The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_013850	Klebsiella variicola At-22, complete sequence	5458505	1632618	1639544	5458505	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_012967574.1|1632618_1633482_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	22.0	1.2e-07
WP_012967575.1|1633492_1634266_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	1.0e-26
WP_008804075.1|1634505_1635402_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	3.6e-15
WP_008804076.1|1635644_1637006_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.0e-207
WP_004201558.1|1637322_1638045_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_008804077.1|1638041_1639544_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.6e-30
>prophage 2
NC_013850	Klebsiella variicola At-22, complete sequence	5458505	1890402	1936458	5458505	integrase,terminase,head	Salmonella_phage(25.45%)	68	1893322:1893349	1939176:1939203
WP_008804267.1|1890402_1891062_-	exodeoxyribonuclease X	NA	A0A0H4IT92	Pseudoalteromonas_phage	29.7	2.2e-14
WP_012541260.1|1891140_1891371_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	55.9	5.0e-14
WP_012967682.1|1891484_1891859_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_012541262.1|1891862_1892732_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_008804271.1|1892748_1893087_+	YebY family protein	NA	NA	NA	NA	NA
1893322:1893349	attL	ACAGGAATCGTATTCGGTCTCTTTTTAT	NA	NA	NA	NA
WP_012967683.1|1893424_1894510_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	68.4	1.3e-147
WP_012967684.1|1894478_1894751_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	61.1	3.0e-26
WP_012967685.1|1894926_1895124_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	78.5	1.2e-21
WP_032425654.1|1895543_1895738_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	58.3	7.2e-14
WP_012967686.1|1895734_1896007_-	DUF5405 family protein	NA	Q716F1	Shigella_phage	63.5	9.1e-23
WP_012967688.1|1896313_1896796_-	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	75.0	1.0e-61
WP_012967689.1|1896788_1897682_-	recombinase RecT	NA	K7P7A0	Enterobacteria_phage	83.3	1.1e-138
WP_012967690.1|1897678_1897987_-	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	51.0	4.2e-24
WP_012967691.1|1898114_1898396_-	hypothetical protein	NA	A0A1R3Y5U4	Salmonella_virus	67.0	7.0e-26
WP_077248766.1|1898382_1898547_-	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_012967693.1|1898702_1899248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012967694.1|1899294_1899618_-	antitermination protein	NA	A0A0K2FII1	Escherichia_phage	78.5	3.0e-41
WP_012967695.1|1899964_1900627_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	70.5	1.4e-88
WP_012967696.1|1900730_1900940_+	helix-turn-helix transcriptional regulator	NA	I6S1U2	Salmonella_phage	49.3	3.5e-14
WP_012967697.1|1901060_1901360_+	hypothetical protein	NA	A2SY75	Escherichia_phage	71.1	1.6e-28
WP_012967698.1|1901394_1901556_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	92.5	3.3e-20
WP_012967699.1|1901542_1902436_+	hypothetical protein	NA	G5DA89	Enterobacteria_phage	70.3	4.8e-105
WP_012967700.1|1902425_1903859_+	AAA family ATPase	NA	Q716D2	Shigella_phage	85.8	2.5e-228
WP_012967701.1|1903858_1904455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012967703.1|1904968_1905238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012967704.1|1905234_1905900_+	ead/Ea22-like family protein	NA	A0A075B8K3	Enterobacteria_phage	55.0	1.5e-26
WP_012967705.1|1905899_1906190_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	84.2	7.2e-42
WP_012967707.1|1907075_1907315_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	51.7	6.6e-09
WP_012967708.1|1907360_1907783_+	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	83.6	4.2e-67
WP_012967709.1|1907779_1907962_+	hypothetical protein	NA	Q8HAF7	Salmonella_phage	78.0	3.3e-21
WP_012967710.1|1907919_1908099_+	NinE family protein	NA	Q76H73	Enterobacteria_phage	66.7	1.1e-13
WP_012967711.1|1908091_1908277_+	NinF family protein	NA	I6R994	Salmonella_phage	62.5	1.1e-14
WP_012967712.1|1908260_1908551_+	DUF1364 domain-containing protein	NA	K7P6U2	Enterobacteria_phage	86.3	2.6e-44
WP_012967713.1|1908547_1908943_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A220NQY4	Salmonella_phage	93.9	4.7e-68
WP_012967714.1|1908939_1909137_+	protein ninH	NA	I6RSQ6	Salmonella_phage	66.7	1.2e-16
WP_012967715.1|1909124_1909307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012967716.1|1909303_1909915_+	hypothetical protein	NA	A0A2H4FND2	Salmonella_phage	98.0	2.8e-112
