The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_011742	Escherichia coli S88, complete genome	5032268	555012	612046	5032268	integrase,capsid,portal,tail,tRNA,protease,lysis,head,holin,terminase	Enterobacteria_phage(41.07%)	68	550092:550107	578367:578382
550092:550107	attL	CGCTCAATGGCGTTAA	NA	NA	NA	NA
WP_000912345.1|555012_556398_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143516.1|556433_556955_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|557062_557275_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|557276_558143_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_001298992.1|558505_559669_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000206813.1|559895_560201_-	hypothetical protein	NA	U5P0J0	Shigella_phage	95.0	1.4e-48
WP_001242717.1|560200_560563_-	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000008165.1|560553_561090_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
WP_000081290.1|561217_562042_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.0e-149
WP_000135682.1|562107_562470_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_012599998.1|563192_563885_-	helix-turn-helix domain-containing protein	NA	S5FUZ3	Shigella_phage	95.7	2.4e-120
WP_001191669.1|563982_564243_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_000515850.1|564235_564793_+	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	96.8	1.1e-96
WP_001087327.1|564789_565938_+	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	86.4	2.7e-177
WP_000620684.1|565934_566801_+	Rha family phage regulatory protein	NA	K7PLX4	Enterobacteria_phage	75.5	9.4e-114
WP_000620687.1|566797_567022_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	95.9	2.4e-37
WP_000061508.1|567018_567837_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	88.1	2.8e-123
WP_001387484.1|567833_568328_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	96.3	1.5e-84
WP_000066917.1|568327_568981_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210143.1|568977_569304_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	2.7e-53
WP_000767110.1|569300_569696_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_001072669.1|569858_570674_+	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.3	8.5e-149
WP_001358491.1|570681_571671_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	4.7e-194
WP_001204814.1|571688_572060_+	antitermination protein Q	NA	Q8W638	Enterobacteria_phage	59.2	8.3e-35
WP_000360285.1|572135_572753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917737.1|573031_573229_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000301784.1|573363_574071_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874508.1|574840_576802_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	64.5	6.6e-240
WP_001304601.1|576938_577121_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	86.7	4.6e-23
WP_001514225.1|577158_577428_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	76.4	1.8e-10
WP_000284510.1|577503_577719_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001037011.1|577723_578074_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	91.1	6.0e-51
WP_000992063.1|578137_578671_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	2.1e-100
578367:578382	attR	TTAACGCCATTGAGCG	NA	NA	NA	NA
WP_000459345.1|578830_578968_+	hypothetical protein	NA	Q687G2	Enterobacteria_phage	97.8	1.3e-17
WP_001082564.1|578969_579407_+|lysis	lysis protein	lysis	A0A088CBQ1	Shigella_phage	95.2	2.3e-68
WP_001028465.1|579608_580130_+	KilA-N domain-containing protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
WP_000347013.1|580838_580979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329960.1|581111_581297_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000867568.1|581692_582241_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_000258997.1|584122_584329_+|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_000831802.1|584325_585918_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	1.6e-183
WP_001253910.1|585907_587413_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	1.0e-99
WP_000256840.1|587449_587797_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522651.1|587854_588883_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.7e-115
WP_000201530.1|588934_589309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204545.1|589301_589655_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	5.8e-38
WP_001007373.1|589666_590245_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	91.7	3.9e-79
WP_000683147.1|590241_590637_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	8.5e-70
WP_001306179.1|590644_591385_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	99.6	7.8e-133
WP_000479165.1|591400_591823_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	1.5e-69
WP_000459451.1|591804_592239_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	1.0e-63
WP_000840203.1|592231_594793_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	89.6	0.0e+00
WP_000847312.1|594789_595119_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	4.7e-58
WP_001514118.1|595118_595817_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.1	1.2e-127
WP_000194708.1|595827_596571_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	94.3	4.9e-143
WP_122994946.1|596516_597149_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	92.8	7.2e-95
WP_000514736.1|597492_601185_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.7	0.0e+00
WP_001228272.1|601252_601852_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.0	9.8e-102
WP_000216562.1|602003_604064_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	65.7	7.1e-152
WP_001204581.1|604060_604339_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	6.0e-22
WP_000355700.1|604348_604642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071586406.1|604681_604780_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	78.1	1.2e-06
WP_023148666.1|604834_605503_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001226381.1|606048_607533_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201822.1|607719_608673_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001331487.1|609781_610138_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	67.5	3.8e-53
WP_000239877.1|610192_610861_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001201816.1|611092_612046_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
>prophage 2
NC_011742	Escherichia coli S88, complete genome	5032268	921161	931281	5032268	protease	Vibrio_phage(33.33%)	6	NA	NA
WP_000188147.1|921161_923108_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|923180_923405_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|923727_924048_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|924078_926355_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000097886.1|927067_928051_+	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.5	3.4e-43
