The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_014121	Enterobacter cloacae subsp. cloacae ATCC 13047, complete sequence	5314581	472223	525014	5314581	integrase,transposase	uncultured_Caudovirales_phage(47.37%)	56	500653:500708	535483:535538
WP_099516394.1|472223_473436_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.8	1.7e-100
WP_007372635.1|473726_474236_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	37.8	6.5e-22
WP_007372636.1|474308_474737_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.8e-49
WP_013095195.1|474794_476084_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	72.5	3.3e-171
WP_013095196.1|476124_477891_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_044158970.1|477914_478280_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_013095198.1|478302_478782_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	51.3	1.8e-34
WP_013095199.1|478838_479192_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	47.2	5.9e-22
WP_013095200.1|479311_479494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052768258.1|479650_480160_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_013095204.1|480364_481366_+	permease	NA	NA	NA	NA	NA
WP_013095205.1|481379_481610_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_013095206.1|481720_481924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372648.1|482005_482833_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	39.9	7.5e-52
WP_013095207.1|482850_484329_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	73.8	2.2e-195
WP_007372650.1|485081_485309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001137910.1|485594_485915_+	DUF134 domain-containing protein	NA	NA	NA	NA	NA
WP_013095208.1|485889_486351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044158965.1|487780_488218_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_013095212.1|488331_488808_+	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	2.4e-18
WP_013095213.1|489110_489461_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013095214.1|489622_491281_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013095215.1|491341_492499_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	63.9	1.3e-121
WP_013095218.1|492946_493855_+	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_013095219.1|493851_494277_+	universal stress protein	NA	NA	NA	NA	NA
WP_013095220.1|494293_495583_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	54.0	1.5e-123
WP_044158961.1|495664_496054_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	58.0	5.5e-29
WP_013095222.1|496423_496843_+	universal stress protein	NA	NA	NA	NA	NA
WP_044158959.1|497105_498644_+	DNA mismatch repair protein MutS	NA	NA	NA	NA	NA
WP_013095225.1|498640_500149_+	DNA mismatch repair protein MutS	NA	A0A076FGT9	Aureococcus_anophage	24.6	1.2e-07
500653:500708	attL	GGCTTTGTTGAATAAATCAGATTTCGGGTAAGTCTCCCCCGTAGCGGGTTGTGTTT	NA	NA	NA	NA
WP_013087110.1|500708_501677_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	6.1e-186
WP_077681925.1|501698_502226_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_077270200.1|502480_502945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013095229.1|505867_506752_+|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_099725561.1|506825_507272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013095231.1|507558_507948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013095232.1|508030_508393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013095233.1|508516_508813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099725666.1|508896_509334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013095235.1|509443_510055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013095236.1|510127_511111_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	38.9	6.2e-53
WP_013095237.1|511207_512158_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_013095238.1|512284_512971_+	N-6 DNA methylase	NA	A0A2K9V411	Faecalibacterium_phage	37.6	1.5e-29
WP_054442362.1|513018_513432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109455549.1|513683_514891_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.6	1.8e-102
WP_109455548.1|514966_515461_-	HNH endonuclease	NA	E7EKU5	Edwardsiella_phage	65.6	1.8e-45
WP_164928065.1|515488_516645_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.1	1.9e-178
WP_013095243.1|516626_517451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013095244.1|517447_517927_-	macro domain-containing protein	NA	NA	NA	NA	NA
WP_013095245.1|517923_518577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013095246.1|518592_519129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044158948.1|519201_520419_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_099725667.1|520504_521356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013095250.1|521668_522229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086538577.1|522433_524014_+	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_013095253.1|524048_525014_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
535483:535538	attR	GGCTTTGTTGAATAAATCAGATTTCGGGTAAGTCTCCCCCGTAGCGGGTTGTGTTT	NA	NA	NA	NA
>prophage 2
NC_014121	Enterobacter cloacae subsp. cloacae ATCC 13047, complete sequence	5314581	1326594	1366738	5314581	holin,lysis,terminase,tail	Salmonella_phage(28.3%)	59	NA	NA
WP_013095940.1|1326594_1326921_-	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	81.1	3.9e-44
WP_013095941.1|1326966_1327170_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	76.1	1.6e-24
WP_044158833.1|1327147_1327486_-	DUF2591 family protein	NA	R9VYJ6	Serratia_phage	42.5	1.1e-14
WP_164928057.1|1327818_1328415_-	HNH endonuclease	NA	A0A142IF90	Pseudomonas_phage	42.3	4.8e-24
WP_013095944.1|1328404_1329046_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	91.3	7.2e-111
WP_013095946.1|1329509_1330190_-	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	94.2	2.9e-126
WP_013095947.1|1330186_1331032_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	61.6	1.6e-70
WP_013095948.1|1331050_1331335_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	96.8	1.6e-49
WP_001752704.1|1331413_1331620_-	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	100.0	3.6e-32
WP_013095950.1|1331616_1331775_-	hypothetical protein	NA	G8C7T3	Escherichia_phage	86.5	2.7e-19
WP_013095951.1|1331771_1332128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023330696.1|1332292_1332523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052429250.1|1333135_1333411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032656806.1|1333442_1334147_-	helix-turn-helix transcriptional regulator	NA	A0A2H4FNG6	Salmonella_phage	66.7	1.5e-88
WP_013095954.1|1334251_1334485_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	67.6	1.1e-21
WP_013095955.1|1334514_1335060_+	hypothetical protein	NA	K7P7P2	Enterobacteria_phage	97.8	6.2e-95
WP_013095956.1|1335145_1335313_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	78.2	2.1e-14
WP_013095957.1|1335299_1336385_+	replication protein	NA	E5AGE9	Erwinia_phage	45.6	3.0e-85
WP_013095958.1|1336381_1337755_+	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	63.5	9.9e-166
WP_044159472.1|1337759_1338059_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	52.6	2.2e-17
WP_013095961.1|1338588_1338819_+	hypothetical protein	NA	G8C7U9	Escherichia_phage	92.1	6.9e-32
WP_013095962.1|1338815_1339373_+	ead/Ea22-like family protein	NA	K7PJQ4	Enterobacteria_phage	85.1	1.6e-50
WP_006808975.1|1340029_1340212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013095964.1|1340211_1340454_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	96.2	1.5e-37
WP_013095965.1|1340456_1340678_+	hypothetical protein	NA	G8C7V2	Escherichia_phage	100.0	6.4e-35
WP_013095966.1|1340862_1341312_+	recombination protein NinB	NA	I6R9D0	Salmonella_phage	46.5	7.2e-33
WP_013095967.1|1341304_1341475_+	NinE family protein	NA	K7P7K0	Enterobacteria_phage	82.1	4.2e-18