WP_012967717.1|1910529_1910844_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	8.3e-44
WP_012967718.1|1910846_1911350_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	79.6	1.0e-75
WP_012967719.1|1911450_1911828_+	hypothetical protein	NA	M9NYX9	Enterobacteria_phage	47.5	1.0e-08
WP_012967720.1|1912362_1912965_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	9.3e-76
WP_012967721.1|1912964_1914437_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.5	4.5e-249
WP_012967722.1|1914449_1915919_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.6	2.4e-149
WP_041165176.1|1915845_1916853_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	67.3	9.3e-113
WP_012967724.1|1916877_1917201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012967725.1|1917273_1918455_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	43.0	4.3e-93
WP_012967726.1|1918458_1918890_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	6.2e-42
WP_012967727.1|1918901_1919999_+	hypothetical protein	NA	F1C5E1	Cronobacter_phage	73.6	3.2e-151
WP_012967728.1|1920008_1920275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012967729.1|1920277_1920658_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	56.1	1.4e-29
WP_012967730.1|1920657_1920831_+	hypothetical protein	NA	I6R0P9	Salmonella_phage	54.4	7.1e-13
WP_012967731.1|1920830_1921178_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	66.1	4.1e-36
WP_012967732.1|1921180_1921621_+	hypothetical protein	NA	A0A1V0E5P5	Salmonella_phage	52.5	2.6e-35
WP_012967733.1|1921617_1922007_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	55.5	4.9e-38
WP_012967734.1|1922075_1922828_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	43.7	3.3e-46
WP_012967735.1|1922878_1923643_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	51.2	7.9e-64
WP_012967736.1|1923858_1924389_+	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	93.1	1.2e-87
WP_012967737.1|1924414_1924984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148671984.1|1924973_1925258_-	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	59.3	6.8e-21
WP_012967739.1|1925481_1926060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012967740.1|1926095_1926425_+	hypothetical protein	NA	A0A222YZ97	Escherichia_phage	52.3	1.2e-21
WP_012967741.1|1926467_1929071_+	tape measure protein	NA	A0A1B1W284	Salmonella_phage	39.0	8.9e-91
WP_012967742.1|1929070_1929616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012967743.1|1929657_1930134_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.0	8.7e-37
WP_012967744.1|1930133_1930604_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	39.7	3.6e-27
WP_012967745.1|1930600_1930996_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	53.6	1.0e-35
WP_012967746.1|1930982_1933460_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.5	2.7e-198
WP_012967748.1|1935654_1936458_+	hypothetical protein	NA	A0A2H4N7C5	Pectobacterium_phage	34.7	8.4e-32
1939176:1939203	attR	ACAGGAATCGTATTCGGTCTCTTTTTAT	NA	NA	NA	NA
>prophage 3
NC_013850	Klebsiella variicola At-22, complete sequence	5458505	2184414	2236256	5458505	integrase,tail,terminase,holin	Escherichia_phage(23.4%)	65	2179262:2179277	2222753:2222768
2179262:2179277	attL	TCGCCGGGCTGGTGGC	NA	NA	NA	NA
WP_012967854.1|2184414_2185662_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	48.7	3.2e-115
WP_012967855.1|2185661_2185877_-	excisionase family protein	NA	A0A0U2RY08	Escherichia_phage	54.9	7.7e-17
WP_004184543.1|2185941_2186181_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	73.1	2.9e-25
WP_012967856.1|2186188_2186497_-	hypothetical protein	NA	I6PD68	Cronobacter_phage	57.8	5.5e-24
WP_012967857.1|2186493_2187204_-	hypothetical protein	NA	Q71T76	Escherichia_phage	62.8	6.0e-74
WP_012967858.1|2187196_2187550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012967859.1|2187584_2188694_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	87.0	9.1e-186
WP_012967860.1|2188706_2191805_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	58.3	1.1e-294
WP_012967861.1|2191942_2192098_-	DNA breaking-rejoining protein	NA	H6WRX3	Salmonella_phage	75.0	1.2e-14
WP_012967862.1|2192106_2192301_-	YebW family protein	NA	NA	NA	NA	NA
WP_153591391.1|2192623_2192854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012967866.1|2193321_2193744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012967867.1|2193768_2194347_-	transcriptional regulator	NA	A0A0P0ZCT8	Stx2-converting_phage	64.4	1.1e-46
