The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_011741	Escherichia coli IAI1, complete genome	4700560	807309	883093	4700560	head,tail,integrase,transposase,portal,terminase,lysis,capsid	Enterobacteria_phage(47.46%)	88	805842:805876	883238:883272
805842:805876	attL	GTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCA	NA	NA	NA	NA
WP_000533641.1|807309_808380_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	2.5e-201
WP_001303849.1|808357_808576_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_087451024.1|808870_809991_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_001336414.1|810356_810641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208012.1|810725_811301_-	hypothetical protein	NA	K7P7E3	Enterobacteria_phage	96.5	8.3e-58
WP_000582228.1|811311_812067_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	92.8	2.5e-142
WP_001289863.1|812068_812476_-	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	97.0	1.4e-67
WP_000763365.1|812472_812694_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	97.3	1.4e-34
WP_001395510.1|812792_813074_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000548537.1|813084_813276_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000682313.1|813248_813431_-	DUF1317 family protein	NA	A0A0P0ZAS9	Stx2-converting_phage	91.7	2.2e-25
WP_000186804.1|813427_814108_-	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	98.7	1.3e-131
WP_000100847.1|814104_814890_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995420.1|814895_815192_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	1.8e-48
WP_000233576.1|815268_815475_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000581650.1|815953_816466_-	DUF4411 family protein	NA	NA	NA	NA	NA
WP_000741702.1|816462_817602_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_001295669.1|817731_818424_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
WP_000184665.1|818534_818762_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001182887.1|818792_819332_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_000147901.1|819328_820348_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	4.4e-110
WP_000788833.1|820344_821046_+	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	98.3	3.2e-128
WP_000145946.1|821042_821336_+	winged helix-turn-helix transcriptional regulator	NA	A0A0P0ZCJ0	Stx2-converting_phage	84.9	3.7e-38
WP_000371307.1|821624_822377_+	DUF4145 domain-containing protein	NA	A0A1S6L018	Salmonella_phage	36.5	3.9e-31
WP_000622057.1|822633_823116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072106870.1|823207_823309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001050829.1|823305_823761_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	5.4e-60
WP_000224916.1|823760_823931_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_000774490.1|823923_824214_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	2.5e-47
WP_001099516.1|824210_824573_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	94.0	2.3e-58
WP_001586249.1|824569_824710_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001204791.1|824795_825179_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737266.1|825368_826466_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	76.5	2.2e-155
WP_000839596.1|827054_827270_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135278.1|827269_827767_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001228695.1|827983_828166_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738421.1|828256_828550_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001307652.1|828912_829107_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000453587.1|829495_830041_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027259.1|830015_831941_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000198149.1|831937_832144_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001345555.1|832140_833742_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	1.3e-310
WP_000123317.1|833722_835042_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.1	5.6e-235
WP_001358225.1|835051_835384_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_000063254.1|835439_836465_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.2	2.8e-189
WP_000158870.1|836506_836902_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	3.5e-55
WP_000752953.1|836913_837267_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	4.9e-61
WP_000975086.1|837278_837857_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	3.9e-79
WP_000683128.1|837853_838249_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_024190502.1|838256_838997_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	8.0e-130
WP_000479134.1|839012_839435_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	9.1e-70
WP_000459457.1|839416_839851_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840331.1|839843_842423_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	93.7	0.0e+00
WP_000847379.1|842419_842749_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152639.1|842748_843447_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000194780.1|843452_844196_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090891.1|844132_844765_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000515723.1|844825_848305_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.8	0.0e+00
WP_001230477.1|848373_848973_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	8.5e-106
WP_000268779.1|849037_852793_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	K7PGT9	Enterobacteria_phage	69.2	2.7e-306
WP_000246055.1|854478_855222_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000767389.1|856324_856801_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_001389241.1|856859_858149_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	3.8e-18
WP_000951213.1|858235_859276_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_000118827.1|859272_860427_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000246781.1|860413_861169_+	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000044868.1|861161_861839_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000042533.1|862417_864439_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_001295302.1|864630_865539_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