WP_013095968.1|1341467_1342100_+	recombination protein NinG	NA	S4TSR3	Salmonella_phage	55.1	6.5e-56
WP_013095969.1|1342209_1342887_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	51.6	2.0e-55
WP_044158185.1|1342883_1343369_+	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	55.1	2.3e-40
WP_013095970.1|1343889_1344114_+|holin	class II holin family protein	holin	M9NZI9	Enterobacteria_phage	94.6	2.7e-33
WP_013095971.1|1344091_1344586_+	lysozyme	NA	M9P0E5	Enterobacteria_phage	98.2	1.9e-90
WP_013095972.1|1344582_1345044_+|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	77.8	2.3e-58
WP_013095973.1|1345293_1345821_+	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	61.9	2.3e-54
WP_013095974.1|1345999_1346218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013095975.1|1346383_1347022_+	hypothetical protein	NA	I6S676	Salmonella_phage	93.4	2.2e-115
WP_013095976.1|1347054_1347513_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	82.2	3.3e-65
WP_044158824.1|1347505_1348753_+|terminase	terminase	terminase	I6RSK1	Salmonella_phage	97.5	1.0e-214
WP_013095979.1|1349072_1350422_+	DUF1073 domain-containing protein	NA	Q5G8Y4	Enterobacteria_phage	82.0	4.3e-214
WP_013095980.1|1350381_1351308_+	hypothetical protein	NA	Q5G8Y3	Enterobacteria_phage	91.6	7.1e-160
WP_044159460.1|1351374_1352634_+	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	90.7	5.1e-217
WP_013095982.1|1352646_1353096_+	hypothetical protein	NA	H6WRT3	Salmonella_phage	85.2	9.3e-65
WP_013095983.1|1353113_1354190_+	hypothetical protein	NA	A0A1V0E5P6	Salmonella_phage	90.8	5.5e-188
WP_013095984.1|1354199_1354493_+	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	91.8	2.7e-44
WP_013095985.1|1354555_1354957_+	hypothetical protein	NA	A0A1V0E5R0	Salmonella_phage	80.8	3.5e-55
WP_013095986.1|1354956_1355130_+	hypothetical protein	NA	I6R0P9	Salmonella_phage	50.0	3.9e-11
WP_013095987.1|1355129_1355480_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	66.1	3.4e-38
WP_013095988.1|1355494_1355683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044158239.1|1355725_1356094_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	62.0	1.7e-35
WP_044158236.1|1356090_1356474_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	57.5	4.4e-39
WP_044158234.1|1356532_1357288_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	48.2	2.6e-51
WP_013095991.1|1357338_1358082_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	51.8	2.9e-63
WP_013095992.1|1358154_1358529_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	46.8	7.9e-25
WP_013095993.1|1358586_1360887_+	tape measure protein	NA	A0A1B1W284	Salmonella_phage	40.2	1.1e-97
WP_013095994.1|1360886_1361384_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	90.9	6.0e-89
WP_013095995.1|1361383_1361854_+	hypothetical protein	NA	F1C5F1	Cronobacter_phage	92.9	7.0e-79
WP_013095996.1|1361867_1362233_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	93.3	2.2e-64
WP_013095997.1|1362219_1364697_+|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	92.5	0.0e+00
WP_013095998.1|1364755_1366738_+	hypothetical protein	NA	F1C5A8	Cronobacter_phage	77.4	2.7e-55
>prophage 3
NC_014121	Enterobacter cloacae subsp. cloacae ATCC 13047, complete sequence	5314581	1514737	1585398	5314581	transposase,tRNA,plate	Salmonella_phage(28.57%)	60	NA	NA
WP_013096140.1|1514737_1515433_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_013096141.1|1515470_1516052_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_013096142.1|1516255_1517941_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	2.2e-34
WP_029882295.1|1518012_1519140_+	ribonuclease D	NA	NA	NA	NA	NA
WP_008500504.1|1519213_1519483_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_013096144.1|1519486_1520299_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_013096145.1|1520322_1521030_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_013096146.1|1521153_1521429_+	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_013096147.1|1521476_1522136_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_014832353.1|1522228_1522669_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_028028084.1|1522790_1523321_-	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_013096152.1|1525108_1525828_+	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_013096153.1|1525910_1527443_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_013096155.1|1527763_1529062_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_013096156.1|1529071_1530142_+	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_013096157.1|1530189_1531923_-	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_013096158.1|1532020_1532935_-	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_013096159.1|1533031_1533643_+	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_013096160.1|1533681_1534413_-	flagellar brake protein	NA	NA	NA	NA	NA
WP_013096161.1|1534619_1534874_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_029882291.1|1534987_1537090_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_013096163.1|1537157_1538843_-	alpha,alpha-trehalase	NA	NA	NA	NA	NA
WP_013096164.1|1539208_1540567_+	MFS transporter	NA	NA	NA	NA	NA
WP_013096165.1|1540661_1542041_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_013096166.1|1542054_1543011_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_013096167.1|1543126_1544314_+	MFS transporter	NA	NA	NA	NA	NA
WP_013096168.1|1544355_1545366_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_013096169.1|1545444_1546425_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013096170.1|1546589_1547561_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_044158197.1|1547553_1548345_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_013096172.1|1548310_1550599_-	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_013096174.1|1551461_1551956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013096175.1|1551979_1552483_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_013096176.1|1552508_1553852_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_013096177.1|1553869_1555108_+	DotU family type VI secretion system protein	NA	NA	NA	NA	NA
WP_013096178.1|1555110_1558731_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_013096179.1|1558747_1559464_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_013096180.1|1559475_1560492_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_008502644.1|1560567_1561092_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_013096181.1|1561095_1562595_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_008502640.1|1562930_1563413_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_013096182.1|1563471_1563963_+	type VI secretion system amidase effector protein Tae4	NA	NA	NA	NA	NA
WP_013096183.1|1563959_1564313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013096184.1|1564400_1566170_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_013096185.1|1566166_1566964_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_013096186.1|1566980_1567967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013096187.1|1567976_1568789_+	type VI secretion system protein ImpE	NA	NA	NA	NA	NA
WP_013096188.1|1568781_1569345_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_038420938.1|1569347_1571219_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_013096190.1|1571215_1572259_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_013096191.1|1572297_1574913_+	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	31.3	1.4e-80
WP_013096192.1|1574937_1576371_+	serine/threonine protein kinase	NA	M1HKB5	Acanthocystis_turfacea_Chlorella_virus	27.8	2.1e-09
WP_013096193.1|1576407_1577826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013096194.1|1577822_1578584_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_164928058.1|1578900_1579350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013087110.1|1579445_1580414_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	6.1e-186
