The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_014011	Aminobacterium colombiense DSM 12261, complete sequence	1980592	1033694	1041469	1980592	tRNA	Staphylococcus_phage(50.0%)	7	NA	NA
WP_013048384.1|1033694_1034966_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.5	6.5e-95
WP_013048385.1|1034965_1035451_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.7	2.9e-35
WP_013048386.1|1035472_1036714_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	51.3	5.3e-110
WP_013048387.1|1036746_1037406_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.6	2.5e-34
WP_013048388.1|1037387_1038497_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.1	4.4e-47
WP_013048389.1|1038474_1039950_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_013048390.1|1040050_1041469_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	32.7	7.3e-63
>prophage 2
NC_014011	Aminobacterium colombiense DSM 12261, complete sequence	1980592	1111367	1190872	1980592	integrase,protease,terminase,head,tail,tRNA,plate,portal	Vibrio_phage(28.21%)	92	1131055:1131077	1170131:1170153
WP_013048462.1|1111367_1111766_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_169302803.1|1111762_1112710_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_041459590.1|1113086_1116644_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_013048465.1|1116938_1117769_+	ribosomal RNA small subunit methyltransferase A	NA	NA	NA	NA	NA
WP_013048466.1|1117801_1118077_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	54.9	3.4e-17
WP_013048467.1|1118200_1119511_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_169302804.1|1119553_1121389_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_041459350.1|1121364_1122591_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.2	8.8e-41
WP_013048470.1|1122571_1122823_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_041459351.1|1122838_1123423_-	guanylate kinase	NA	A0A1L2JY06	Liberibacter_phage	34.5	7.7e-19
WP_013048472.1|1123406_1123670_-	DUF370 domain-containing protein	NA	NA	NA	NA	NA
WP_013048473.1|1123675_1124560_-	YicC family protein	NA	NA	NA	NA	NA
WP_041459592.1|1124586_1125705_-	GTPase HflX	NA	NA	NA	NA	NA
WP_013048475.1|1125706_1126333_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_013048476.1|1126329_1127007_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_013048477.1|1127111_1127834_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_013048478.1|1127837_1128380_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.8	1.1e-19
WP_013048479.1|1128351_1129125_-	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_013048480.1|1129137_1130133_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_013048481.1|1130192_1130969_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
1131055:1131077	attL	TGGTGGGCCTACCTGGACTCGAA	NA	NA	NA	NA
WP_013048484.1|1131564_1131897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169302805.1|1131838_1132123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169302806.1|1132161_1132485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013048487.1|1132494_1132872_-	DUF882 domain-containing protein	NA	R9ZW03	Cellulophaga_phage	46.6	6.5e-19
WP_013048488.1|1132946_1133543_-	DUF4376 domain-containing protein	NA	A0A1S5R1J2	Pseudomonas_phage	54.0	1.0e-18
WP_013048489.1|1133676_1135362_-|tail	phage tail protein	tail	A0A0A7RTP0	Clostridium_phage	54.9	3.8e-50
WP_013048490.1|1135373_1136030_-|tail	phage tail protein I	tail	A0A059WLJ8	Vibrio_phage	37.4	4.0e-24
WP_013048491.1|1136022_1137132_-|plate	baseplate J/gp47 family protein	plate	A0A059WFM2	Vibrio_phage	46.4	6.7e-88
WP_013048492.1|1137118_1137439_-	GPW/gp25 family protein	NA	A0A067ZJ13	Vibrio_phage	50.5	3.3e-16
WP_013048493.1|1137442_1137832_-|tail	phage tail protein	tail	A0A0C5AN08	Bacteriophage	39.1	1.0e-22
WP_041459598.1|1138144_1138573_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	45.9	5.3e-25
WP_013048496.1|1138596_1139610_-	late control D family protein	NA	A0A067ZG47	Vibrio_phage	41.3	1.6e-67
WP_013048497.1|1139606_1139825_-|tail	phage tail protein gpX	tail	A0A067ZJB1	Vibrio_phage	43.1	4.1e-10
WP_013048498.1|1139817_1142250_-|tail	phage tail tape measure protein	tail	A0A097I4X9	Vibrio_phage	42.5	6.3e-123
WP_013048499.1|1142400_1142682_-|tail	phage tail assembly protein	tail	A0A0C5AEP1	Bacteriophage	46.2	4.4e-12
WP_013048500.1|1142695_1143220_-|tail	phage major tail tube protein	tail	A0A067ZJA9	Vibrio_phage	59.8	4.2e-56
WP_013048501.1|1143232_1144681_-|tail	phage tail sheath family protein	tail	A0A059WKP9	Vibrio_phage	61.6	4.2e-183
WP_013048502.1|1144670_1144955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013048503.1|1144955_1145399_-	hypothetical protein	NA	A0A067ZIL8	Vibrio_phage	43.6	8.1e-29
WP_013048504.1|1145399_1145954_-|tail	phage tail protein	tail	A0A067ZG41	Vibrio_phage	38.4	5.8e-24
WP_013048505.1|1145950_1146277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013048506.1|1146280_1146616_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_013048507.1|1146631_1148557_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1B0YZU0	Pseudomonas_phage	43.0	8.6e-67
WP_013048508.1|1148537_1150022_-|portal	phage portal protein	portal	G8CLA3	Synechococcus_phage	31.3	1.0e-62