WP_001101565.1|928047_931281_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.0	1.0e-83
>prophage 3
NC_011742	Escherichia coli S88, complete genome	5032268	1178622	1223757	5032268	integrase,capsid,portal,tail,tRNA,protease,lysis,head,terminase	Enterobacteria_phage(51.79%)	64	1169142:1169155	1198846:1198859
1169142:1169155	attL	CACCACCACAAATG	NA	NA	NA	NA
WP_001298466.1|1178622_1179729_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1179782_1180244_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248695.1|1180253_1180907_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|1181078_1182329_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|1182442_1183585_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|1183574_1183811_-	excisionase	NA	NA	NA	NA	NA
WP_000490213.1|1183950_1184190_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000002139.1|1184173_1184500_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000763374.1|1184499_1184721_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000548516.1|1185107_1185299_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000149537.1|1185271_1185454_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000186848.1|1185450_1186131_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100847.1|1186127_1186913_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995434.1|1186918_1187215_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.1e-48
WP_000372923.1|1187290_1187434_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_001198860.1|1187402_1187567_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000065374.1|1187639_1188008_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_000213979.1|1188190_1188391_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	7.1e-33
WP_001066170.1|1188604_1189186_+	super-infection exclusion protein B	NA	K7P6T7	Enterobacteria_phage	92.7	1.4e-92
WP_000088199.1|1189202_1189475_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.8e-40
WP_000438342.1|1189452_1189635_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	1.1e-27
WP_000968518.1|1189911_1190664_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_001062368.1|1190660_1191218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302016.1|1191257_1191953_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|1192028_1192244_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442609.1|1192385_1192682_+	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
WP_000788872.1|1193543_1194245_+	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	2.9e-129
WP_000145927.1|1194241_1194532_+	protein ren	NA	O48423	Enterobacteria_phage	97.9	2.8e-46
WP_000736913.1|1194605_1195046_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000153286.1|1195042_1195570_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
WP_001254243.1|1195566_1195743_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	3.3e-26
WP_000386643.1|1195745_1196087_+	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_001099712.1|1196293_1196656_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971053.1|1196652_1196793_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	3.6e-07
WP_001204776.1|1196878_1197262_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000737271.1|1197450_1198533_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_000839596.1|1199121_1199337_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
1198846:1198859	attR	CATTTGTGGTGGTG	NA	NA	NA	NA
WP_001135277.1|1199336_1199834_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001228695.1|1200050_1200233_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|1200323_1200617_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|1201097_1201424_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|1201630_1201813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000867565.1|1202375_1202924_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.8e-57
WP_001304453.1|1202895_1204824_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	3.3e-260
WP_000258997.1|1204807_1205014_+|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_000831761.1|1205010_1206603_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_001253914.1|1206592_1208098_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	3.6e-100
WP_000256840.1|1208134_1208482_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522651.1|1208539_1209568_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.7e-115
WP_000201530.1|1209619_1209994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204545.1|1209986_1210340_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	5.8e-38
WP_001007373.1|1210351_1210930_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	91.7	3.9e-79
WP_000683147.1|1210926_1211322_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	8.5e-70
WP_001306179.1|1211329_1212070_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	99.6	7.8e-133
WP_000479165.1|1212085_1212508_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	1.5e-69
WP_000459451.1|1212489_1212924_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	1.0e-63
WP_000840240.1|1212916_1215478_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	94.6	0.0e+00
WP_000847405.1|1215474_1215804_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	5.4e-54
WP_001152660.1|1215803_1216502_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	4.0e-131
WP_000140699.1|1216507_1217251_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
WP_000090917.1|1217187_1217820_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000515327.1|1217880_1221363_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
WP_000290543.1|1221421_1223482_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	53.4	2.0e-125
WP_000654167.1|1223478_1223757_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	56.5	7.6e-25
>prophage 4
NC_011742	Escherichia coli S88, complete genome	5032268	1302723	1393339	5032268	integrase,capsid,transposase,portal,tail,protease,lysis,head,holin,terminase	Escherichia_phage(30.91%)	99	1296118:1296134	1349035:1349051
1296118:1296134	attL	GCCAGCGTTGGCAGCAT	NA	NA	NA	NA
WP_001111620.1|1302723_1303923_-|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	63.0	1.4e-139
WP_000555849.1|1304715_1305558_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001362934.1|1305607_1306066_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|1306178_1307084_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193456.1|1307175_1308189_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|1308390_1309299_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|1309442_1309856_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068076.1|1310459_1311077_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	7.8e-54