WP_013096196.1|1581562_1581910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013096197.1|1582006_1583935_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.2	8.4e-46
WP_082208141.1|1583984_1584428_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	60.8	6.5e-18
WP_013087110.1|1584429_1585398_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	6.1e-186
>prophage 4
NC_014121	Enterobacter cloacae subsp. cloacae ATCC 13047, complete sequence	5314581	1680991	1749519	5314581	transposase,tail,integrase,holin,protease,terminase,portal	Enterobacteria_phage(29.41%)	77	1688838:1688855	1719025:1719042
WP_013096290.1|1680991_1682110_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21929	Phage_21	45.0	9.7e-79
WP_013096292.1|1682408_1682651_-	DUF4060 family protein	NA	NA	NA	NA	NA
WP_013096293.1|1682637_1684539_-	exodeoxyribonuclease VIII	NA	S4TNL0	Salmonella_phage	29.8	6.6e-27
WP_013096295.1|1684761_1685034_-	hypothetical protein	NA	H6WRX2	Salmonella_phage	48.1	2.0e-14
WP_044158271.1|1685492_1685789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044158267.1|1686184_1686580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044158265.1|1686674_1686932_+	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	34.3	3.3e-06
WP_013096297.1|1686931_1687381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013096299.1|1688369_1689110_+	ATP-binding protein	NA	H6WRX8	Salmonella_phage	72.3	8.7e-100
1688838:1688855	attL	GATGACCTCTGCAAAGTT	NA	NA	NA	NA
WP_013096300.1|1689127_1689784_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	28.3	4.6e-12
WP_013096301.1|1689985_1690459_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.8	1.2e-67
WP_044158262.1|1690462_1690810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044158261.1|1690996_1691320_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	63.6	4.1e-30
WP_044158259.1|1691441_1691660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013096305.1|1691804_1692098_+	hypothetical protein	NA	Q6V7S4	Burkholderia_virus	57.0	3.2e-21
WP_013096306.1|1692090_1692447_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	61.0	3.1e-39
WP_013096307.1|1692443_1693046_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	65.3	6.6e-74
WP_013096308.1|1693383_1693632_+	hypothetical protein	NA	I6PCV4	Cronobacter_phage	85.4	1.8e-30
WP_044158257.1|1693635_1694466_+	hypothetical protein	NA	I6PD67	Cronobacter_phage	80.5	1.3e-123
WP_044158255.1|1694787_1694979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013096310.1|1695594_1695984_+|holin	phage holin family protein	holin	G8C7V8	Escherichia_phage	100.0	4.0e-64
WP_013096311.1|1695973_1696252_+|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	97.8	2.1e-43
WP_044158253.1|1696251_1696881_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	92.8	1.9e-108
WP_013096313.1|1696888_1697164_+	hypothetical protein	NA	K7PGW4	Enterobacterial_phage	100.0	1.1e-07
WP_131725267.1|1697297_1697879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013096315.1|1697951_1699409_+	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	89.5	7.3e-268
WP_013096316.1|1699420_1699756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013096317.1|1699709_1699967_-	hypothetical protein	NA	K7P7V5	Enterobacteria_phage	96.3	3.2e-33
WP_044158251.1|1700671_1701160_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	92.0	3.7e-75
WP_013096319.1|1701159_1703262_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	97.7	0.0e+00
WP_013096320.1|1703258_1703474_+	hypothetical protein	NA	K7PMB5	Enterobacterial_phage	95.8	1.6e-30
WP_013096321.1|1703470_1704970_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	99.0	2.7e-286
WP_044158249.1|1705449_1706685_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	43.2	1.7e-100
WP_044158246.1|1706686_1706911_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_013096324.1|1706976_1708326_-	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	85.7	9.5e-230
WP_014883655.1|1708349_1708544_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_072072172.1|1708676_1708964_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_013096325.1|1708956_1709136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013096326.1|1709140_1709464_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_013096327.1|1709460_1710870_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	70.5	1.1e-135
WP_013096329.1|1711325_1711814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044158243.1|1712313_1712526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013096330.1|1712522_1714439_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	58.5	1.3e-216
WP_072072171.1|1714591_1714843_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	44.8	1.9e-06
WP_087776199.1|1714930_1716138_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.7	2.6e-101
WP_044158375.1|1716201_1716774_+|tail	tail assembly protein	tail	K7P6V1	Enterobacteria_phage	78.3	9.1e-73
WP_044158372.1|1716824_1717478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013096334.1|1719343_1719670_+	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	92.5	4.4e-48
1719025:1719042	attR	AACTTTGCAGAGGTCATC	NA	NA	NA	NA
WP_044067056.1|1719662_1719938_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	63.7	5.2e-26
WP_013096336.1|1719946_1720501_+|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	84.7	3.5e-69
WP_013096337.1|1720497_1720896_+|tail	tail protein	tail	S5MW30	Escherichia_phage	64.4	2.5e-45
WP_013096338.1|1720903_1721641_+|tail	phage tail protein	tail	O64327	Escherichia_phage	98.8	2.7e-130
WP_013096339.1|1721679_1722102_+|tail	phage minor tail protein G	tail	K7P7M5	Enterobacteria_phage	97.1	9.1e-54
WP_013096340.1|1722110_1722431_+|tail	phage tail assembly protein T	tail	K7P6V0	Enterobacteria_phage	97.2	1.4e-54
WP_013096341.1|1722408_1724925_+|tail	phage tail tape measure protein	tail	K7P7A9	Enterobacteria_phage	99.2	0.0e+00
WP_013096342.1|1724930_1725278_+|tail	phage tail protein	tail	K7P7G7	Enterobacteria_phage	99.1	1.4e-60
WP_000055651.1|1725274_1726030_+|tail	phage minor tail protein L	tail	K7P6G9	Enterobacteria_phage	99.6	3.9e-148
WP_013096343.1|1726031_1726763_+	C40 family peptidase	NA	K7P7M8	Enterobacteria_phage	99.6	4.0e-150
WP_044158363.1|1726750_1727338_+|tail	tail assembly protein	tail	K7P6V1	Enterobacteria_phage	99.5	2.2e-98
WP_013096345.1|1727391_1731219_+|tail	phage tail protein	tail	K7PKR4	Enterobacteria_phage	79.3	0.0e+00
WP_013096346.1|1731220_1732186_+	hypothetical protein	NA	G1CSU0	Cronobacter_virus	40.6	3.6e-61
WP_013096348.1|1733177_1733453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077681905.1|1733439_1734012_-|tail	tail fiber domain-containing protein	tail	NA	NA	NA	NA
WP_044159385.1|1734136_1734685_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	80.0	6.4e-76
WP_123906383.1|1735043_1735469_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	47.2	2.4e-25
WP_013096351.1|1735555_1735795_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	89.9	2.2e-33
WP_013096355.1|1737554_1738364_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_013096356.1|1738363_1739557_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_013096357.1|1739567_1740926_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.9	9.5e-36
WP_013096358.1|1740929_1742525_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	37.3	8.5e-52
WP_106993556.1|1744181_1744226_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_013096361.1|1744365_1745247_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_013096362.1|1745243_1745864_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_013096363.1|1745960_1746836_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_013096364.1|1746872_1747463_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_013096365.1|1747459_1748221_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	22.5	2.3e-07
