP_000216561.1|933148_935209_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	65.7	4.2e-152
WP_001204578.1|935205_935484_+	hypothetical protein	NA	A0A0E3GMJ7	Enterobacteria_phage	47.3	2.3e-21
WP_000355615.1|935493_935790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001261928.1|935907_936156_-	DinI-like family protein	NA	H6WZN4	Escherichia_phage	84.0	1.8e-30
WP_001309587.1|936670_938356_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
WP_001308766.1|938352_939072_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|939118_939589_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|939629_940091_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001329821.1|940215_942216_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001329822.1|942212_943349_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	4.2e-162
>prophage 3
NC_011750	Escherichia coli IAI39, complete genome	5132068	1038977	1047833	5132068		Enterobacteria_phage(42.86%)	8	NA	NA
WP_001116062.1|1038977_1040372_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	2.4e-18
WP_000183060.1|1040546_1041440_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000699450.1|1041812_1042898_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	3.9e-101
WP_001023616.1|1042897_1043797_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	8.2e-28
WP_000857508.1|1043855_1044734_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	8.7e-107
WP_001100801.1|1044738_1045284_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	53.9	1.6e-47
WP_001060534.1|1045287_1046718_+	O7 family O-antigen flippase	NA	NA	NA	NA	NA
WP_000998544.1|1046720_1047833_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A0P0YLZ6	Yellowstone_lake_phycodnavirus	25.7	1.3e-14
>prophage 4
NC_011750	Escherichia coli IAI39, complete genome	5132068	1509235	1616525	5132068	portal,terminase,tail,integrase,transposase,lysis,head,protease,capsid,tRNA	Escherichia_phage(31.58%)	105	1501712:1501729	1587736:1587753
1501712:1501729	attL	GCAGCCAGATAATATAGT	NA	NA	NA	NA
WP_000483766.1|1509235_1510582_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000483371.1|1510643_1511411_+	7-alpha-hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
WP_000969092.1|1511631_1512222_+	DNA-binding transcriptional regulator UidR	NA	NA	NA	NA	NA
WP_000945913.1|1512613_1514425_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.8	0.0e+00
WP_001075887.1|1514421_1515795_+	glucuronide transporter	NA	NA	NA	NA	NA
WP_001227044.1|1515833_1517099_+	glucuronide uptake porin UidC	NA	NA	NA	NA	NA
WP_001043392.1|1517143_1518652_-	YdgA family protein	NA	NA	NA	NA	NA
WP_001170654.1|1518752_1519928_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000066639.1|1520126_1521773_+	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_001099081.1|1521915_1523319_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_012602309.1|1523315_1524245_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_000732505.1|1524320_1525622_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.2	4.2e-17
WP_001317857.1|1525625_1526345_-	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000524861.1|1526473_1526809_+	GlpM family protein	NA	NA	NA	NA	NA
WP_000520815.1|1526805_1527528_-	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_000412379.1|1527564_1528947_-	amino acid permease	NA	NA	NA	NA	NA
WP_000769322.1|1529132_1530077_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_012602311.1|1530601_1532134_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000014036.1|1532144_1533533_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_001118241.1|1533557_1534592_-	AI-2 transporter TqsA	NA	NA	NA	NA	NA
WP_000276140.1|1535003_1535369_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_000046661.1|1535355_1535685_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_001260849.1|1535723_1536545_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|1536644_1536728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743943.1|1536820_1537156_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|1537552_1538806_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|1538912_1539806_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|1539940_1541161_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|1541285_1541981_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_164930346.1|1541933_1543226_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148690.1|1543383_1543998_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526500.1|1544040_1544895_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|1544896_1545514_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_012602313.1|1545524_1547948_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.8	2.8e-208
WP_000041644.1|1548008_1550435_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.6e-211
WP_001295396.1|1550633_1550939_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001445899.1|1551046_1551757_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|1551759_1552320_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|1552354_1552696_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001314753.1|1552830_1553157_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.2e-23
WP_012602314.1|1553362_1554577_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	2.4e-46
WP_000836046.1|1554588_1555608_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	5.7e-17
WP_001360138.1|1555665_1555776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876958.1|1555795_1557076_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	3.3e-155
WP_001189111.1|1559491_1561000_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_000664577.1|1561622_1562036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054512.1|1562016_1562982_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	2.2e-55
WP_001151262.1|1563022_1563445_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_001310834.1|1563441_1563798_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
WP_072096395.1|1564911_1565130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000955178.1|1565104_1565287_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_000589007.1|1565464_1566688_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000087856.1|1566749_1567052_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001702848.1|1567087_1567906_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	5.9e-65
WP_001323403.1|1568508_1569288_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_001310017.1|1569287_1570310_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-201
WP_120795389.1|1570924_1571014_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|1571068_1571281_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|1571581_1571797_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|1572550_1572766_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|1572770_1573082_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|1573078_1573612_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|1573608_1574106_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|1574468_1574681_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|1574691_1574880_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|1574882_1574948_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|1575027_1575183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|1575354_1575528_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001571459.1|1575679_1576090_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.3	1.2e-55
WP_001368374.1|1576147_1576381_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453587.1|1576769_1577315_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027298.1|1577289_1579215_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000198149.1|1579211_1579418_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001595430.1|1579414_1581016_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	1.6e-308
WP_000123221.1|1580996_1582328_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	97.7	1.2e-229
WP_000201478.1|1582337_1582670_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	90.9	9.7e-51
WP_000118192.1|1582725_1583751_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	95.6	5.4e-185
WP_012602318.1|1583753_1584116_+	DNA packaging protein	NA	A0A2R9YJP4	Escherichia_phage	86.9	3.8e-40
WP_001189111.1|1584677_1586186_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_015674644.1|1588830_1588992_-	hypothetical protein	NA	NA	NA	NA	NA
1587736:1587753	attR	GCAGCCAGATAATATAGT	NA	NA	NA	NA