WP_001295301.1|865935_866925_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_000084632.1|866946_867459_+	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_000080885.1|867461_867947_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000598619.1|867939_868185_+	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000852287.1|868186_868639_+	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000373624.1|868775_869480_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_001331162.1|869681_870329_+	Bax inhibitor-1 family protein	NA	NA	NA	NA	NA
WP_001088647.1|870398_871112_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000045450.1|871147_872104_-	UPF0104 family protein	NA	NA	NA	NA	NA
WP_000650337.1|872103_873345_-	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_001113348.1|873341_874103_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000871982.1|874235_874646_+	YbhQ family protein	NA	NA	NA	NA	NA
WP_000469031.1|874607_875714_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000070131.1|875724_876858_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000996091.1|876850_878587_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	1.3e-18
WP_001296990.1|878579_879575_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|879577_880249_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007101.1|880477_881842_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_000399648.1|882112_883093_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
883238:883272	attR	GTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCA	NA	NA	NA	NA
>prophage 2
NC_011741	Escherichia coli IAI1, complete genome	4700560	1646433	1704817	4700560	head,tail,integrase,portal,terminase,lysis,capsid	Enterobacteria_phage(34.62%)	74	1677066:1677081	1709514:1709529
WP_000527797.1|1646433_1647894_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	1.1e-42
WP_000347483.1|1647982_1649266_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1649869_1649983_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1650051_1650285_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086514.1|1650601_1651192_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000885616.1|1651289_1651865_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_024190505.1|1651864_1654825_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	53.7	4.0e-55
WP_001233090.1|1654889_1655489_-	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_000515369.1|1655559_1659057_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	98.1	0.0e+00
WP_000090891.1|1659117_1659750_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000194780.1|1659686_1660430_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000847331.1|1661134_1661464_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840330.1|1661460_1664040_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	95.0	0.0e+00
WP_000459457.1|1664032_1664467_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479134.1|1664448_1664871_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	9.1e-70
WP_024190506.1|1664886_1665627_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.6	1.4e-129
WP_000683128.1|1665634_1666030_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_000975086.1|1666026_1666605_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	3.9e-79
WP_000752953.1|1666616_1666970_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	4.9e-61
WP_000158870.1|1666981_1667377_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	3.5e-55
WP_000063254.1|1667418_1668444_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.2	2.8e-189
WP_001358225.1|1668499_1668832_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_000123317.1|1668841_1670161_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.1	5.6e-235
WP_001345555.1|1670141_1671743_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	1.3e-310
WP_000198149.1|1671739_1671946_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027295.1|1671942_1673868_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000453611.1|1673842_1674388_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001368374.1|1674776_1675010_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1675067_1675478_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1675629_1675803_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1675974_1676130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122134696.1|1676209_1676275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|1676277_1676466_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1676476_1676689_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1677052_1677550_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
1677066:1677081	attL	TTTTTATCTCTTAAAG	NA	NA	NA	NA
WP_001092971.1|1677546_1678080_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189915.1|1678076_1678388_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1678392_1678608_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1679361_1679577_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1679877_1680090_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1680144_1680234_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|1680511_1681264_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|1681277_1682327_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|1682328_1682607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1682673_1682925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1683141_1683297_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323026.1|1683368_1683656_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	64.9	6.9e-29
WP_000534858.1|1683655_1683895_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1683919_1684225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001317460.1|1684427_1684760_+	FlxA-like family protein	NA	NA	NA	NA	NA
WP_000955176.1|1686715_1686898_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	1.7e-12
WP_001374839.1|1688204_1688561_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	71.4	4.8e-40
WP_001151262.1|1688557_1688980_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_000054512.1|1689020_1689986_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	2.2e-55