WP_013096366.1|1748472_1749519_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	28.7	6.2e-19
>prophage 5
NC_014121	Enterobacter cloacae subsp. cloacae ATCC 13047, complete sequence	5314581	2232431	2240986	5314581		Escherichia_phage(66.67%)	10	NA	NA
WP_013096791.1|2232431_2233646_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.2	8.2e-47
WP_013096792.1|2233757_2234084_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	4.2e-22
WP_013096793.1|2234237_2234576_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_013096794.1|2234575_2235133_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_077681884.1|2235150_2235861_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_013096796.1|2235966_2236260_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_013096797.1|2236406_2238845_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.4	9.8e-217
WP_013096798.1|2238855_2239473_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_013096799.1|2239474_2240329_+	dimethyl sulfoxide reductase anchor subunit family protein	NA	A0A077SK59	Escherichia_phage	36.1	6.2e-25
WP_013096800.1|2240371_2240986_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	37.3	2.1e-30
>prophage 6
NC_014121	Enterobacter cloacae subsp. cloacae ATCC 13047, complete sequence	5314581	2747861	2765570	5314581	transposase,tRNA	Salmonella_phage(20.0%)	19	NA	NA
WP_013097275.1|2747861_2750474_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.4	2.4e-19
WP_013097276.1|2750899_2751139_+	DinI family protein	NA	K7PKM2	Enterobacterial_phage	89.9	6.5e-33
WP_087451024.1|2751241_2752361_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_088581786.1|2753067_2754215_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	5.0e-147
WP_072072180.1|2754259_2754442_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_102135191.1|2754491_2755277_+	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	35.6	3.9e-34
WP_044158727.1|2755452_2755884_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_044158724.1|2755950_2756337_+	S24 family peptidase	NA	F1C5A0	Cronobacter_phage	60.0	4.9e-38
WP_006811079.1|2756443_2756668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013097278.1|2756660_2757068_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	86.6	4.7e-47
WP_013097279.1|2757257_2757671_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	64.7	3.1e-46
WP_013097280.1|2757670_2758249_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	68.2	9.8e-75
WP_044158720.1|2758260_2759004_+	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	86.2	3.4e-120
WP_044158718.1|2759006_2759378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013097283.1|2759361_2759619_+	excisionase family protein	NA	S4TND0	Salmonella_phage	90.0	1.8e-36
WP_013097284.1|2759663_2760956_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	95.6	6.1e-242
WP_013097285.1|2761140_2762343_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.6	3.8e-44
WP_029882977.1|2762508_2763909_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.2	1.1e-79
WP_164928068.1|2764517_2765570_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	50.3	3.0e-90
>prophage 7
NC_014121	Enterobacter cloacae subsp. cloacae ATCC 13047, complete sequence	5314581	2829866	2915086	5314581	transposase,tail,holin,integrase,head,plate,terminase,capsid,portal	Cronobacter_phage(56.82%)	89	2881405:2881426	2912885:2912906
WP_088581786.1|2829866_2831014_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	5.0e-147
WP_013097330.1|2831208_2831904_+	aquaporin Z	NA	NA	NA	NA	NA
WP_013097331.1|2832061_2832961_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_013097332.1|2833104_2834757_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_013097333.1|2834767_2835736_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_013097334.1|2835833_2836268_-	DoxX family protein	NA	NA	NA	NA	NA
WP_013097335.1|2836420_2838139_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.2	2.3e-31
WP_013097336.1|2838177_2839179_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_013097337.1|2839189_2840626_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_013097338.1|2840718_2841732_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013097339.1|2841828_2843670_-	chitinase	NA	NA	NA	NA	NA
WP_013097340.1|2843806_2844259_-	type III secretion system invasion protein IagB	NA	NA	NA	NA	NA
WP_013097341.1|2844396_2847120_-	glycoside hydrolase	NA	B0FDP2	Orgyia_leucostigma_nucleopolyhedrovirus	60.1	2.3e-190
WP_013097342.1|2847383_2848181_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_013097343.1|2848177_2848663_-	type II secretion system protein M	NA	NA	NA	NA	NA
WP_013097344.1|2848659_2849790_-	general secretion pathway protein GspL	NA	NA	NA	NA	NA
WP_013097345.1|2849805_2850822_-	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_013097346.1|2850818_2851490_-	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_013097347.1|2851486_2851861_-	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_013097348.1|2851853_2852339_-	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_013097349.1|2852338_2852788_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_013097350.1|2852790_2853999_-	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_013097351.1|2853998_2855477_-	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_013097352.1|2855490_2857419_-	type II secretion system secretin GspD	NA	NA	NA	NA	NA
WP_040022860.1|2857431_2858163_-	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_013097356.1|2860015_2860642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013097357.1|2860638_2861262_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013097358.1|2861525_2862356_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	3.7e-06
WP_006174327.1|2862352_2862676_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013097359.1|2862783_2863302_+	lipoprotein	NA	NA	NA	NA	NA
WP_013097360.1|2863528_2864257_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.6e-29
WP_013097361.1|2864277_2865009_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013097362.1|2865015_2865732_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_013097363.1|2865731_2866400_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_013097364.1|2866555_2867287_+	ABC transporter substrate-binding protein ArtJ	NA	NA	NA	NA	NA
WP_044158735.1|2867373_2868843_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.7	2.4e-24
WP_013097367.1|2869638_2870778_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	2.3e-27
WP_013097368.1|2870818_2871292_-	YbjO family protein	NA	NA	NA	NA	NA
WP_013097369.1|2871357_2872203_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_013097370.1|2872199_2873153_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_013097371.1|2873163_2874297_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.4	6.5e-30
WP_013097372.1|2874440_2875553_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_003858385.1|2875904_2876381_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_013097373.1|2876444_2877347_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	33.6	1.1e-37
WP_013097374.1|2877398_2878121_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_006809455.1|2878305_2878575_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	71.8	7.9e-27
WP_013097375.1|2878921_2879305_-	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_013097376.1|2879575_2881261_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
2881405:2881426	attL	ATGGGTTTTTTGTTGCCTGAAA	NA	NA	NA	NA
WP_013097377.1|2881515_2882634_-	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_164928060.1|2882938_2883316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013097379.1|2883354_2885031_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	63.7	1.4e-206
WP_013097380.1|2885033_2885582_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.9	3.1e-62