WP_000340206.1|1589111_1590848_-	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000051554.1|1590942_1591857_-	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_001295994.1|1591956_1592568_+	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000020138.1|1592569_1593304_-	flagellar brake protein	NA	NA	NA	NA	NA
WP_001330447.1|1593504_1593759_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_001295995.1|1593808_1595779_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000576816.1|1595804_1596659_-	ModD protein	NA	NA	NA	NA	NA
WP_000904008.1|1596655_1597468_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000173316.1|1597477_1598236_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	2.0e-14
WP_001261263.1|1598232_1599213_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000060138.1|1599212_1600235_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000841923.1|1600564_1602262_-	alpha,alpha-trehalase	NA	NA	NA	NA	NA
WP_012602320.1|1602581_1604000_-	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_012602321.1|1604010_1604643_-	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_000733699.1|1604653_1605724_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001205390.1|1605942_1607871_+	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_001298097.1|1607907_1608138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000505866.1|1608275_1609367_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000152933.1|1609483_1610068_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000823885.1|1610345_1610624_+	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_001033361.1|1610678_1612358_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	1.0e-23
WP_001298109.1|1612482_1613430_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001260310.1|1613580_1614432_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001130702.1|1614431_1615055_-	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001330437.1|1615268_1616525_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
>prophage 5
NC_011750	Escherichia coli IAI39, complete genome	5132068	1865215	2074507	5132068	portal,tail,terminase,integrase,transposase,lysis,head,protease,plate,capsid,tRNA	Enterobacteria_phage(22.63%)	238	1931857:1931916	2077843:2078638
WP_139371347.1|1865215_1866429_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000665265.1|1870425_1870731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172485.1|1871368_1872391_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774178.1|1872417_1873293_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000558522.1|1873316_1873607_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001286534.1|1873663_1874422_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_001313828.1|1874425_1875340_-	bestrophin family inner membrane protein	NA	NA	NA	NA	NA
WP_000854646.1|1875536_1876988_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_000558442.1|1877215_1878634_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
WP_001191031.1|1878772_1879132_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000257409.1|1879131_1880058_-	glutaminase B	NA	NA	NA	NA	NA
WP_000156622.1|1880121_1881510_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000972391.1|1882242_1882461_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001011797.1|1882551_1883652_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.0	1.7e-176
WP_000980413.1|1883648_1884134_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_001282778.1|1884130_1887208_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.9	0.0e+00
WP_000763311.1|1887200_1887320_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|1887334_1887637_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207660.1|1887691_1888207_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_000046120.1|1888216_1889389_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	2.1e-204
WP_001067838.1|1889602_1890307_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.0e-139
WP_000104795.1|1890343_1891519_-	hypothetical protein	NA	M1TAS6	Escherichia_phage	79.7	1.8e-171
WP_001086812.1|1891515_1892121_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
WP_000268280.1|1892113_1893022_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	7.8e-143
WP_000177590.1|1893008_1893368_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_000993775.1|1893364_1893943_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
WP_000829122.1|1894011_1894458_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	5.1e-63
WP_001039944.1|1894450_1894882_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	4.4e-72
WP_001337513.1|1894977_1895406_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.3	2.9e-47
WP_000727856.1|1895402_1895780_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.9e-16
WP_001069929.1|1895781_1896294_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.7	5.2e-88
WP_000171573.1|1896274_1896490_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	78.9	6.9e-26
WP_000868175.1|1896493_1896697_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673508.1|1896696_1897161_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	3.2e-76
WP_000059199.1|1897256_1897907_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.4	5.6e-111
WP_000742511.1|1897910_1898969_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000216223.1|1898985_1899819_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.1e-122
WP_001067838.1|1901131_1901836_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.0e-139
WP_000520381.1|1902555_1903590_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.6	1.2e-168
WP_139371347.1|1903719_1904932_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000258570.1|1905867_1906983_+	putative protein YneK	NA	NA	NA	NA	NA
WP_000210799.1|1907132_1908323_+	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_000885033.1|1908347_1909013_-	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000843419.1|1909224_1909659_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000091199.1|1909679_1910063_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803527.1|1910094_1910313_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000012599.1|1910369_1911809_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.7	2.4e-29
WP_001022788.1|1911833_1913507_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_001361816.1|1913562_1913874_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_001238644.1|1913901_1915224_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_000722567.1|1915337_1915649_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000577189.1|1915847_1916546_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000087203.1|1916590_1917490_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_001054193.1|1917684_1918872_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000559549.1|1918903_1919302_-	rhodanese	NA	NA	NA	NA	NA
WP_122998293.1|1919396_1920368_+	transcriptional regulator FtrA	NA	NA	NA	NA	NA
WP_000901367.1|1920475_1920571_+	protein MgtS	NA	NA	NA	NA	NA
WP_000592819.1|1920789_1921680_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.0	1.4e-19
WP_000671736.1|1921934_1922327_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_012602359.1|1922692_1924738_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000636571.1|1924874_1925621_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000215553.1|1925709_1926396_+	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_000214712.1|1926573_1926777_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527774.1|1926812_1928273_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	28.9	4.3e-42
WP_000347480.1|1928362_1929646_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1930249_1930363_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1930431_1930665_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_139371347.1|1931383_1932597_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
1931857:1931916	attL	CGTAAGTAAAATCAGCCACCCACAGCTGGTCAGGTCGTTCTGCCACGAACTGACGGTTTA	NA	NA	NA	NA
WP_000235983.1|1932602_1933256_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	62.8	1.6e-52
WP_000654151.1|1933265_1933547_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	3.1e-18
WP_000741758.1|1933543_1935943_-	hypothetical protein	NA	A0A0E3M194	Enterobacteria_phage	55.2	3.9e-133
WP_001228263.1|1936007_1936607_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	93.5	2.0e-102
WP_000514727.1|1936674_1940475_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	84.1	0.0e+00
WP_072037205.1|1940818_1941451_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.0	1.4e-103