WP_000301660.1|1312534_1315210_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000616773.1|1315686_1316334_+	NAAT family transporter YchE	NA	NA	NA	NA	NA
WP_000051910.1|1316491_1316653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297114.1|1317071_1318703_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_000911108.1|1318788_1319709_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_000979659.1|1319723_1320632_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_000110950.1|1320643_1321657_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994894.1|1321653_1322658_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	1.1e-15
WP_000366957.1|1322710_1323040_-	YciU family protein	NA	NA	NA	NA	NA
WP_000214516.1|1323074_1324535_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_001309467.1|1324677_1324851_+	YciY family protein	NA	NA	NA	NA	NA
WP_001313775.1|1324905_1326159_-	voltage-gated potassium channel protein	NA	NA	NA	NA	NA
WP_000967595.1|1326458_1326755_-	YciI family protein	NA	NA	NA	NA	NA
WP_001357407.1|1326978_1327695_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_000108160.1|1327734_1328133_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000808672.1|1328238_1328778_-	septation protein A	NA	NA	NA	NA	NA
WP_000028546.1|1328807_1329551_-	UPF0259 family protein	NA	NA	NA	NA	NA
WP_001350853.1|1329906_1330545_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000113674.1|1330590_1331721_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1331698_1331947_-	excisionase	NA	NA	NA	NA	NA
WP_000048435.1|1332011_1334483_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	5.0e-59
WP_001090203.1|1334575_1334767_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1334763_1334952_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|1335352_1335517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171970.1|1335517_1335739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|1335898_1336054_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001362937.1|1336346_1336685_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.7	3.3e-06
WP_000747951.1|1337076_1337319_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693867.1|1337302_1337728_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262357.1|1337799_1338870_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_001151217.1|1338910_1339333_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	87.8	4.1e-62
WP_014639476.1|1339524_1340487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354966.1|1340502_1341504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122083109.1|1341912_1342020_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_000813256.1|1342121_1342277_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	98.0	5.0e-18
WP_011478175.1|1342444_1342723_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_001265108.1|1342724_1343771_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.8	3.8e-109
WP_000904114.1|1343783_1344158_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_000762880.1|1344154_1344976_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000917749.1|1345200_1345398_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
WP_000935515.1|1345548_1346598_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	95.1	3.7e-197
WP_001331709.1|1347872_1348100_+	DUF1737 domain-containing protein	NA	Q20GJ1	Phage_258-320	91.8	1.8e-32
WP_000372595.1|1348368_1348584_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000193259.1|1348588_1348933_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	8.2e-37
WP_001351274.1|1348898_1349171_-	hypothetical protein	NA	NA	NA	NA	NA
1349035:1349051	attR	GCCAGCGTTGGCAGCAT	NA	NA	NA	NA
WP_000459345.1|1349970_1350108_+	hypothetical protein	NA	Q687G2	Enterobacteria_phage	97.8	1.3e-17
WP_001082537.1|1350109_1350574_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	84.2	1.0e-61
WP_000057035.1|1350881_1351292_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	75.6	1.7e-52
WP_001331705.1|1351349_1351583_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	9.5e-21
WP_000867575.1|1351969_1352518_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_000259002.1|1354400_1354607_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831818.1|1354603_1356196_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	4.9e-185
WP_001253963.1|1356185_1357691_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.8	9.3e-101
WP_000256823.1|1357727_1358075_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_000522649.1|1358132_1359161_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	1.0e-114
WP_000201530.1|1359212_1359587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204535.1|1359579_1359933_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.9	6.7e-42
WP_000974980.1|1359948_1360482_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_000683079.1|1360478_1360874_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235110.1|1360881_1361634_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479118.1|1361647_1362079_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	1.8e-41
WP_000533402.1|1362105_1362519_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082348.1|1362499_1365073_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.1	0.0e+00
WP_000847398.1|1365069_1365339_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	93.3	2.7e-43
WP_001152522.1|1365398_1366097_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
WP_000140762.1|1366101_1366845_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.1e-146
WP_000090879.1|1366781_1367384_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_001332187.1|1367457_1367796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000515771.1|1367862_1371342_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.8	0.0e+00
WP_001233195.1|1371409_1372009_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
WP_000216497.1|1372160_1375268_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	90.5	4.4e-52
WP_000885580.1|1375267_1375852_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.5e-102
WP_000240999.1|1375906_1376575_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|1376631_1376901_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000251936.1|1377015_1377186_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_001079492.1|1377673_1378180_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056507.1|1378225_1378726_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134814.1|1378811_1378991_-	general stress protein	NA	NA	NA	NA	NA
WP_000443098.1|1379371_1380178_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209529.1|1380177_1381371_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001195306.1|1381382_1382741_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