WP_013097381.1|2885553_2886279_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	50.2	4.5e-61
WP_044158745.1|2886268_2886700_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	46.0	1.3e-23
WP_085929673.1|2887079_2888247_+|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.1	1.9e-178
WP_013097383.1|2888253_2890236_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.5	6.2e-153
WP_013097384.1|2890245_2890833_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	79.5	8.4e-90
WP_013097385.1|2890825_2892010_-|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	78.8	2.0e-175
WP_013097386.1|2892006_2892336_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	70.6	1.3e-36
WP_013097388.1|2894829_2895090_-|tail	putative phage tail assembly chaperone	tail	A5X9I7	Aeromonas_virus	62.8	2.1e-21
WP_013097389.1|2895209_2895578_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	52.4	1.8e-21
WP_013097390.1|2895577_2895919_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	90.1	1.1e-49
WP_013097391.1|2895915_2896212_-|holin	phage holin family protein	holin	S4TP56	Salmonella_phage	46.9	9.9e-15
WP_013097392.1|2896221_2896677_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	3.5e-59
WP_013097393.1|2896673_2897801_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	82.9	2.5e-175
WP_013097394.1|2897797_2898505_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	78.6	1.0e-102
WP_013097395.1|2898501_2899008_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	70.3	5.6e-66
WP_013097396.1|2899004_2899457_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	76.7	1.9e-57
WP_013097397.1|2899555_2900257_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	4.4e-85
WP_013097398.1|2900260_2901283_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	79.4	9.3e-153
WP_013097399.1|2901342_2902137_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	55.6	2.2e-69
WP_013097400.1|2902309_2904085_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	82.4	5.4e-289
WP_013097401.1|2904137_2905133_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	81.0	2.7e-157
WP_044158755.1|2905129_2905453_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	89.4	7.4e-48
WP_013097403.1|2905426_2905639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131725270.1|2905758_2907774_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	75.4	3.3e-303
WP_013097405.1|2907775_2907988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013097406.1|2907984_2908851_-	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	93.2	7.2e-146
WP_013097407.1|2908841_2909075_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_013097408.1|2909141_2909543_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	54.1	6.0e-39
WP_013097409.1|2909542_2909971_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.2	5.8e-24
WP_013097410.1|2909960_2910155_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_013097411.1|2910164_2910668_-	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	70.7	1.9e-58
WP_013097412.1|2910700_2910922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044158758.1|2911058_2911679_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	37.8	5.0e-32
WP_013097414.1|2911757_2912807_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	54.6	4.1e-103
WP_044158760.1|2912996_2913317_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	54.9	9.1e-22
2912885:2912906	attR	ATGGGTTTTTTGTTGCCTGAAA	NA	NA	NA	NA
WP_013097417.1|2913352_2914642_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	3.1e-169
WP_013097418.1|2914654_2915086_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	67.1	2.4e-49
>prophage 8
NC_014121	Enterobacter cloacae subsp. cloacae ATCC 13047, complete sequence	5314581	3242751	3278289	5314581	transposase,tail,holin,lysis,protease,terminase	Cronobacter_phage(30.0%)	46	NA	NA
WP_013097701.1|3242751_3243582_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_032652866.1|3244243_3244633_-	DNA polymerase V	NA	K7P6F7	Enterobacteria_phage	65.6	6.4e-46
WP_032652865.1|3244745_3245108_+	GtrA family protein	NA	U5P0S6	Shigella_phage	81.7	3.7e-48
WP_013097703.1|3245104_3246025_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	86.8	7.6e-154
WP_013097704.1|3246021_3247521_+	glucosyltransferase domain-containing protein	NA	A0A192Y7W8	Salmonella_phage	24.7	3.2e-24
WP_013097705.1|3247549_3249523_-	hypothetical protein	NA	F1C5A8	Cronobacter_phage	75.9	3.9e-54
WP_044158819.1|3249581_3252059_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	92.2	0.0e+00
WP_013097707.1|3252045_3252438_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	89.5	9.6e-66
WP_013097708.1|3252447_3252918_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	92.9	3.1e-79
WP_013097709.1|3252917_3253415_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	90.9	4.6e-89
WP_013097710.1|3253414_3256864_-	tape measure protein	NA	R9TMK1	Aeromonas_phage	57.4	2.7e-236
WP_013097711.1|3256922_3257606_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	61.1	1.3e-78
WP_013097712.1|3257665_3258409_-	Ig-like domain-containing protein	NA	F1C5E5	Cronobacter_phage	85.3	6.3e-74
WP_013097713.1|3258472_3258856_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	61.4	4.4e-39
WP_044158821.1|3258852_3259221_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	63.9	9.4e-39
WP_013097714.1|3259223_3259583_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	65.8	1.7e-37
WP_013097716.1|3259734_3259905_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	48.2	3.8e-11
WP_013097717.1|3259904_3260306_-	hypothetical protein	NA	G0ZNE1	Cronobacter_phage	78.9	3.5e-55
WP_013097718.1|3260368_3260662_-	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	90.7	2.2e-43
WP_013095983.1|3260671_3261748_-	hypothetical protein	NA	A0A1V0E5P6	Salmonella_phage	90.8	5.5e-188
WP_013095982.1|3261765_3262215_-	hypothetical protein	NA	H6WRT3	Salmonella_phage	85.2	9.3e-65
WP_044159460.1|3262227_3263487_-	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	90.7	5.1e-217
WP_013095980.1|3263553_3264480_-	hypothetical protein	NA	Q5G8Y3	Enterobacteria_phage	91.6	7.1e-160
WP_013095979.1|3264439_3265789_-	DUF1073 domain-containing protein	NA	Q5G8Y4	Enterobacteria_phage	82.0	4.3e-214
WP_044158824.1|3266108_3267356_-|terminase	terminase	terminase	I6RSK1	Salmonella_phage	97.5	1.0e-214
WP_013095976.1|3267348_3267807_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	82.2	3.3e-65
WP_013097719.1|3267838_3268477_-	hypothetical protein	NA	I6S676	Salmonella_phage	92.0	2.4e-114
WP_013097720.1|3268480_3268699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025759831.1|3268800_3269250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013097722.1|3269714_3269999_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	67.0	1.9e-26
WP_013097723.1|3270008_3270473_-|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	66.7	2.6e-46
WP_013095971.1|3270469_3270964_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	98.2	1.9e-90
WP_013095970.1|3270941_3271166_-|holin	class II holin family protein	holin	M9NZI9	Enterobacteria_phage	94.6	2.7e-33
WP_087776199.1|3271927_3273134_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.7	2.6e-101
WP_164928062.1|3273126_3273513_-	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	53.4	1.1e-26
WP_013097724.1|3273509_3274187_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	51.1	2.9e-54
WP_088567025.1|3274183_3274300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044158181.1|3274296_3274476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013097725.1|3274472_3275117_-	recombination protein NinG	NA	S4TSR3	Salmonella_phage	68.2	3.9e-72
WP_072072169.1|3275109_3275280_-	NinE family protein	NA	G8C7V4	Escherichia_phage	86.8	2.2e-19
WP_013097726.1|3275276_3275714_-	recombination protein NinB	NA	G8C7V3	Escherichia_phage	69.0	1.6e-53