WP_000194709.1|1941396_1942140_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	8.6e-148
WP_001327694.1|1942145_1942844_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.0	7.6e-130
WP_000847298.1|1942843_1943173_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082401.1|1943169_1945731_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.0	0.0e+00
WP_001538601.1|1945711_1946125_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_001299690.1|1946151_1946583_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_000235034.1|1946601_1947348_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.0	5.6e-123
WP_000683079.1|1947355_1947751_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974978.1|1947747_1948281_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	2.0e-58
WP_001204533.1|1948296_1948650_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_000201498.1|1948642_1949026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522592.1|1949077_1950106_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.7e-114
WP_000256835.1|1950163_1950511_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	2.9e-21
WP_001253972.1|1950547_1952053_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	2.3e-99
WP_012602360.1|1952042_1953635_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	1.1e-184
WP_000259002.1|1953631_1953838_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_012602361.1|1953821_1955750_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	3.9e-261
WP_000235436.1|1955721_1956231_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001189111.1|1957972_1959481_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_000197840.1|1960854_1961925_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|1961934_1963233_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190866.1|1963562_1965095_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_000234823.1|1965146_1965866_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406367.1|1966088_1967630_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943460.1|1967775_1968306_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457628.1|1968351_1969620_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	3.9e-209
WP_000897372.1|1969619_1970039_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.9	5.3e-38
WP_000115885.1|1970171_1970690_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_000343765.1|1970708_1971929_+|transposase	ISL3-like element ISEc53 family transposase	transposase	NA	NA	NA	NA
WP_001306826.1|1972303_1973215_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|1973421_1973883_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|1973959_1974619_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|1974690_1974984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000874956.1|1974995_1975154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000693755.1|1975224_1975626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001056845.1|1975745_1976114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|1976633_1977329_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|1977352_1978165_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|1978168_1978435_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_015674642.1|1979179_1979299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071781438.1|1979259_1979445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000120099.1|1979545_1979719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304448.1|1979780_1980065_+	glycine zipper family protein	NA	NA	NA	NA	NA
WP_000979977.1|1980068_1980404_+	YmgD family protein	NA	NA	NA	NA	NA
WP_024190533.1|1980461_1982783_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	43.3	7.9e-91
WP_001065862.1|1983509_1983728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012602364.1|1983859_1985383_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_139371347.1|1985790_1987003_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_012602365.1|1987043_1987280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000888777.1|1987392_1987659_-	biofilm/acid-resistance regulator AriR	NA	NA	NA	NA	NA
WP_000858011.1|1987687_1987960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000554153.1|1988002_1988239_-	two-component-system connector protein YcgZ	NA	NA	NA	NA	NA
WP_012311660.1|1988552_1989764_+	blue light-responsive regulator BluF	NA	NA	NA	NA	NA
WP_000332300.1|1989968_1990700_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	3.5e-53
WP_000373096.1|1990920_1991325_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_019842521.1|1991377_1991488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000871293.1|1992029_1992353_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	4.0e-41
WP_000539892.1|1992455_1992608_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	1.6e-21
WP_001304451.1|1993079_1993838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087762043.1|1994560_1995451_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000983716.1|1995450_1996278_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	G9BWD6	Planktothrix_phage	29.0	7.6e-12
WP_001101730.1|1996274_1997132_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968127.1|1997128_1997986_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_000355609.1|1998077_1998371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235967.1|1998381_1999086_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
WP_000654154.1|1999095_1999377_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.2e-17
WP_000741757.1|1999373_2001773_-|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	55.2	3.0e-133
WP_001281695.1|2002171_2002561_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
WP_000988472.1|2002532_2002985_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.9	1.6e-24
WP_000123379.1|2002974_2003190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000631819.1|2003179_2003410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000132037.1|2003406_2004090_-	DUF2786 domain-containing protein	NA	L7P7W8	Pseudomonas_phage	36.2	1.4e-24
WP_000763554.1|2004086_2004302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299260.1|2004316_2004613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000632580.1|2004622_2004895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|2005183_2005714_-	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000843446.1|2005741_2006011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000960680.1|2006013_2007180_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.7	9.7e-122
WP_000990532.1|2007190_2008960_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	68.5	1.4e-228
WP_000533821.1|2008963_2009878_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	52.5	6.8e-70
WP_000049025.1|2009888_2010197_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	5.5e-24
WP_000200153.1|2010249_2010438_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	6.1e-18
WP_001259268.1|2010488_2010950_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000031883.1|2010946_2011933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001330012.1|2012017_2012605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000149906.1|2012642_2013119_-	ABC transporter ATPase	NA	NA	NA	NA	NA
WP_000793146.1|2013249_2013600_+	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_001104439.1|2013602_2014343_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000264661.1|2014326_2014977_+	hypothetical protein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
WP_000175097.1|2014973_2015300_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_000227700.1|2015299_2015611_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000124059.1|2015610_2016060_+	DUF3486 family protein	NA	Q6QIC2	Burkholderia_phage	70.5	3.8e-50
WP_001404333.1|2016215_2017748_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	63.0	2.1e-185
WP_000090685.1|2017747_2019244_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	4.0e-168
WP_000117548.1|2019224_2020046_+|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
WP_000135514.1|2020048_2020507_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_001273067.1|2020721_2021837_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	5.5e-98
WP_001286902.1|2021851_2022805_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	9.9e-64
WP_000537457.1|2022814_2023153_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_000271668.1|2023154_2023601_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_001101804.1|2023600_2024065_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_012602372.1|2024061_2024316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729834.1|2024305_2025733_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_165442306.1|2025729_2026254_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	66.7	3.1e-67