WP_013048509.1|1150015_1150204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169302807.1|1150222_1152037_-|terminase	terminase	terminase	A0A2K9V301	Faecalibacterium_phage	43.8	3.0e-130
WP_013048511.1|1152080_1152605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169302808.1|1152963_1153611_-|integrase	tyrosine-type recombinase/integrase	integrase	H0USV4	Bacillus_phage	44.5	1.0e-27
WP_169302809.1|1154150_1154579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013048516.1|1154836_1155028_-	Lar family restriction alleviation protein	NA	NA	NA	NA	NA
WP_041459355.1|1155033_1155252_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013048517.1|1155244_1156177_-	ATP-binding protein	NA	A0A1B1P8D0	Bacillus_phage	34.4	5.5e-19
WP_013048518.1|1156173_1157043_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013048519.1|1157072_1157510_-	dUTP diphosphatase	NA	A0A0A0YRI4	Escherichia_phage	48.1	9.8e-27
WP_013048520.1|1157599_1157959_-	DUF4406 domain-containing protein	NA	NA	NA	NA	NA
WP_013048521.1|1157969_1158113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013048522.1|1158216_1158990_-	phage antirepressor Ant	NA	A0A2H4JCR9	uncultured_Caudovirales_phage	56.6	5.5e-73
WP_169302810.1|1158986_1159142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013048524.1|1159138_1159339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013048525.1|1159341_1159566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013048526.1|1159555_1159831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013048527.1|1160230_1160491_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013048528.1|1160641_1161322_+	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_013048529.1|1161393_1162812_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_013048530.1|1162872_1163148_+	S24 family peptidase	NA	NA	NA	NA	NA
WP_013048531.1|1163177_1163717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148211406.1|1163841_1164873_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_013048533.1|1164992_1166684_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_013048534.1|1166792_1167695_+	DNA adenine methylase	NA	A0A219VHB5	Ochrobactrum_phage	22.9	1.2e-10
WP_013048535.1|1167785_1168211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013048536.1|1168220_1168652_-	DUF4065 domain-containing protein	NA	I6R0L8	Salmonella_phage	37.2	3.5e-16
WP_013048537.1|1168836_1169964_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	37.8	4.6e-68
WP_013048538.1|1170314_1170497_-	ferredoxin	NA	NA	NA	NA	NA
1170131:1170153	attR	TGGTGGGCCTACCTGGACTCGAA	NA	NA	NA	NA
WP_013048539.1|1170576_1171368_-	pur operon repressor	NA	NA	NA	NA	NA
WP_013048540.1|1171364_1172240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013048541.1|1172323_1172563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013048542.1|1172659_1174600_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	30.3	1.2e-20
WP_052292810.1|1174592_1176026_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_013048544.1|1176224_1176812_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_013048545.1|1176837_1177410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013048546.1|1177451_1178564_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_013048547.1|1178560_1180372_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	42.2	7.5e-20
WP_013048548.1|1180722_1181442_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D8KNF0	Synechococcus_phage	41.0	1.1e-43
WP_013048549.1|1181442_1181694_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_013048550.1|1181696_1182404_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_041459608.1|1182403_1184557_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	37.9	4.3e-139
WP_013048552.1|1184557_1185931_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	32.8	2.1e-54
WP_013048553.1|1185914_1186907_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FC27	Synechococcus_phage	44.7	1.1e-65
WP_013048554.1|1186909_1187515_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	28.7	7.5e-17
WP_013048555.1|1187501_1189031_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	48.1	3.6e-39
WP_013048556.1|1189043_1190315_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_013048557.1|1190326_1190872_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.6	2.3e-25
>prophage 3
NC_014011	Aminobacterium colombiense DSM 12261, complete sequence	1980592	1828396	1836521	1980592		Planktothrix_phage(16.67%)	9	NA	NA
WP_013049155.1|1828396_1829179_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.5	3.1e-15
WP_013049156.1|1829175_1830003_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.1	3.6e-14
WP_013049157.1|1829947_1831171_-	MFS transporter	NA	NA	NA	NA	NA
WP_013049158.1|1831203_1831800_-	ribonuclease HI family protein	NA	NA	NA	NA	NA
WP_013049159.1|1831792_1832668_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	36.8	3.7e-33
WP_041459390.1|1832769_1833045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013049160.1|1833029_1834286_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	50.0	1.9e-99
WP_013049161.1|1834327_1835521_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	34.0	5.7e-53
WP_041459391.1|1835552_1836521_-	L-threonine 3-dehydrogenase	NA	A0A1E1ESK0	Acanthamoeba_castellanii_mimivirus	27.2	7.3e-06