WP_000763524.1|1382744_1384340_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_001194639.1|1384339_1385902_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1385993_1386038_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285667.1|1386175_1387057_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1387053_1387674_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001350892.1|1387701_1389597_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291206.1|1389809_1390685_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278741.1|1390724_1391315_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559260.1|1391311_1392070_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	7.5e-06
WP_000422062.1|1392289_1393339_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 5
NC_011742	Escherichia coli S88, complete genome	5032268	2167641	2207534	5032268	integrase,capsid,transposase,portal,terminase,tail,tRNA,lysis,head,holin,plate	Escherichia_phage(38.1%)	46	2169148:2169175	2205547:2205574
WP_000476019.1|2167641_2169003_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	5.5e-217
2169148:2169175	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|2169275_2169494_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882955.1|2169575_2170739_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.0	7.0e-205
WP_000978907.1|2170738_2171218_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000069926.1|2171232_2173680_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.1	0.0e+00
WP_053879341.1|2173672_2173792_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	4.0e-15
WP_001031303.1|2173824_2174100_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251412.1|2174156_2174675_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	3.2e-93
WP_001286719.1|2174687_2175878_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	2.8e-225
WP_000836023.1|2176208_2176586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001514314.1|2176608_2177193_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	31.5	5.2e-07
WP_000711880.1|2177299_2178142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001164150.1|2178563_2179091_-|tail	tail fiber assembly protein	tail	Q7Y4D3	Escherichia_virus	91.4	8.3e-89
WP_000104708.1|2179094_2181830_-|tail	phage tail protein	tail	Q858V4	Yersinia_virus	81.7	0.0e+00
WP_001285335.1|2181840_2182371_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	98.3	7.3e-101
WP_001121504.1|2182363_2183272_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	2.2e-161
WP_000127164.1|2183276_2183624_-	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_000853328.1|2183620_2184256_-|plate	phage baseplate assembly protein V	plate	Q858V7	Yersinia_virus	97.6	2.2e-112
WP_001280130.1|2184401_2185481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001001802.1|2185561_2186014_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.0	1.5e-75
WP_000917186.1|2186006_2186474_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	2.5e-81
WP_072130481.1|2186436_2186610_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	93.0	2.6e-23
WP_000040664.1|2186581_2187007_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	97.2	2.3e-65
WP_000736608.1|2186994_2187420_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	95.7	2.3e-57
WP_001144107.1|2187434_2187932_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	6.9e-93
WP_000123123.1|2187931_2188213_-|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846409.1|2188216_2188420_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000988633.1|2188419_2188929_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000203432.1|2189028_2189772_-|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	97.2	3.3e-123
WP_001298859.1|2190632_2192174_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|2192188_2192935_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001085953.1|2193493_2194348_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
WP_000156872.1|2194521_2196294_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_000038181.1|2196293_2197328_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.7	1.2e-200
WP_000997854.1|2197667_2199500_-	hypothetical protein	NA	Q2P9X5	Enterobacteria_phage	32.1	2.0e-89
WP_000268562.1|2199616_2201899_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.9	0.0e+00
WP_000027667.1|2201888_2202164_-	DUF5405 family protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_001113264.1|2202160_2202385_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277891.1|2202387_2202687_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	100.0	8.4e-46
WP_000557708.1|2202686_2202911_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	1.4e-32
WP_000217677.1|2202974_2203475_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_001005162.1|2203471_2203642_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000043869.1|2203652_2203928_-	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001350698.1|2204042_2204342_+	helix-turn-helix transcriptional regulator	NA	Q1JS83	Enterobacteria_phage	100.0	3.3e-50
WP_001350699.1|2205901_2206219_-	hypothetical protein	NA	NA	NA	NA	NA
2205547:2205574	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807360.1|2206634_2207534_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.5	5.7e-13
>prophage 6
NC_011742	Escherichia coli S88, complete genome	5032268	2245007	2254452	5032268		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292784.1|2245007_2246144_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	1.2e-161
WP_001332210.1|2246140_2248144_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.4	0.0e+00
WP_001296231.1|2248268_2248730_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|2248770_2249241_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2249287_2250007_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2250003_2251689_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240394.1|2251910_2252642_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	3.1e-110
WP_001216963.1|2252701_2252809_+	protein YohO	NA	NA	NA	NA	NA
WP_000783132.1|2252789_2253521_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569345.1|2253525_2254452_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 7
NC_011742	Escherichia coli S88, complete genome	5032268	2463058	2533406	5032268	integrase,portal,tail,tRNA,protease,lysis,head,holin,coat,terminase	Enterobacteria_phage(72.73%)	84	2480016:2480032	2525525:2525541
WP_001283598.1|2463058_2463871_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289178.1|2463870_2464884_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699136.1|2464949_2466086_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.4	3.5e-23