WP_000084213.1|2026635_2026971_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001202894.1|2026894_2027053_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000016537.1|2027128_2030080_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.6	2.0e-83
WP_000458386.1|2030079_2030964_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_012602373.1|2030960_2031176_+	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000808005.1|2031163_2032318_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	2.5e-85
WP_000148265.1|2032314_2032911_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	5.4e-36
WP_001219102.1|2033303_2034407_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	8.3e-107
WP_000138756.1|2034399_2034978_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_000527462.1|2034980_2037041_+	short-chain fatty acid transporter	NA	A0A0K2FIZ6	Escherichia_phage	43.7	7.4e-40
WP_000072166.1|2037047_2037662_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.5	1.7e-61
WP_021565985.1|2037661_2038174_-|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	48.5	4.4e-34
WP_000904922.1|2038245_2038818_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_000867568.1|2039566_2040115_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_000881610.1|2040677_2040860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|2041066_2041393_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_139371347.1|2042037_2043251_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000065382.1|2043371_2043740_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	1.0e-64
WP_001198860.1|2043812_2043977_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000372923.1|2043945_2044089_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_000995434.1|2044164_2044461_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.1e-48
WP_012602375.1|2044466_2045252_+	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	99.6	1.2e-147
WP_000186887.1|2045248_2045929_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.1	3.0e-131
WP_000682312.1|2045925_2046084_+	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	98.1	1.5e-22
WP_000581109.1|2046080_2046833_+	hypothetical protein	NA	M1FN76	Enterobacteria_phage	100.0	6.4e-151
WP_000151206.1|2046840_2047056_+	hypothetical protein	NA	M1FPM2	Enterobacteria_phage	97.2	6.5e-32
WP_000763364.1|2047154_2047373_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
WP_000488402.1|2047420_2047660_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	92.4	2.0e-37
WP_000088653.1|2047799_2048036_+	excisionase	NA	NA	NA	NA	NA
WP_000444487.1|2049281_2050532_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000381620.1|2051111_2051510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139371347.1|2051512_2052726_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_012602377.1|2052858_2053209_+	DUF1493 family protein	NA	NA	NA	NA	NA
WP_000873386.1|2053541_2054180_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|2054189_2054651_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001295972.1|2054704_2055811_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001295971.1|2055846_2056488_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423737.1|2056491_2057862_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.6e-107
WP_001265481.1|2058030_2058702_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|2058701_2060162_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133414.1|2060693_2060975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127897.1|2060988_2062650_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.4	4.4e-277
WP_000113645.1|2062633_2062990_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000174068.1|2063112_2063295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145903.1|2063278_2063719_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	71.9	1.2e-61
WP_000123184.1|2063718_2064015_-	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	75.5	2.6e-39
WP_001201245.1|2064011_2064350_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	58.0	7.8e-32
WP_000267616.1|2064346_2065561_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	78.6	4.8e-188
WP_000504184.1|2065562_2066138_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	1.2e-61
WP_001137336.1|2066173_2067346_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	71.2	2.2e-153
WP_000233312.1|2067633_2067906_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126632.1|2067915_2068326_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001260556.1|2068322_2068580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761805.1|2068868_2070617_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.5	1.6e-91
WP_000791983.1|2070613_2070913_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000549001.1|2070918_2071146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001230911.1|2071138_2071603_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_012602379.1|2071595_2072657_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000953272.1|2072714_2072903_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000085259.1|2073277_2074507_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.6	2.4e-131
2077843:2078638	attR	TAAACCGTCAGTTCGTGGCAGAACGACCTGACCAGCTGTGGGTGGCTGATTTTACTTACGGTGTGCCCGGAGTTCAGGGCGGGCATGGATGCTTAAATGAACCGCGAGTCTGTCTGGAATATTGAACCGGTAACTCACGATGAGAAACCCAACAATCCCACCGGGTGTGACGGTGGAGAACCTGAGCGGCAGTGACCTGCGGCATGCCCGCAGGGTGATGTAACCCGCTGACAACGGGGATTGAGGCGAGATCACTAAGCCGAGATGATCCTCAAGGTTAAGTACTGAAAGGCTGAAGAACATGAACCCGTTAATCCGCCTCTGTGGGTTGAAAACGTCACCACGGCCTACGTGATCTGACAGGCCGTGCAGGAGGAACTGGCAGTGATACGTAAGCACTGCCGGTCGAAGGTGTTTTGACATGTATGCGAAACACCGGGGCAGCAGCGTCTATCACGCTTGCGTTGCTGACTTCTGCCAACTTGCGGCAAGCAAGGATAAAGAGTGCGACGGGCAGCCTCCTCAGTATGCCTGAGTCCAGGCAGGTAAACCGGGGAAGGTCAGCGACGGATGTTAAGGGGGCATGGCTCCGATGACGCGCTGGCTGGCGGAGCTTCCGTAGTAGTCCGCGATGGGGAAAGCCCATTACATGGCGAAGGGAAGCAGTTTGAATGTGTTTGCGACGTGAATTAACTGACCTAACGAGGTGAAGACCTTTGATAATCAGCGAAATGCAACGCAAGCTTGCCACATGGGCAGCCACCGATCCGTCCCTACGGATTCAACGGCTGCTGCG	NA	NA	NA	NA
>prophage 6
NC_011750	Escherichia coli IAI39, complete genome	5132068	2279862	2346114	5132068	transposase,lysis,protease,tRNA	Bacillus_phage(27.78%)	52	NA	NA
WP_001298300.1|2279862_2280648_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899602.1|2280783_2281563_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436918.1|2281539_2282433_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011612.1|2282586_2283333_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350058.1|2283329_2283512_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056517.1|2283563_2284796_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000570565.1|2284832_2285819_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551270.1|2285815_2287564_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000705750.1|2287600_2289865_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|2290071_2290356_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|2290515_2292189_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|2292299_2292983_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_001353317.1|2293155_2293920_-	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_012602405.1|2294108_2295455_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000445250.1|2295527_2296811_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057143.1|2296881_2297970_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_000642839.1|2298168_2298861_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000194837.1|2298990_2300751_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642546.1|2301156_2302014_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292812.1|2302068_2304351_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
WP_000111043.1|2304542_2305283_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001190363.1|2305364_2305955_-	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
WP_001242687.1|2306054_2306963_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000918503.1|2306963_2308394_-	amino acid permease	NA	NA	NA	NA	NA
WP_000109288.1|2308603_2309752_-	MFS transporter	NA	NA	NA	NA	NA
WP_000167611.1|2310066_2310693_+	hydrolase	NA	NA	NA	NA	NA
WP_000534633.1|2310727_2311591_-	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000213095.1|2311592_2312210_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.1	1.9e-76