WP_072072168.1|3275892_3276072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013097727.1|3276068_3276317_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	95.0	5.9e-37
WP_131725278.1|3276386_3276635_-	hypothetical protein	NA	A0A1I9KF90	Aeromonas_phage	46.7	3.5e-13
WP_013097728.1|3276631_3277036_-	hypothetical protein	NA	A0A248SKW5	Klebsiella_phage	47.2	1.0e-06
WP_085929673.1|3277120_3278289_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.1	1.9e-178
>prophage 9
NC_014121	Enterobacter cloacae subsp. cloacae ATCC 13047, complete sequence	5314581	3402830	3410583	5314581		Bodo_saltans_virus(16.67%)	7	NA	NA
WP_000954830.1|3402830_3403442_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.3	6.0e-14
WP_013097848.1|3403481_3404462_-	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_013097849.1|3404654_3405659_+	NAD-dependent epimerase	NA	A0A2K9L4U8	Tupanvirus	30.7	7.8e-35
WP_013097850.1|3405710_3406877_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.0	2.7e-111
WP_013097851.1|3407117_3407999_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.1	6.9e-104
WP_013097852.1|3407995_3409084_-	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	52.0	5.0e-96
WP_000043519.1|3409176_3410583_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	4.0e-37
>prophage 10
NC_014121	Enterobacter cloacae subsp. cloacae ATCC 13047, complete sequence	5314581	3614052	3623135	5314581		Pseudomonas_phage(33.33%)	7	NA	NA
WP_013098011.1|3614052_3616338_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	64.0	6.0e-285
WP_013098012.1|3616445_3617576_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.4	6.0e-177
WP_013098013.1|3617575_3617830_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	67.9	5.1e-28
WP_109455534.1|3617997_3619641_+	GMC family oxidoreductase N-terminal domain-containing protein	NA	A0A1V0S9J5	Catovirus	30.6	1.7e-23
WP_044157966.1|3619534_3621091_+	GMC family oxidoreductase N-terminal domain-containing protein	NA	A0A1V0SI18	Klosneuvirus	28.0	2.2e-36
WP_013098016.1|3621122_3622052_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013098017.1|3622076_3623135_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	50.9	7.7e-09
>prophage 11
NC_014121	Enterobacter cloacae subsp. cloacae ATCC 13047, complete sequence	5314581	3638223	3682485	5314581	transposase,holin,integrase,lysis,capsid,plate,terminase	Enterobacteria_phage(22.03%)	75	3632829:3632845	3682595:3682611
3632829:3632845	attL	GCCAGTAAGAGACGCAT	NA	NA	NA	NA
WP_013098030.1|3638223_3639246_-	hypothetical protein	NA	K4HZC0	Acinetobacter_phage	37.7	5.5e-12
WP_013098031.1|3639247_3639835_-	DUF2612 domain-containing protein	NA	A0A077K9U8	Edwardsiella_phage	44.2	8.3e-37
WP_013098032.1|3639831_3641064_-|plate	baseplate J/gp47 family protein	plate	A0A077KGW9	Edwardsiella_phage	51.6	1.7e-108
WP_044157974.1|3641072_3641429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013098033.1|3641465_3642173_-	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	38.5	2.7e-34
WP_013098034.1|3642173_3643034_-	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.4	2.2e-38
WP_013098035.1|3643023_3643335_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	44.4	1.8e-19
WP_109455533.1|3643334_3643991_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	47.1	6.6e-27
WP_013098037.1|3644134_3645904_-	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	40.7	1.7e-48
WP_013098038.1|3645903_3646101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013098039.1|3646115_3646520_-	hypothetical protein	NA	H9C0W7	Aeromonas_phage	47.2	8.5e-17
WP_013098040.1|3646528_3646870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013098041.1|3646969_3648448_-	DUF3383 domain-containing protein	NA	A6N3B0	Burkholderia_virus	37.5	2.5e-74
WP_044159291.1|3648448_3648940_-	hypothetical protein	NA	A0A077KC88	Edwardsiella_phage	28.6	2.9e-11
WP_044157976.1|3648996_3649365_-	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	48.8	9.8e-28
WP_044157978.1|3649361_3649814_-	hypothetical protein	NA	A0A077KC03	Edwardsiella_phage	45.3	2.1e-24
WP_044157982.1|3649816_3650260_-	DUF4054 domain-containing protein	NA	K4HYQ8	Acinetobacter_phage	36.4	5.3e-12
WP_013098045.1|3650262_3650589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013098046.1|3650592_3651627_-	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	51.4	1.1e-87
WP_044157985.1|3651626_3652109_-	hypothetical protein	NA	A0A077KAW3	Edwardsiella_phage	54.1	1.8e-37
WP_044157986.1|3652110_3653298_-	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	35.7	1.3e-57
WP_044159293.1|3653310_3654000_-|capsid	minor capsid protein	capsid	H9C0V1	Aeromonas_phage	53.5	1.3e-65
WP_013098050.1|3654058_3655585_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.8	1.5e-101
WP_013098051.1|3655585_3657244_-|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	74.7	5.2e-246
WP_013098052.1|3657245_3657722_-|terminase	phage terminase small subunit	terminase	C7U0W1	Enterobacteria_phage	73.3	3.2e-55
WP_044157989.1|3657724_3657922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007851400.1|3657923_3658085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013098054.1|3658084_3658294_-	hypothetical protein	NA	K4I3A7	Salmonella_phage	66.0	2.2e-08
WP_013098055.1|3658587_3658875_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	67.4	1.7e-32
WP_013098056.1|3658911_3659370_-|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	60.5	6.6e-42
WP_044159299.1|3659366_3659855_-	lysozyme	NA	A0A2H4FND7	Salmonella_phage	88.9	1.5e-79
WP_044157993.1|3659832_3660036_-|holin	phage holin family protein	holin	I6R0S9	Salmonella_phage	89.6	3.4e-30
WP_013098059.1|3660486_3661251_-	antitermination protein	NA	Q5G8R6	Enterobacteria_phage	93.7	1.8e-137
WP_044157995.1|3661247_3661670_-	HNH endonuclease	NA	C6ZR29	Salmonella_phage	68.8	1.1e-51
WP_013098060.1|3661666_3661852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060568999.1|3661839_3662037_-	protein ninH	NA	A0A1R3Y5V4	Salmonella_virus	68.3	8.3e-18
WP_044158000.1|3662113_3662356_-	hypothetical protein	NA	A0A1V0E5R3	Salmonella_phage	77.5	6.8e-30
WP_044158002.1|3662352_3662718_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	77.5	1.2e-46
WP_044158004.1|3662714_3663005_-	DUF1364 domain-containing protein	NA	K7P6U2	Enterobacteria_phage	85.3	1.0e-43
WP_044158005.1|3662997_3663174_-	NinF family protein	NA	NA	NA	NA	NA
WP_013098061.1|3663166_3663535_-	DUF2591 family protein	NA	A0A1J0GWC2	Alteromonas_phage	42.1	2.7e-17
WP_044158007.1|3663536_3663764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013098063.1|3664133_3664544_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	86.0	1.8e-62
WP_044158012.1|3664515_3664875_-	hypothetical protein	NA	A0A193H1Z1	Shigella_phage	47.0	1.6e-22
WP_044158013.1|3664877_3665129_-	hypothetical protein	NA	A0A220NQX3	Salmonella_phage	41.7	6.5e-07
WP_013098064.1|3665140_3665350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044158017.1|3665375_3665777_-	DUF2591 family protein	NA	A0A1J0GUX1	Halomonas_phage	35.1	2.0e-05
WP_085929673.1|3665810_3666979_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.1	1.9e-178
WP_013098065.1|3666947_3667478_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_013098066.1|3667481_3668816_-	DNA helicase	NA	A0A2I7R8E4	Vibrio_phage	37.6	1.9e-76
WP_013098067.1|3668815_3669715_-	replication protein	NA	A0A1I9KG10	Aeromonas_phage	43.4	6.3e-28
WP_013098068.1|3669701_3669860_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	86.3	4.3e-17
WP_023972039.1|3669904_3670195_-	hypothetical protein	NA	I6RSP4	Salmonella_phage	86.5	1.9e-39
WP_013098070.1|3670305_3670503_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	85.7	1.3e-23
WP_044158020.1|3670603_3671317_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	78.9	1.2e-106
WP_013098071.1|3671695_3672166_+	glycine zipper family protein	NA	NA	NA	NA	NA
WP_013098072.1|3672198_3672408_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	67.2	1.7e-16