WP_000615815.1|2466184_2467180_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127769.1|2467176_2468355_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|2468619_2469840_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683753.1|2469998_2472005_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559761.1|2472125_2472404_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089237.1|2472437_2472986_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447366.1|2472985_2473795_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043802.1|2473794_2474619_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001331783.1|2474622_2475708_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001298774.1|2475742_2476675_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|2476840_2477392_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001350713.1|2477711_2478554_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_001050125.1|2478555_2479083_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000824843.1|2479079_2479559_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000642895.1|2479555_2480059_-	fimbrial protein	NA	NA	NA	NA	NA
2480016:2480032	attL	GCCAGCAATAGCGCGGC	NA	NA	NA	NA
WP_000120670.1|2480075_2480828_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001447287.1|2480847_2483496_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001195816.1|2484684_2485170_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000425007.1|2485372_2487517_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531977.1|2487516_2488827_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296261.1|2489007_2489292_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001350714.1|2489663_2491004_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000776774.1|2491061_2491817_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368123.1|2492110_2493043_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	1.6e-167
WP_000958671.1|2493354_2494512_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000129907.1|2495793_2498739_-|tail	tail fiber domain-containing protein	tail	A5VW57	Enterobacteria_phage	99.4	0.0e+00
WP_001350929.1|2498839_2499742_-	phage antirepressor Ant	NA	Q0H8C7	Salmonella_phage	97.0	1.5e-167
WP_000620145.1|2499804_2499978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000410001.1|2499974_2500127_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001051911.1|2500241_2500490_+	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	50.0	1.5e-08
WP_000903306.1|2500489_2501026_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	NA	NA	NA	NA
WP_001198454.1|2501074_2501524_-	type II toxin-antitoxin system YafO family toxin	NA	G8C7Q9	Escherichia_phage	60.3	9.1e-44
WP_000064337.1|2501532_2502099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011703616.1|2502295_2502625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000868966.1|2502642_2504655_-	hypothetical protein	NA	A0A2I7QW93	Vibrio_phage	36.7	2.9e-97
WP_000257015.1|2504654_2506106_-	phage DNA ejection protein	NA	A0A2H4FND5	Salmonella_phage	61.0	7.5e-148
WP_000964905.1|2506116_2506809_-	hypothetical protein	NA	A5VW66	Enterobacteria_phage	99.6	2.5e-117
WP_000627629.1|2506811_2507267_-	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	100.0	1.4e-87
WP_000785531.1|2507266_2507968_-	hypothetical protein	NA	A5VW68	Enterobacteria_phage	100.0	3.2e-120
WP_001122367.1|2507967_2509386_-	packaged DNA stabilization protein gp10	NA	A5VW69	Enterobacteria_phage	100.0	4.2e-276
WP_001140510.1|2509395_2509857_-|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_001389518.1|2509837_2510026_-	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
WP_000370106.1|2510067_2511321_-|coat	coat protein	coat	A5VW72	Enterobacteria_phage	99.0	3.1e-235
WP_000372589.1|2511339_2512233_-	hypothetical protein	NA	A5VW73	Enterobacteria_phage	100.0	3.8e-134
WP_000818371.1|2512323_2514522_-|portal	portal protein	portal	A5VW74	Enterobacteria_phage	100.0	0.0e+00
WP_000200779.1|2514523_2515939_-|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	100.0	3.1e-279
WP_000113731.1|2515935_2516376_-	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	100.0	5.9e-80
WP_000807788.1|2516378_2516621_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_001109020.1|2516848_2517391_-	Rha family transcriptional regulator	NA	A5VW78	Enterobacteria_phage	100.0	1.4e-99
WP_001139680.1|2517596_2517749_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_001350934.1|2517736_2518174_-|lysis	lysis protein	lysis	A5VW79	Enterobacteria_phage	100.0	2.0e-72
WP_000229389.1|2518170_2518647_-	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	100.0	7.5e-89
WP_000783734.1|2518630_2518954_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000027551.1|2519550_2520069_-	DUF1133 family protein	NA	A5VW83	Enterobacteria_phage	99.4	3.4e-95
WP_000994516.1|2520065_2520254_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008199.1|2520250_2520613_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
WP_000002245.1|2520609_2520900_-	DUF1364 domain-containing protein	NA	A5VW86	Enterobacteria_phage	100.0	1.0e-51
WP_001004257.1|2520899_2521622_-	phage antirepressor KilAC domain-containing protein	NA	A5VW87	Enterobacteria_phage	100.0	5.4e-131
WP_000950973.1|2521614_2521791_-	protein ninF	NA	G9L691	Escherichia_phage	100.0	5.7e-26
WP_000386646.1|2521783_2522203_-	DUF2591 family protein	NA	A0A088CQ65	Enterobacteria_phage	73.3	5.9e-53
WP_001254264.1|2522205_2522382_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	4.3e-26
WP_000814617.1|2522378_2522789_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	97.8	1.1e-69
WP_001514330.1|2522988_2523303_-	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	65.6	1.9e-24
WP_000229808.1|2523418_2523625_-	hypothetical protein	NA	G8C7M4	Escherichia_phage	95.6	6.7e-26
WP_001248388.1|2523697_2525074_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_000431320.1|2525070_2525958_-	replication protein	NA	A5VW95	Enterobacteria_phage	100.0	1.3e-145
2525525:2525541	attR	GCCGCGCTATTGCTGGC	NA	NA	NA	NA
WP_001244621.1|2526020_2526293_-	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_000251072.1|2526315_2526609_-	hypothetical protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
WP_000276886.1|2526717_2526903_-	Cro/Cl family transcriptional regulator	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_000856967.1|2526983_2527634_+	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	100.0	1.1e-122
WP_000219332.1|2528155_2528455_+	hypothetical protein	NA	A5VW99	Enterobacteria_phage	98.0	4.5e-31
WP_000167596.1|2528463_2528934_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.8e-87
WP_001183771.1|2529128_2529299_+	hypothetical protein	NA	A0A192Y6R1	Salmonella_phage	100.0	1.3e-24
WP_000031365.1|2529555_2530161_+	ERF family protein	NA	A5VWA8	Enterobacteria_phage	100.0	3.2e-108