WP_000850332.1|2312220_2314665_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	5.0e-221
WP_000886683.1|2314903_2316196_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067771.1|2316286_2317630_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	41.0	7.3e-81
WP_001295343.1|2317640_2318252_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_102818574.1|2318414_2319763_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
WP_000077007.1|2319846_2323953_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|2324087_2324582_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537432.1|2325126_2326092_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_001043595.1|2326214_2327981_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_001202192.1|2327981_2329703_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.9e-21
WP_001241667.1|2329744_2330449_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|2330733_2330952_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|2331878_2334155_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|2334185_2334506_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|2334828_2335053_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188136.1|2335125_2337072_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000746460.1|2337068_2338184_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_162901045.1|2338340_2339291_+	DUF535 family protein	NA	NA	NA	NA	NA
WP_000599806.1|2339287_2340946_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_012602407.1|2341371_2342067_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000868869.1|2342581_2343607_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001264877.1|2343837_2344785_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_001295452.1|2345023_2345422_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_000968208.1|2345418_2346114_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
>prophage 7
NC_011750	Escherichia coli IAI39, complete genome	5132068	2588733	2641825	5132068	transposase,integrase	Escherichia_phage(33.33%)	42	2574643:2574660	2622973:2622990
2574643:2574660	attL	CAGGCCGCTGAACAGATC	NA	NA	NA	NA
WP_000958681.1|2588733_2589891_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	2.4e-221
WP_077777932.1|2590131_2590332_-	hypothetical protein	NA	C7U0V2	Enterobacteria_phage	100.0	1.8e-20
WP_139371347.1|2590425_2591638_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000243051.1|2595203_2595824_-	LuxR family transcriptional regulator	NA	A0A2L1IV08	Escherichia_phage	99.5	1.6e-118
WP_001181154.1|2596141_2596771_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	99.0	5.4e-119
WP_001224626.1|2597519_2598089_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.2	7.0e-49
WP_015674714.1|2598483_2599431_-	DNA-binding transcriptional regulator DsdC	NA	NA	NA	NA	NA
WP_000556035.1|2599648_2600986_+	D-serine transporter DsdX	NA	NA	NA	NA	NA
WP_000426436.1|2601003_2602335_+	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_001018714.1|2602439_2603978_-	multidrug efflux MFS transporter permease subunit EmrY	NA	NA	NA	NA	NA
WP_000435155.1|2603977_2605141_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrK	NA	NA	NA	NA	NA
WP_000991369.1|2605556_2606171_+	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
WP_012602419.1|2606175_2609769_+	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	6.2e-10
WP_012602420.1|2609824_2610970_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|2611043_2611988_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283479.1|2612056_2613751_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.8	1.0e-23
WP_000106759.1|2613804_2615055_-	formyl-CoA transferase	NA	NA	NA	NA	NA
WP_000825618.1|2615566_2616199_-	YfdX family protein	NA	NA	NA	NA	NA
WP_000867663.1|2616494_2616770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000639883.1|2616846_2617089_-	YfdY family protein	NA	NA	NA	NA	NA
WP_000484016.1|2617441_2618362_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	6.4e-76
WP_010723117.1|2618717_2618789_+	membrane protein YpdK	NA	NA	NA	NA	NA
WP_000785931.1|2618853_2620092_-	alanine transaminase	NA	NA	NA	NA	NA
WP_000544379.1|2620468_2622166_+	two-component system sensor histidine kinase YpdA	NA	NA	NA	NA	NA
WP_001314031.1|2622180_2622918_+	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.3	6.1e-13
WP_000646844.1|2622930_2623788_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
2622973:2622990	attR	GATCTGTTCAGCGGCCTG	NA	NA	NA	NA
WP_021521571.1|2623790_2624201_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_015674716.1|2624142_2626209_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_000366047.1|2626233_2627271_-	aminopeptidase	NA	NA	NA	NA	NA
WP_000173264.1|2627270_2628356_-	aminopeptidase	NA	NA	NA	NA	NA
WP_000985322.1|2628370_2629618_-	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000038456.1|2629639_2629966_-	fructose-like phosphotransferase enzyme IIB component 1	NA	NA	NA	NA	NA
WP_000170343.1|2630184_2631150_-	glucokinase	NA	NA	NA	NA	NA
WP_000903113.1|2631353_2632610_+	ion channel protein	NA	NA	NA	NA	NA
WP_000490077.1|2632724_2633051_+	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_102818574.1|2633144_2634492_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
WP_000186369.1|2634628_2635867_-	Mn(2+) uptake NRAMP transporter MntH	NA	NA	NA	NA	NA
WP_000376337.1|2636202_2637405_+	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_012602421.1|2637453_2639643_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_001445514.1|2640276_2640621_+	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000826499.1|2640622_2641015_+	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_015674717.1|2641054_2641825_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	95.7	3.5e-128
>prophage 8
NC_011750	Escherichia coli IAI39, complete genome	5132068	2732864	2796274	5132068	tail,terminase,integrase,transposase,holin,protease	Escherichia_phage(58.18%)	65	2751281:2751297	2793160:2793176
WP_000489677.1|2732864_2734328_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
WP_000166456.1|2734348_2734708_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_000247065.1|2734813_2735560_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_000198330.1|2735609_2736899_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	6.6e-63
WP_001295473.1|2736984_2737611_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_015674722.1|2737683_2737917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012602436.1|2737935_2738973_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.0	2.4e-71
WP_001028626.1|2738972_2739611_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
WP_000529576.1|2739782_2741849_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_001121364.1|2741853_2743395_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_000017552.1|2745858_2746011_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
WP_000076001.1|2746028_2746220_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_001295476.1|2746530_2747049_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
WP_000755181.1|2747064_2747460_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	97.9	6.0e-15
WP_001189111.1|2748897_2750406_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
2751281:2751297	attL	AATCATTCCCACTCAAT	NA	NA	NA	NA
WP_001336051.1|2751407_2751890_-	DUF2514 domain-containing protein	NA	A0A2R9YJI7	Escherichia_phage	93.8	6.9e-74
WP_000403797.1|2751886_2752516_-	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	97.1	4.4e-113
WP_000256103.1|2752505_2752814_-|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	93.1	4.6e-47
WP_001276090.1|2752800_2753205_-	membrane protein	NA	G9L6E6	Escherichia_phage	94.8	7.4e-61
WP_000218911.1|2753511_2756631_-	peptidase S74	NA	A5VW57	Enterobacteria_phage	95.4	0.0e+00
WP_001188252.1|2756826_2757084_+	hypothetical protein	NA	G9L6E3	Escherichia_phage	100.0	1.3e-42
WP_000993735.1|2757401_2758058_+	phage antirepressor Ant	NA	A0A1U9AJ93	Stx1_converting_phage	52.2	4.3e-50
WP_001136300.1|2758287_2758923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001337645.1|2759025_2759442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139371347.1|2761350_2762563_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000119847.1|2764145_2765948_-	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	96.8	0.0e+00
WP_001145638.1|2765944_2768458_-	hypothetical protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	89.6	0.0e+00
WP_000336180.1|2768470_2769010_-	hypothetical protein	NA	A0A193GYJ4	Enterobacter_phage	81.8	1.6e-47
WP_000568023.1|2769009_2769474_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	100.0	8.4e-85