WP_013098074.1|3674233_3674599_+	antitermination protein	NA	C6ZR44	Salmonella_phage	80.2	5.5e-47
WP_044157947.1|3674602_3674905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044157944.1|3674950_3675145_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	42.3	1.2e-05
WP_044157941.1|3675294_3675681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013098076.1|3675766_3675898_+	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	65.0	1.3e-06
WP_013098077.1|3675882_3676029_+	host cell division inhibitory peptide Kil	NA	K7PM80	Enterobacteria_phage	69.8	3.9e-12
WP_013098078.1|3676104_3676275_+	hypothetical protein	NA	A5VWA7	Enterobacteria_phage	75.0	2.0e-15
WP_013098079.1|3676287_3677160_+	ATP-binding protein	NA	A0A1B1P9H8	Acinetobacter_phage	56.0	8.7e-59
WP_044157939.1|3677160_3677610_+	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	75.6	2.7e-56
WP_013098081.1|3677685_3678030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013098082.1|3678209_3678695_+	hypothetical protein	NA	A0A0F6N6A6	Escherichia_phage	66.4	9.5e-31
WP_013098083.1|3678691_3679168_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	50.6	2.3e-37
WP_013098084.1|3679164_3679764_+	DUF551 domain-containing protein	NA	G8C7V0	Escherichia_phage	65.8	1.0e-29
WP_044157936.1|3679979_3680180_+	hypothetical protein	NA	G8C7S1	Escherichia_phage	68.2	1.8e-20
WP_013098086.1|3680192_3680807_+	DUF5420 family protein	NA	A0A220NQT7	Salmonella_phage	69.7	4.0e-82
WP_165444164.1|3680842_3680995_+	hypothetical protein	NA	W6B279	Escherichia_phage	63.6	2.3e-07
WP_071990016.1|3681077_3681275_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_013098087.1|3681243_3682485_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	39.5	4.0e-73
3682595:3682611	attR	GCCAGTAAGAGACGCAT	NA	NA	NA	NA
>prophage 12
NC_014121	Enterobacter cloacae subsp. cloacae ATCC 13047, complete sequence	5314581	4510315	4551234	5314581	tail,integrase,lysis,protease,head,plate,terminase,capsid,tRNA,portal	Salmonella_phage(80.49%)	50	4519470:4519485	4551274:4551289
WP_013098773.1|4510315_4512310_-|protease	serine protease	protease	Q2A0D0	Sodalis_phage	24.8	3.1e-19
WP_029883055.1|4512658_4513339_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_013098775.1|4513370_4514384_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	8.2e-109
WP_001144069.1|4514620_4514836_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_013098776.1|4514952_4516698_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.2	2.9e-77
WP_013098777.1|4516863_4518711_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_013098778.1|4518820_4519315_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
4519470:4519485	attL	GACTCATAATCGCTTG	NA	NA	NA	NA
WP_024146528.1|4519652_4519871_-	DNA-binding transcriptional regulator	NA	Q53ZE7	Salmonella_virus	75.0	4.9e-27
WP_013098779.1|4519940_4521041_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	92.1	7.6e-185
WP_013098780.1|4521037_4521523_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	94.4	1.7e-72
WP_054442331.1|4521519_4525056_-|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	62.2	0.0e+00
WP_007848878.1|4525048_4525168_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	92.3	3.3e-14
WP_007848877.1|4525182_4525485_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	91.0	3.7e-41
WP_007848874.1|4525539_4526055_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	93.0	7.6e-87
WP_013098782.1|4526064_4527237_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	92.8	4.7e-209
WP_044157605.1|4527372_4527801_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	47.6	2.8e-26
WP_013098785.1|4529122_4529728_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	95.0	2.1e-112
WP_013098786.1|4529720_4530629_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	92.4	2.6e-146
WP_013098787.1|4530615_4530975_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	92.4	2.4e-55
WP_013098788.1|4530971_4531550_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	96.9	2.2e-106
WP_044157606.1|4531618_4532065_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	88.4	4.2e-65
WP_013098790.1|4532057_4532489_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	96.5	8.1e-74
WP_164928070.1|4532584_4533013_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	98.6	1.1e-67
WP_013098792.1|4533009_4533387_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	96.8	4.4e-60
WP_001069919.1|4533391_4533901_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	98.8	2.2e-94
WP_000171565.1|4533881_4534097_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_013098793.1|4534100_4534304_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	98.5	1.5e-33
WP_010835209.1|4534303_4534768_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.7	6.4e-85
WP_013098794.1|4534861_4535512_-|terminase	small terminase subunit	terminase	A0A1S6KZX1	Salmonella_phage	99.1	3.2e-114
WP_013098795.1|4535515_4536577_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	99.2	7.8e-195
WP_013098796.1|4536593_4537427_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	96.4	1.8e-125
WP_044157610.1|4537569_4539336_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	94.7	0.0e+00
WP_013098798.1|4539335_4540370_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.6	2.0e-174
WP_013098799.1|4540407_4541256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013098800.1|4541265_4541928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013098801.1|4541947_4542757_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_013098802.1|4542874_4543024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217561.1|4543119_4543353_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	2.2e-33
WP_001154443.1|4543364_4543553_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	6.1e-26
WP_013098803.1|4543714_4546123_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	97.0	0.0e+00
WP_013098804.1|4546113_4546974_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	81.1	1.7e-131
WP_013098805.1|4546970_4547198_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	5.1e-35
WP_013098806.1|4547197_4547431_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	79.2	6.0e-23
WP_013098807.1|4547498_4547840_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	85.8	7.6e-51
WP_072072160.1|4547803_4548004_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	92.4	6.7e-31
WP_013098809.1|4548011_4548521_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	91.7	1.5e-82
WP_013098810.1|4548555_4548792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072072161.1|4548880_4549534_+	phage repressor protein CI	NA	F1BUN8	Cronobacter_phage	33.8	3.5e-28
WP_044157615.1|4549526_4549961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013098812.1|4550148_4551234_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	60.2	6.5e-120
4551274:4551289	attR	GACTCATAATCGCTTG	NA	NA	NA	NA
>prophage 1
NC_014107	Enterobacter cloacae subsp. cloacae ATCC 13047 plasmid pECL_A, complete sequence	199562	39197	89855	199562	transposase,integrase	uncultured_Caudovirales_phage(31.58%)	59	35844:35859	70561:70576
35844:35859	attL	GCCGTCGAGCAAGGTG	NA	NA	NA	NA
WP_099516394.1|39197_40411_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.8	1.7e-100
WP_013087123.1|40630_40834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013087126.1|41376_41667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013087127.1|41797_42328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013087128.1|42346_43123_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.4	3.5e-51
WP_015572055.1|43825_44836_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	55.2	6.3e-85
WP_013087133.1|45576_46743_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	93.8	1.8e-216
WP_013087134.1|46742_47708_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	76.9	9.8e-136
WP_013087135.1|48357_49629_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.0	4.7e-154