WP_000951332.1|2530160_2530544_+	hypothetical protein	NA	A5VWA9	Enterobacteria_phage	100.0	4.7e-65
WP_001111304.1|2530567_2530864_+	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	100.0	7.8e-52
WP_000215166.1|2531472_2531772_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	100.0	1.5e-58
WP_000161575.1|2531773_2532346_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	100.0	4.0e-105
WP_000002106.1|2532623_2532908_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	100.0	2.4e-50
WP_000545737.1|2532980_2533148_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
WP_001163428.1|2533205_2533406_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
>prophage 8
NC_011742	Escherichia coli S88, complete genome	5032268	2749428	2873459	5032268	integrase,capsid,transposase,portal,tail,tRNA,protease,lysis,head,holin,terminase,plate	Salmonella_phage(38.78%)	140	2798240:2798285	2832336:2832381
WP_000083664.1|2749428_2750166_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|2750297_2751632_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001350886.1|2751664_2752546_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189209.1|2752648_2753236_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|2753291_2753675_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262723.1|2753979_2754669_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000997387.1|2754716_2755754_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|2755960_2756380_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001298618.1|2756448_2757147_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082937.1|2757178_2759839_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|2759952_2761308_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001370843.1|2761353_2761677_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_001298619.1|2761673_2762972_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.7	4.8e-45
WP_001298859.1|2763365_2764907_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|2764921_2765668_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001350770.1|2774041_2776615_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	5.8e-127
WP_000040118.1|2776744_2777476_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079096.1|2777472_2778453_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|2778587_2779325_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|2779594_2779936_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|2780039_2780087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200106.1|2780185_2781346_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225230.1|2781388_2782510_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168025.1|2782520_2783591_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_001296308.1|2783800_2784166_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212400.1|2784314_2784833_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969016.1|2784822_2786049_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589793.1|2786064_2786547_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|2786623_2786971_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|2787012_2787780_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|2787810_2788359_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|2788377_2788626_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|2788762_2790124_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|2790290_2791082_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|2791102_2792389_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001332400.1|2792443_2793037_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059176.1|2793159_2794038_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880938.1|2794123_2795785_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|2795933_2796275_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117834.1|2796336_2796627_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600193.1|2796616_2797093_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|2797224_2797707_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
2798240:2798285	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAA	NA	NA	NA	NA
WP_000391794.1|2798407_2798890_+	hypothetical protein	NA	Q19UP0	Mannheimia_phage	34.3	1.6e-17
WP_000980501.1|2798916_2799135_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	77.8	7.5e-28
WP_001011796.1|2799203_2800304_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.5	3.4e-177
WP_000980413.1|2800300_2800786_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_001282804.1|2800782_2803860_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.9	0.0e+00
WP_000763311.1|2803852_2803972_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281014.1|2803986_2804289_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	88.0	5.9e-39
WP_001207660.1|2804343_2804859_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_000046126.1|2804868_2806041_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.5	1.6e-204
WP_000356478.1|2806175_2806778_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	79.9	3.6e-88
WP_000104760.1|2806777_2808403_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	66.2	6.4e-188
WP_001086836.1|2808399_2809005_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
WP_000268284.1|2808997_2809906_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	4.6e-143
WP_000177573.1|2809892_2810252_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.7	4.7e-51
WP_001096009.1|2810248_2810827_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	2.1e-93
WP_000400690.1|2810965_2812666_+	AIPR family protein	NA	NA	NA	NA	NA
WP_000829140.1|2812721_2813180_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.2	2.2e-61
WP_001039934.1|2813172_2813604_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	91.6	4.2e-70
WP_001080935.1|2813699_2814128_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	73.8	1.6e-45
WP_000727853.1|2814124_2814502_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
WP_001069895.1|2814503_2815016_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.1	4.4e-87
WP_000171568.1|2814996_2815212_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|2815215_2815419_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673520.1|2815418_2815883_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
WP_000059196.1|2815978_2816629_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	94.4	2.8e-110
WP_000742511.1|2816632_2817691_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000216229.1|2817707_2818541_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	4.1e-122
WP_001098431.1|2818683_2820450_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_000520349.1|2820449_2821484_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.4	6.5e-170