WP_001018555.1|2769473_2771945_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	99.3	0.0e+00
WP_000179259.1|2771944_2772550_-	hypothetical protein	NA	G9L6C9	Escherichia_phage	99.5	1.1e-111
WP_000424495.1|2772549_2772873_-	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	98.1	2.6e-53
WP_000012377.1|2772923_2773259_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
WP_000627074.1|2773269_2773707_-	hypothetical protein	NA	G9L6C6	Escherichia_phage	100.0	2.2e-74
WP_000268721.1|2773758_2774745_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	99.7	7.3e-187
WP_001048075.1|2774759_2775455_-	peptidase	NA	G9L6C4	Escherichia_phage	100.0	6.0e-95
WP_000133163.1|2775457_2775754_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	99.0	3.7e-46
WP_000852428.1|2775750_2777430_-|tail	tail protein	tail	G9L6C2	Escherichia_phage	99.1	2.3e-302
WP_000335899.1|2777444_2777651_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_000590811.1|2778451_2778799_+	hypothetical protein	NA	G9L6B9	Escherichia_phage	100.0	6.0e-27
WP_000132519.1|2778884_2780360_-|terminase	terminase	terminase	G9L6B8	Escherichia_phage	99.6	3.4e-297
WP_001090120.1|2780356_2781031_-|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	100.0	9.0e-120
WP_001129683.1|2781071_2781410_-	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	89.3	2.9e-50
WP_000386652.1|2781402_2781765_-	DUF2591 family protein	NA	A0A2D1GLI3	Escherichia_phage	69.8	1.5e-41
WP_000208034.1|2781764_2782478_-	DUF551 domain-containing protein	NA	G9L6B4	Escherichia_phage	53.2	1.8e-54
WP_000582232.1|2782488_2783244_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	93.2	8.4e-143
WP_001290009.1|2783245_2783812_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	54.7	2.1e-45
WP_000445450.1|2783808_2784384_-	hypothetical protein	NA	A0A0F6TJR7	Escherichia_coli_O157_typing_phage	98.4	5.1e-23
WP_000744232.1|2784445_2784790_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	97.4	1.4e-60
WP_000843276.1|2784907_2785690_-	hypothetical protein	NA	G9L6A9	Escherichia_phage	91.2	5.0e-138
WP_000086416.1|2785664_2786498_-	primosomal protein	NA	Q286X4	Escherichia_phage	94.1	5.2e-101
WP_000402893.1|2786513_2786714_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	6.0e-32
WP_001282459.1|2786864_2787095_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_000836290.1|2787249_2787834_+	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
WP_001198620.1|2787987_2788140_+	hypothetical protein	NA	G9L6A5	Escherichia_phage	100.0	5.4e-25
WP_001102257.1|2788142_2788442_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	100.0	3.4e-47
WP_000802265.1|2788438_2789260_+	exodeoxyribonuclease VIII	NA	G9L6A3	Escherichia_phage	98.2	2.0e-161
WP_000064070.1|2789256_2790174_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	49.7	1.2e-69
WP_000675390.1|2790223_2790472_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_001228938.1|2790581_2790881_+	PerC family transcriptional regulator	NA	A0A2R9YJK3	Escherichia_phage	97.0	1.8e-48
WP_000163466.1|2790873_2791524_+	hypothetical protein	NA	G9L699	Escherichia_phage	97.7	5.2e-125
WP_001077943.1|2791520_2791715_+	DUF1382 family protein	NA	G9L698	Escherichia_phage	96.9	2.8e-26
WP_000954558.1|2791718_2792969_-|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.0	8.0e-239
WP_000138282.1|2793161_2794739_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
2793160:2793176	attR	AATCATTCCCACTCAAT	NA	NA	NA	NA
WP_001299507.1|2794807_2796274_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
>prophage 9
NC_011750	Escherichia coli IAI39, complete genome	5132068	2886547	2947195	5132068	tail,transposase,plate,tRNA	Shigella_phage(34.78%)	55	NA	NA
WP_001346794.1|2886547_2887285_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|2887416_2888751_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_102818574.1|2888940_2890288_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
WP_000189223.1|2891378_2891966_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|2892020_2892404_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262726.1|2892708_2893398_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	1.2e-55
WP_000997418.1|2893445_2894483_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|2894689_2895109_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001308860.1|2895177_2895876_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082988.1|2895907_2898568_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|2898681_2900037_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000464861.1|2900061_2900406_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|2900402_2901701_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|2907468_2910042_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040130.1|2910171_2910903_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079097.1|2910899_2911880_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|2912014_2912752_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000483766.1|2912801_2914148_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000178456.1|2914460_2914802_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|2914905_2914953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200124.1|2915051_2916212_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225236.1|2916254_2917376_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168045.1|2917386_2918457_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_015674728.1|2918664_2919030_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212386.1|2919179_2919698_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969053.1|2919687_2920914_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589833.1|2920929_2921412_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|2921488_2921836_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|2921877_2922645_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|2922675_2923224_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|2923242_2923491_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460043.1|2923627_2924989_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001189257.1|2925080_2925947_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|2925967_2927254_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|2927308_2927902_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059145.1|2928025_2928904_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880931.1|2928989_2930651_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|2930799_2931141_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117840.1|2931202_2931493_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600189.1|2931482_2931959_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|2932090_2932573_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_012602456.1|2933378_2934593_+	type II restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	7.9e-34
WP_072095179.1|2934627_2936031_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.1	4.0e-106
WP_000355484.1|2936463_2937237_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_042029334.1|2937669_2938662_+	acyltransferase	NA	G9L6E5	Escherichia_phage	28.6	5.2e-15
WP_039067872.1|2938703_2939102_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	46.9	1.3e-09
WP_000554668.1|2939098_2940049_-	hypothetical protein	NA	U5P0I1	Shigella_phage	82.7	9.5e-51
WP_000383554.1|2940052_2940637_-	YmfQ family protein	NA	O22003	Shigella_phage	99.0	1.6e-112
WP_000785298.1|2940627_2941686_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	99.1	5.6e-201
WP_000424732.1|2941672_2942098_-	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_001201462.1|2942097_2942646_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	9.6e-96
WP_000999488.1|2942645_2943725_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	98.9	8.5e-205
WP_015674730.1|2943721_2945050_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.4	2.7e-245
WP_012602461.1|2945110_2946016_-|tail	tail protein from phage	tail	S5FM63	Shigella_phage	98.6	3.0e-118
WP_139371347.1|2945981_2947195_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
>prophage 10
NC_011750	Escherichia coli IAI39, complete genome	5132068	4603260	4671680	5132068	plate,transposase,tRNA,tail	Burkholderia_phage(27.27%)	68	NA	NA
WP_102818574.1|4603260_4604608_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
WP_001137258.1|4604785_4606510_+	bifunctional isocitrate dehydrogenase kinase/phosphatase	NA	NA	NA	NA	NA
WP_000226399.1|4606526_4607351_-	glyoxylate bypass operon transcriptional repressor IclR	NA	NA	NA	NA	NA