WP_000705358.1|1689966_1690488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1690471_1690702_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1690785_1691193_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1691359_1691515_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171942.1|1691674_1691893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329848.1|1691896_1692061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1692450_1692639_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083297.1|1692635_1692827_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048317.1|1692919_1695391_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_000005552.1|1695463_1695715_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000877005.1|1695749_1697030_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	2.5e-155
WP_015953164.1|1697031_1697160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836079.1|1697217_1698237_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001295394.1|1698248_1699463_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1699668_1699995_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|1700129_1700471_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1700505_1701066_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1701068_1701779_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001307224.1|1701886_1702192_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041554.1|1702390_1704817_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	2.0e-214
1709514:1709529	attR	TTTTTATCTCTTAAAG	NA	NA	NA	NA
>prophage 3
NC_011741	Escherichia coli IAI1, complete genome	4700560	2268385	2277827	4700560		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292767.1|2268385_2269522_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
WP_023277811.1|2269518_2271519_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001295429.1|2271643_2272105_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001365803.1|2272145_2272616_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	3.0e-82
WP_000598641.1|2272662_2273382_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2273378_2275064_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2275285_2276017_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216961.1|2276076_2276184_+	protein YohO	NA	NA	NA	NA	NA
WP_000783138.1|2276164_2276896_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569361.1|2276900_2277827_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 4
NC_011741	Escherichia coli IAI1, complete genome	4700560	2720943	2765225	4700560	tRNA,plate,tail,integrase,terminase,holin,capsid	Salmonella_phage(53.85%)	51	2723283:2723299	2765470:2765486
WP_001295367.1|2720943_2721480_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000190655.1|2721504_2722140_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_015953195.1|2722348_2723197_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
2723283:2723299	attL	AATTGTGATATGTGTGA	NA	NA	NA	NA
WP_001288814.1|2723831_2724479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185986.1|2725053_2726121_+	acyltransferase	NA	NA	NA	NA	NA
WP_000994383.1|2726376_2726793_-|tail	tail fiber assembly protein	tail	U5P0S4	Shigella_phage	73.0	3.4e-21
WP_024190510.1|2726792_2727860_-	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	68.7	5.9e-57
WP_000049954.1|2727859_2728540_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	77.0	5.5e-101
WP_001197079.1|2728536_2729736_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	83.9	1.3e-185
WP_001270632.1|2729735_2730089_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	89.7	9.0e-55
WP_000301088.1|2730088_2730841_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	66.3	1.6e-88
WP_000758868.1|2731615_2731969_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	84.0	1.3e-29
WP_000081748.1|2731968_2733036_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	80.2	6.5e-157
WP_000155119.1|2733038_2733341_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	92.0	2.2e-49
WP_001298404.1|2733340_2733928_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.0	3.4e-83
WP_000990885.1|2733927_2735913_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	53.5	4.4e-175
WP_000393958.1|2736089_2736542_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.0	1.8e-55
WP_000109249.1|2736545_2736986_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_000046919.1|2736996_2738142_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.5	5.2e-160
WP_001349562.1|2738145_2738709_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	76.3	3.4e-80
WP_001142484.1|2738683_2739073_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	96.1	1.1e-66
WP_000008724.1|2739059_2739614_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	72.3	1.5e-67
WP_001125666.1|2739610_2740018_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.1	2.8e-68
WP_000627480.1|2740246_2741188_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.6	1.4e-155
WP_001066735.1|2741199_2741706_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	78.7	3.2e-69
WP_000873177.1|2741709_2742930_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	90.2	2.1e-207
WP_000246483.1|2742944_2743682_-|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	90.6	1.4e-102
WP_000113494.1|2743566_2745036_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	94.7	1.5e-268
WP_001130796.1|2745035_2746658_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.4	0.0e+00
WP_000162796.1|2746660_2747233_-|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	69.6	1.4e-60
WP_000779566.1|2747294_2747819_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	66.9	4.5e-42
WP_001194119.1|2747802_2748279_-	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	96.2	2.1e-86
WP_000781776.1|2748282_2748624_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	91.9	2.8e-53
WP_001244504.1|2749027_2749462_-	antitermination protein Q	NA	B6SD39	Bacteriophage	62.9	7.4e-43
WP_001284069.1|2749748_2751935_-	replication protein	NA	B6SD37	Bacteriophage	72.4	5.4e-174
WP_000016209.1|2751938_2752139_-	transcriptional regulator	NA	K7RWG7	Bacteriophage	50.0	1.0e-07
WP_000567467.1|2752280_2752955_+	helix-turn-helix transcriptional regulator	NA	B6SCU0	Bacteriophage	50.7	6.7e-59
WP_001288045.1|2753373_2753898_-	hypothetical protein	NA	K7P861	Enterobacteria_phage	47.5	1.4e-35
WP_000801672.1|2754111_2754261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000051349.1|2754257_2755160_+	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