WP_013087136.1|49628_50060_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.0e-28
WP_077681920.1|50291_51263_+	StbA family protein	NA	A0A222YXF2	Escherichia_phage	47.4	8.2e-74
WP_013087138.1|51265_51928_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_013087139.1|51931_52195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013087140.1|52223_52427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013087142.1|52801_53269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013087143.1|53791_54484_+	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	36.7	7.5e-29
WP_013087144.1|54480_54702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013087145.1|54757_55180_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_013087148.1|55536_55965_+	antirestriction protein	NA	NA	NA	NA	NA
WP_013087149.1|56007_56418_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_071888820.1|56468_56666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013087154.1|57435_57708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013087155.1|57751_58117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013087156.1|58184_60197_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_032669078.1|60234_60669_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_013087158.1|60665_61397_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_013087159.1|61393_61624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032669168.1|61665_61845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087654045.1|62066_63435_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	69.7	1.2e-78
WP_012540252.1|63653_64004_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	5.3e-23
WP_012540111.1|64051_64414_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_013087164.1|64431_66183_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_012540054.1|66230_67520_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.5	4.6e-173
WP_013087165.1|67532_67958_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	71.4	2.5e-51
WP_013087166.1|67992_68529_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_162875198.1|68653_70405_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_013087168.1|70431_70794_-	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
70561:70576	attR	GCCGTCGAGCAAGGTG	NA	NA	NA	NA
WP_013087169.1|70869_71415_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_013087170.1|71423_72137_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.3	8.1e-95
WP_013087171.1|72138_72462_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012540086.1|72762_73029_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_013087172.1|73016_73502_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000589001.1|73920_75261_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_032072095.1|75516_75939_-	nickel resistance OB fold protein NcrY	NA	NA	NA	NA	NA
WP_004196366.1|76100_77231_-	Ni(II)/Co(II) efflux transporter permease subunit NcrC	NA	NA	NA	NA	NA
WP_004196355.1|77243_77513_-	nickel-sensing transcriptional repressor NcrB	NA	NA	NA	NA	NA
WP_004196314.1|77618_78917_-	nickel resistance membrane nickel efflux protein NirA	NA	NA	NA	NA	NA
WP_004196325.1|79150_79909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196315.1|79962_80883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196359.1|80945_81317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196334.1|81663_82641_+	chromate resistance protein	NA	NA	NA	NA	NA
WP_004196363.1|82597_83974_+	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	64.6	1.6e-27
WP_013087175.1|84004_84694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008460272.1|84707_85445_-	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_009651956.1|85488_85854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087451024.1|85889_87010_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_004196370.1|87329_87569_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	9.1e-19
WP_000323025.1|87568_87856_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_085929673.1|88686_89855_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.1	1.9e-178
>prophage 2
NC_014107	Enterobacter cloacae subsp. cloacae ATCC 13047 plasmid pECL_A, complete sequence	199562	132965	172174	199562	protease,transposase,integrase	Shigella_phage(16.67%)	43	139717:139733	172715:172731
WP_013087234.1|132965_133943_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	39.7	1.7e-47
WP_013087235.1|134175_135327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099516394.1|136144_137357_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.8	1.7e-100
WP_032662300.1|137368_138868_-	kinase	NA	NA	NA	NA	NA
WP_013087238.1|138893_140531_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
139717:139733	attL	ACCAGGCCAGCAGCGTC	NA	NA	NA	NA
WP_013087239.1|140530_141571_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_013087240.1|141656_142295_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|142294_142936_-	TerD family protein	NA	NA	NA	NA	NA
WP_001388628.1|142958_143597_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|144060_144528_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506888.1|144545_145754_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000797363.1|145764_146721_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_001182415.1|146720_147800_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	7.3e-39
WP_001040062.1|147801_148575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001282603.1|148567_149710_-	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	34.5	1.5e-29
WP_013087241.1|149719_150802_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_000254136.1|151098_151680_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054787.1|151679_152837_+	TerD family protein	NA	NA	NA	NA	NA
WP_000007448.1|152859_153315_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|153337_154378_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116677.1|154426_155005_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
WP_000301242.1|155072_155648_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053338.1|156076_157318_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000077926.1|157880_158162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000398480.1|158211_158403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151575.1|158494_158836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|159208_159601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|160289_161294_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_003100847.1|161372_161930_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_003100853.1|161923_162295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044159268.1|162291_162753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003465068.1|162884_164564_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	M4T586	Rhodobacter_phage	25.4	2.6e-06
WP_003465065.1|164566_165475_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_013087245.1|165471_166689_+	TniQ family protein	NA	NA	NA	NA	NA
WP_000904941.1|166749_167364_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	50.3	6.6e-37
WP_001087809.1|167416_167653_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_003465059.1|167649_168015_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000136268.1|168031_169678_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.3	1.0e-39
WP_000654684.1|169674_169920_-	mercury resistance system transport protein MerF	NA	NA	NA	NA	NA
WP_000735441.1|169922_170198_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294667.1|170213_170564_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000429838.1|170635_171070_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000427623.1|171169_172174_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
172715:172731	attR	GACGCTGCTGGCCTGGT	NA	NA	NA	NA