WP_000096058.1|4607550_4611234_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
WP_000590027.1|4611293_4611614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001189562.1|4611656_4612106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000956822.1|4612276_4613908_+	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_000421763.1|4613997_4614687_-	dipeptidase PepE	NA	NA	NA	NA	NA
WP_000610344.1|4614809_4615622_-	shikimate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000858564.1|4615614_4616844_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_000437897.1|4616895_4617720_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_000406332.1|4617730_4618528_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_001027853.1|4618593_4619088_-	PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB	NA	NA	NA	NA	NA
WP_000245635.1|4619087_4619495_-	PTS sorbose transporter subunit IIA	NA	NA	NA	NA	NA
WP_001195435.1|4619504_4620311_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000431660.1|4620380_4621328_-	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000936365.1|4621591_4622464_+	23S rRNA pseudouridine(2604) synthase RluF	NA	NA	NA	NA	NA
WP_001207638.1|4622464_4622737_-	DUF3811 domain-containing protein	NA	NA	NA	NA	NA
WP_000592040.1|4623265_4624393_+	slipin family protein	NA	NA	NA	NA	NA
WP_001130541.1|4624398_4625190_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	44.6	2.6e-46
WP_000047947.1|4625204_4625660_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	43.3	1.3e-26
WP_012602631.1|4625656_4626364_-	DUF4376 domain-containing protein	NA	A0A0E3JQ06	Enterobacteria_phage	42.4	4.1e-14
WP_000135569.1|4626360_4627941_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	40.8	1.3e-84
WP_000359519.1|4627943_4628660_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	37.2	2.4e-22
WP_000951745.1|4628652_4629768_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	51.7	2.0e-100
WP_001093498.1|4629758_4630118_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	4.7e-35
WP_000679404.1|4630216_4630918_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	36.3	8.4e-12
WP_000808053.1|4630927_4631968_-	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.4	3.9e-74
WP_001269711.1|4631955_4632165_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	1.3e-16
WP_000271439.1|4632164_4633118_-	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.0	1.3e-34
WP_001262480.1|4633117_4635493_-|tail	tail protein	tail	A4JWL0	Burkholderia_virus	25.7	1.0e-56
WP_015674804.1|4635594_4635723_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000658214.1|4635682_4636000_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907492.1|4636050_4636575_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	2.1e-68
WP_000729840.1|4636574_4637999_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	69.8	3.5e-190
WP_000875309.1|4637988_4638186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000404765.1|4638182_4638638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777272.1|4638784_4639099_-	membrane protein	NA	Q5ZQY8	Pseudomonas_phage	43.2	9.2e-19
WP_000266448.1|4639111_4639717_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.1	3.3e-57
WP_000758106.1|4639719_4640007_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	47.7	8.7e-16
WP_000343765.1|4640345_4641566_-|transposase	ISL3-like element ISEc53 family transposase	transposase	NA	NA	NA	NA
WP_000115885.1|4641584_4642103_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_000619864.1|4642436_4642784_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	49.0	2.2e-21
WP_001290321.1|4642838_4644188_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000789981.1|4644712_4646362_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000757333.1|4646715_4646958_+	polysaccharide production threonine-rich protein	NA	NA	NA	NA	NA
WP_012602636.1|4647071_4647710_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_000595550.1|4647706_4648444_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000745768.1|4648443_4650540_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001295279.1|4650586_4650865_-	periplasmic protein	NA	NA	NA	NA	NA
WP_000202902.1|4651078_4651489_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_001252058.1|4651582_4652473_-	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_001361466.1|4652487_4654032_-	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_000695387.1|4654185_4655376_-	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_012602637.1|4655740_4656856_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
WP_000973665.1|4656927_4658268_+	maltoporin LamB	NA	NA	NA	NA	NA
WP_000783444.1|4658510_4659431_+	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000579094.1|4659658_4661239_+	SopA family protein	NA	NA	NA	NA	NA
WP_012602638.1|4661461_4661959_+	chorismate lyase	NA	NA	NA	NA	NA
WP_000455227.1|4661971_4662844_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000017354.1|4662998_4665422_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000002907.1|4665592_4665961_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000646078.1|4666070_4666679_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_001134700.1|4666697_4668077_+	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_001296638.1|4668192_4668402_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000416263.1|4668443_4668959_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_000014225.1|4669276_4670281_+	DUF2713 family protein	NA	NA	NA	NA	NA
WP_012602639.1|4670642_4671680_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 11
NC_011750	Escherichia coli IAI39, complete genome	5132068	4902927	4962752	5132068	transposase,protease,tRNA,integrase	Klosneuvirus(13.33%)	48	4948689:4948703	4955665:4955679
WP_000483766.1|4902927_4904274_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000853753.1|4904959_4905958_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_001219792.1|4906133_4907507_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_102818574.1|4907587_4908936_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
WP_000166273.1|4909098_4909650_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|4909743_4911096_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001232252.1|4911279_4911666_+	cytochrome b562	NA	NA	NA	NA	NA
WP_000212714.1|4911856_4912096_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	49.4	4.0e-14
WP_001106233.1|4912096_4912561_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	3.8e-53
WP_000187789.1|4912750_4914889_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.4	2.6e-266
WP_000183355.1|4915282_4916938_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_001572301.1|4916987_4918409_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001181323.1|4918527_4919475_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	6.0e-13
WP_001387276.1|4919659_4919713_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471901.1|4919853_4922550_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	2.0e-45
WP_000047539.1|4922755_4923142_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148583.1|4923214_4923676_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|4923688_4924624_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_001296693.1|4924627_4924762_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000666045.1|4924851_4925340_-	arginine repressor	NA	NA	NA	NA	NA
WP_001374935.1|4925455_4926859_-	YfcC family protein	NA	NA	NA	NA	NA
WP_000235828.1|4926915_4927920_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000428627.1|4927943_4928876_-	carbamate kinase	NA	NA	NA	NA	NA
WP_001346533.1|4928886_4930107_-	arginine deiminase	NA	NA	NA	NA	NA
WP_000635217.1|4930784_4931237_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000012936.1|4931281_4932286_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002952.1|4932447_4932864_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001298035.1|4933040_4933544_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001000682.1|4933736_4934924_+	DUF898 family protein	NA	NA	NA	NA	NA
WP_000416368.1|4934970_4937826_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.0e-140
WP_000786399.1|4937825_4938269_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|4938622_4940134_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584143.1|4940400_4941501_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|4941500_4942583_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001294549.1|4942701_4944204_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.3	1.8e-83
WP_001304655.1|4944281_4945280_-	DNA-binding transcriptional regulator IdnR	NA	NA	NA	NA	NA