WP_001113507.1|2755162_2756464_+	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	56.1	6.1e-133
WP_000769006.1|2756479_2757028_+	DUF2815 family protein	NA	Q775A5	Bordetella_phage	65.9	1.2e-66
WP_000551020.1|2757080_2757710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065480.1|2757756_2759820_+	DNA polymerase	NA	Q775A3	Bordetella_phage	67.4	5.1e-275
WP_001157067.1|2759884_2760646_+	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_000065111.1|2760880_2761075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000312942.1|2761074_2761362_+	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	66.3	4.5e-28
WP_001127518.1|2761374_2762172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015953207.1|2762239_2763634_+	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	74.4	5.4e-212
WP_001291431.1|2763630_2763831_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001138329.1|2763827_2765225_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2765470:2765486	attR	AATTGTGATATGTGTGA	NA	NA	NA	NA
>prophage 5
NC_011741	Escherichia coli IAI1, complete genome	4700560	2903215	2910355	4700560		Escherichia_phage(83.33%)	6	NA	NA
WP_001272898.1|2903215_2905777_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141333.1|2905882_2906539_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	2.8e-49
WP_001297141.1|2906589_2907357_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|2907552_2908461_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|2908457_2909720_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|2909716_2910355_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 6
NC_011741	Escherichia coli IAI1, complete genome	4700560	4486120	4543901	4700560	protease,transposase	Pectobacterium_phage(11.11%)	60	NA	NA
WP_000312488.1|4486120_4487380_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|4487382_4488387_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|4488468_4488666_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|4488769_4490068_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177644.1|4490272_4490698_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076316.1|4490736_4493178_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001293282.1|4493357_4494089_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220137.1|4494215_4494617_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511955.1|4494635_4495334_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012553.1|4495384_4496044_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|4496061_4496460_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101653.1|4496469_4497108_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_001299837.1|4497110_4498274_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	3.7e-81
WP_001299838.1|4498357_4499983_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|4500099_4500375_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254642.1|4500523_4500853_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569728.1|4501034_4501784_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|4501780_4502536_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|4502643_4503708_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_001300695.1|4504062_4505460_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_015953248.1|4505475_4505781_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776505.1|4505790_4506255_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056749.1|4506268_4506919_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949489.1|4506928_4507783_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170797.1|4507782_4508469_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000492914.1|4508598_4508874_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|4509200_4509596_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|4509602_4509917_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|4509921_4510149_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|4510190_4510640_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001351393.1|4510710_4511505_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604912.1|4512127_4512559_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	1.9e-43
WP_001367946.1|4512566_4513775_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	9.2e-208
WP_001119478.1|4513909_4514548_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|4514766_4515387_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228343.1|4515695_4517108_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331465.1|4517152_4517815_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001324314.1|4517922_4518888_-	DMT family transporter	NA	NA	NA	NA	NA
WP_015953249.1|4518995_4519856_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000084622.1|4519944_4520325_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589420.1|4520453_4522397_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886909.1|4522586_4523327_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000175289.1|4523316_4523874_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|4524198_4524405_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935042.1|4524466_4525810_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001295196.1|4526132_4526771_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|4526976_4528710_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060927.1|4528706_4532486_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|4532488_4532830_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223208.1|4533041_4533293_+	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_000239579.1|4533286_4533637_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055075.1|4533716_4534247_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265933.1|4534556_4535513_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205781.1|4535652_4537155_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-11
WP_001296689.1|4537168_4538191_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596015.1|4538177_4539173_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|4539205_4540204_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_001219792.1|4540379_4541753_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|4541903_4542455_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|4542548_4543901_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