WP_000008839.1|2821531_2822941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|2823262_2823496_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|2823506_2823695_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_000104172.1|2826285_2827143_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.8	2.3e-157
WP_000752624.1|2827139_2827367_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	97.3	3.0e-35
WP_001244228.1|2827366_2827600_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_000996717.1|2827667_2828009_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_000956176.1|2828126_2828423_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
WP_000460849.1|2828430_2828940_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	99.4	3.4e-87
WP_000102105.1|2828972_2829215_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_000932272.1|2829336_2829969_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	51.9	4.8e-59
WP_000218401.1|2829971_2830991_+|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	92.9	1.4e-185
WP_001244285.1|2830995_2832219_+	hypothetical protein	NA	E5G6K9	Salmonella_phage	38.8	3.6e-74
WP_000183405.1|2832959_2833748_+	hypothetical protein	NA	NA	NA	NA	NA
2832336:2832381	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAA	NA	NA	NA	NA
WP_000174562.1|2833835_2834129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000353910.1|2834339_2835113_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	39.2	3.6e-40
WP_000834402.1|2836164_2838054_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001115559.1|2838307_2838799_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	35.3	4.8e-06
WP_001089535.1|2838801_2839245_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	50.3	4.8e-37
WP_000356380.1|2839216_2839819_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	86.0	3.4e-94
WP_000554665.1|2839818_2840562_-|tail	tail fiber protein	tail	O22004	Shigella_phage	92.6	3.7e-50
WP_000539246.1|2840565_2841150_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	1.0e-111
WP_000785328.1|2841140_2842199_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	97.7	2.6e-198
WP_000424731.1|2842185_2842611_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	98.6	7.4e-80
WP_000103707.1|2842610_2843159_-|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	98.9	5.6e-96
WP_000999498.1|2843158_2844238_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.4	1.5e-206
WP_001350765.1|2844234_2845563_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.6	7.2e-246
WP_000807182.1|2845623_2847459_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	98.4	7.7e-307
WP_000661051.1|2847600_2847870_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	6.0e-43
WP_000090998.1|2847869_2848226_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
WP_000155718.1|2848225_2849722_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	95.6	4.3e-263
WP_000497751.1|2849705_2849876_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779291.1|2849884_2850445_-	hypothetical protein	NA	S5FM61	Shigella_phage	98.9	1.5e-104
WP_000213503.1|2850441_2850948_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	3.2e-90
WP_000702385.1|2850922_2851333_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	96.3	1.1e-72
WP_000927711.1|2851329_2851653_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601360.1|2851655_2851856_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000257492.1|2851905_2853111_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.5	9.1e-224
WP_001193631.1|2853125_2853776_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000466267.1|2853753_2854995_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	6.5e-241
WP_000605604.1|2854994_2855177_-	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	100.0	1.7e-25
WP_072011717.1|2855188_2856685_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_000929172.1|2856918_2857413_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	8.6e-88
WP_001135216.1|2857538_2857889_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	3.4e-62
WP_000026993.1|2857991_2858432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001332386.1|2858538_2858790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000092331.1|2858860_2859298_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	92.3	5.3e-65
WP_001180490.1|2859294_2859771_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	93.0	2.8e-83
WP_000544527.1|2859757_2860063_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	86.6	1.6e-39
WP_000606308.1|2860214_2860550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047143.1|2860735_2861488_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.1e-134
WP_001350764.1|2861501_2862491_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.2	1.3e-191
WP_001061411.1|2862498_2863296_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	5.8e-150
WP_000767113.1|2863315_2863705_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210172.1|2863701_2864028_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_001332383.1|2864024_2864678_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	99.1	1.6e-126
WP_001332382.1|2864677_2865172_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	99.4	1.9e-87
WP_000104933.1|2865168_2866110_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	98.4	1.3e-153
WP_001250269.1|2866099_2866279_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515830.1|2866454_2867006_-	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
WP_000649477.1|2867049_2867250_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|2867340_2868015_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000500990.1|2868217_2868730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135691.1|2869198_2869561_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	98.3	1.2e-59
WP_000081287.1|2869626_2870451_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008234.1|2870578_2871103_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.3	5.4e-96
WP_001075212.1|2871211_2872078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331174.1|2872119_2872326_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_000531794.1|2872286_2873459_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.5	3.3e-146
>prophage 9
NC_011742	Escherichia coli S88, complete genome	5032268	2949119	2956259	5032268		Escherichia_phage(83.33%)	6	NA	NA
WP_000103864.1|2949119_2951681_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.0e-31
WP_001141302.1|2951786_2952443_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	1.1e-50
WP_001296319.1|2952493_2953261_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_000847997.1|2953456_2954365_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_000590420.1|2954361_2955624_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279003.1|2955620_2956259_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 10