WP_001128336.1|4945346_4946666_-	gnt-II system L-idonate transporter	NA	NA	NA	NA	NA
WP_000998700.1|4946730_4947495_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_001197408.1|4947518_4948550_-	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
4948689:4948703	attL	ACAGAAATAAAAAAA	NA	NA	NA	NA
WP_000896738.1|4948766_4949330_+	gluconokinase	NA	NA	NA	NA	NA
WP_012602660.1|4949333_4950353_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.9	1.2e-43
WP_001218934.1|4950819_4952085_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.8	6.2e-82
WP_000179692.1|4954771_4955989_+	MFS transporter	NA	NA	NA	NA	NA
4955665:4955679	attR	TTTTTTTATTTCTGT	NA	NA	NA	NA
WP_000611568.1|4956000_4957119_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000594406.1|4957161_4957287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000255001.1|4957339_4957597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139371347.1|4959260_4960474_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_001702848.1|4961933_4962752_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	5.9e-65
>prophage 12
NC_011750	Escherichia coli IAI39, complete genome	5132068	5014889	5096735	5132068	portal,terminase,tail,integrase,transposase,lysis,protease	Enterobacteria_phage(40.38%)	79	5015918:5015935	5106166:5106183
WP_000181197.1|5014889_5015810_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.7	2.2e-60
5015918:5015935	attL	TTCACGCCGCATCCGGCA	NA	NA	NA	NA
WP_020233658.1|5016037_5016118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000648247.1|5016215_5018312_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000132602.1|5018358_5018700_-	endoribonuclease SymE	NA	NA	NA	NA	NA
WP_000110093.1|5018920_5020681_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000939429.1|5020680_5022186_-	type I restriction-modification system subunit M	NA	J7I0U9	Acinetobacter_phage	27.3	9.8e-34
WP_000819015.1|5022216_5024649_-	DEAD/DEAH box helicase family protein	NA	A0A2I5ARD8	Synechococcus_phage	25.0	1.0e-08
WP_012602679.1|5025408_5026578_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001314406.1|5026646_5027603_-	GTPase	NA	NA	NA	NA	NA
WP_000467859.1|5027613_5027817_-	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_001366791.1|5027866_5030017_-	pyruvate/proton symporter BtsT	NA	NA	NA	NA	NA
WP_000919579.1|5030394_5032059_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	5.3e-12
WP_000118642.1|5032101_5033373_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_000034588.1|5033906_5034878_-	DctP family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_015674824.1|5035568_5037221_+	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_000091599.1|5037391_5038297_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001292634.1|5039597_5041889_-	phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase	NA	NA	NA	NA	NA
WP_001385190.1|5042142_5042637_-	DUF2501 domain-containing protein	NA	NA	NA	NA	NA
WP_000799911.1|5042685_5043423_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_001298056.1|5043425_5043965_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	3.8e-28
WP_000538188.1|5044072_5044546_-	threonine/serine exporter	NA	NA	NA	NA	NA
WP_001314410.1|5044536_5045307_-	threonine/serine exporter ThrE family protein	NA	NA	NA	NA	NA
WP_000936639.1|5045926_5046652_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001298690.1|5046609_5047287_+	DNA-binding transcriptional activator BglJ	NA	NA	NA	NA	NA
WP_000331589.1|5047324_5048113_-	siderophore-iron reductase FhuF	NA	NA	NA	NA	NA
WP_001350368.1|5048253_5048490_+	DUF1435 domain-containing protein	NA	NA	NA	NA	NA
WP_001272341.1|5049050_5050082_-	16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC	NA	NA	NA	NA	NA
WP_000204030.1|5050184_5050598_+	DNA polymerase III subunit psi	NA	NA	NA	NA	NA
WP_001092465.1|5050566_5051013_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_000870712.1|5051027_5051705_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_001218286.1|5052090_5053314_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	99.0	9.5e-237
WP_016240718.1|5053498_5054740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024179241.1|5055216_5055513_-	hypothetical protein	NA	U5P0J0	Shigella_phage	73.4	4.8e-25
WP_000335012.1|5055560_5056439_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	92.4	2.2e-163
WP_000081287.1|5057083_5057908_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135682.1|5057973_5058336_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000859460.1|5059081_5059756_-	LexA family transcriptional regulator	NA	Q8SBF6	Shigella_phage	99.1	1.7e-131
WP_000649477.1|5059846_5060047_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_165442302.1|5060308_5061521_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_001087352.1|5061951_5062788_+	hypothetical protein	NA	Q8SBF3	Shigella_phage	98.9	5.1e-149
WP_015364394.1|5062792_5063017_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	91.9	1.2e-33
WP_000061506.1|5063013_5063832_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	89.5	2.7e-126
WP_072185076.1|5063828_5064323_+	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	94.5	7.6e-84
WP_001442792.1|5064322_5064976_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	4.7e-126
WP_000210170.1|5064972_5065299_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000767103.1|5065295_5065685_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
WP_001061379.1|5065704_5066514_+	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.5	8.2e-152
WP_001360050.1|5066521_5067511_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001047105.1|5067524_5068277_+	antitermination protein	NA	A0A291AWZ5	Escherichia_phage	100.0	1.3e-138
WP_000217632.1|5068557_5068983_+	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	100.0	3.6e-74
WP_000595432.1|5069206_5069410_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	97.0	3.0e-31
WP_000115885.1|5069681_5070200_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_000343765.1|5070218_5071439_+|transposase	ISL3-like element ISEc53 family transposase	transposase	NA	NA	NA	NA
WP_000578748.1|5071450_5072506_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.4	4.1e-204
WP_000839596.1|5072572_5072788_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135251.1|5072787_5073285_+	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	99.4	1.7e-91
WP_001341210.1|5073281_5073749_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
WP_001139675.1|5073736_5073889_+	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	100.0	1.2e-21
WP_000373425.1|5074966_5075461_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_000934132.1|5075460_5077563_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	99.7	0.0e+00
WP_001072973.1|5077559_5077772_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	98.6	7.1e-31
WP_000985937.1|5077771_5079280_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.0	3.3e-287
WP_016240729.1|5079224_5081252_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_001097045.1|5081338_5081662_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	100.0	8.5e-52
WP_001283152.1|5081654_5081930_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	8.6e-45
WP_000677112.1|5081941_5082520_+|tail	phage tail protein	tail	A0A291AWZ0	Escherichia_phage	99.5	9.4e-102
WP_001079419.1|5082516_5082918_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_000211104.1|5082928_5083672_+|tail	tail protein	tail	A5LH35	Enterobacteria_phage	99.6	7.8e-133
WP_016240730.1|5083732_5084119_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	99.2	1.6e-65
WP_001161009.1|5084127_5084457_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000372045.1|5084428_5087494_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.7	0.0e+00
WP_000447253.1|5087493_5087823_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152379.1|5087832_5088531_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	1.3e-134
WP_000140759.1|5088536_5089280_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	5.4e-150
WP_000741576.1|5089177_5089825_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	98.6	2.7e-113
WP_000515491.1|5089885_5093584_+	DUF1983 domain-containing protein	NA	A0A0K2FI38	Escherichia_phage	75.3	0.0e+00
WP_001228271.1|5093651_5094251_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	91.0	7.5e-102
WP_012602691.1|5094402_5096460_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	63.6	5.3e-147
WP_001204581.1|5096456_5096735_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	6.0e-22
5106166:5106183	attR	TTCACGCCGCATCCGGCA	NA	NA	NA	NA