NC_011742	Escherichia coli S88, complete genome	5032268	4817931	4827955	5032268	transposase	Klebsiella_phage(12.5%)	9	NA	NA
WP_001514408.1|4817931_4819434_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	1.4e-83
WP_001299662.1|4819563_4820583_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	8.4e-45
WP_000594911.1|4821396_4822221_+	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
WP_000227281.1|4822269_4822842_-	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000747102.1|4822942_4823293_+|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
WP_001254876.1|4823212_4824364_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
WP_000177060.1|4825415_4825673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|4826230_4826998_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|4826998_4827955_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
>prophage 11
NC_011742	Escherichia coli S88, complete genome	5032268	4953651	5002510	5032268	integrase,portal,tail,protease,holin,terminase	Enterobacteria_phage(46.15%)	62	4952853:4952867	4982381:4982395
4952853:4952867	attL	GCGATGGCGGAAATC	NA	NA	NA	NA
WP_001218287.1|4953651_4954866_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	99.3	1.6e-236
WP_000653746.1|4955241_4956237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206727.1|4956804_4957425_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	95.1	2.6e-118
WP_001242728.1|4957424_4957787_-	hypothetical protein	NA	U5P092	Shigella_phage	95.8	1.3e-64
WP_000008232.1|4957777_4958314_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	100.0	7.4e-101
WP_000081290.1|4958441_4959266_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.0e-149
WP_000135682.1|4959331_4959694_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_001311077.1|4960416_4961109_-	helix-turn-helix domain-containing protein	NA	S5FUZ3	Shigella_phage	96.5	2.9e-121
WP_001191669.1|4961206_4961467_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_000526665.1|4961459_4962011_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	99.5	1.7e-100
WP_001087313.1|4962007_4963159_+	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	99.2	1.6e-214
WP_000620695.1|4963155_4963380_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	4.8e-38
WP_000061487.1|4963376_4964195_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	87.8	6.2e-123
WP_000055034.1|4964197_4964686_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.9	1.4e-85
WP_000210132.1|4964685_4965012_+	LexA repressor	NA	U5P451	Shigella_phage	96.3	1.1e-51
WP_000767093.1|4965008_4965398_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	2.1e-68
WP_001061398.1|4965417_4966215_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	9.8e-150
WP_016230662.1|4966222_4967212_+	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	99.7	4.3e-195
WP_001047084.1|4967225_4967978_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	96.4	1.1e-131
WP_016230663.1|4968249_4968339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000087756.1|4968393_4968606_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066482.1|4968906_4969122_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	2.6e-25
WP_000839581.1|4969874_4970090_+|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	90.1	7.9e-30
WP_000189904.1|4970094_4970646_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	50.6	4.2e-35
WP_001306174.1|4970593_4970854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101173.1|4970967_4971501_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
WP_001071776.1|4971497_4971995_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_000066495.1|4972358_4972571_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071526745.1|4972581_4972770_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|4972917_4973073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|4973245_4973419_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000548593.1|4973714_4973921_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_000349509.1|4974473_4974965_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_000934113.1|4974964_4977067_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.7	0.0e+00
WP_001072975.1|4977063_4977276_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985947.1|4977275_4978784_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	1.6e-289
WP_001136588.1|4978728_4980756_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_001097041.1|4980842_4981166_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	98.1	5.5e-51
WP_001283153.1|4981158_4981434_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677127.1|4981445_4982024_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	3.6e-101
WP_001079398.1|4982020_4982422_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
4982381:4982395	attR	GCGATGGCGGAAATC	NA	NA	NA	NA
WP_000211132.1|4982432_4983176_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.2	8.1e-130
WP_001341514.1|4983236_4983623_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	97.7	5.2e-64
WP_001161009.1|4983631_4983961_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000372024.1|4983932_4986998_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447251.1|4986997_4987327_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	3.0e-60
WP_001152371.1|4987336_4988035_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.7	1.9e-133
WP_000140707.1|4988039_4988783_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.9	1.8e-145
WP_000741589.1|4988680_4989328_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
WP_000515501.1|4989388_4992784_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	89.7	0.0e+00
WP_001233090.1|4992851_4993451_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_000741761.1|4993515_4995894_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	75.9	7.4e-185
WP_000654139.1|4995893_4996175_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	48.9	3.1e-18
WP_000235978.1|4996184_4996889_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	4.6e-58
WP_000355601.1|4996899_4997193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086522.1|4997420_4998011_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
WP_000836768.1|4998327_4998561_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_001372053.1|4998629_4998743_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	77.8	1.4e-06
WP_001217539.1|4999169_4999418_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000202563.1|4999637_5001224_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001295748.1|5001616_5002222_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|5002348_5002510_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