WP_012967868.1|2194349_2194634_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	71.3	4.9e-35
WP_012967869.1|2194719_2195103_-	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	80.0	2.3e-48
WP_012967870.1|2195200_2195431_+	helix-turn-helix domain-containing protein	NA	K7PKS2	Enterobacteria_phage	64.8	3.6e-20
WP_012967871.1|2195421_2195958_+	toxin YdaT domain-containing protein	NA	K7PJT7	Enterobacteria_phage	72.3	8.5e-65
WP_012967872.1|2196086_2196881_+	ParB/RepB/Spo0J family partition protein	NA	C7BGF1	Burkholderia_phage	51.7	1.3e-64
WP_012967873.1|2196946_2197786_+	hypothetical protein	NA	I6NW17	Burkholderia_virus	51.9	3.3e-23
WP_012967874.1|2197788_2198538_+	ATP-binding protein	NA	H6WRX8	Salmonella_phage	81.1	4.6e-117
WP_012967875.1|2198545_2198890_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	7.8e-11
WP_012967877.1|2199454_2199937_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	77.3	7.4e-68
WP_012967878.1|2199933_2200158_+	hypothetical protein	NA	S4TVX5	Salmonella_phage	50.0	6.4e-14
WP_012967880.1|2200767_2201106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012967881.1|2201102_2201702_+	DUF551 domain-containing protein	NA	A0A1V0E5M5	Salmonella_phage	59.2	4.2e-20
WP_012967882.1|2201705_2202098_+	hypothetical protein	NA	A0A088FQM9	Escherichia_phage	37.5	8.6e-06
WP_012967883.1|2202205_2202490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012967884.1|2202515_2203415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012967885.1|2203692_2204331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012967887.1|2205510_2206107_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	80.1	1.0e-90
WP_041165182.1|2206315_2206612_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	74.0	1.6e-36
WP_012967890.1|2206608_2207424_+	antitermination protein	NA	A0A286N2Q2	Klebsiella_phage	74.8	5.6e-108
WP_012967891.1|2207676_2208303_+	YagU family protein	NA	NA	NA	NA	NA
WP_004213330.1|2208881_2209277_+|holin	phage holin family protein	holin	G8C7V8	Escherichia_phage	73.1	1.5e-45
WP_012967892.1|2209263_2209545_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	72.0	3.8e-32
WP_012967893.1|2209544_2210171_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	76.8	1.2e-89
WP_012967894.1|2210178_2210355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012967895.1|2210376_2210559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012967896.1|2210644_2210938_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	73.2	4.0e-32
WP_141828104.1|2211346_2211466_-	small membrane protein	NA	NA	NA	NA	NA
WP_012967897.1|2212019_2212379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041165184.1|2213188_2213410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012967899.1|2213688_2213934_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	93.8	2.3e-33
WP_012967900.1|2214491_2215496_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	44.2	5.9e-35
WP_012967901.1|2215473_2216778_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	60.3	2.2e-146
WP_012967902.1|2216782_2218207_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	71.5	4.4e-193
WP_041165185.1|2218190_2219303_+	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	53.3	2.0e-108
WP_012967904.1|2219409_2220174_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	59.1	1.5e-75
WP_012967905.1|2220261_2221398_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.9	8.2e-158
WP_012967906.1|2221437_2221650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012967907.1|2221653_2222064_+	hypothetical protein	NA	A0A0H5AUF0	Pseudomonas_phage	37.5	3.3e-08
WP_004146199.1|2222065_2222362_+	hypothetical protein	NA	A0A1V0E8A3	Vibrio_phage	50.0	5.6e-10
WP_012967908.1|2222333_2222717_+	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	9.2e-21
WP_012967909.1|2222718_2223270_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	5.9e-29
2222753:2222768	attR	TCGCCGGGCTGGTGGC	NA	NA	NA	NA
WP_012967910.1|2223266_2223659_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_012967911.1|2223682_2224855_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	4.7e-23
WP_012967912.1|2224908_2225391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012967913.1|2225528_2225726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012967914.1|2225792_2226125_+	hypothetical protein	NA	M1PRT9	Cellulophaga_phage	66.0	2.2e-31
WP_012967915.1|2226244_2229871_+|tail	phage tail length tape measure family protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	38.2	1.5e-96
WP_012967916.1|2229870_2230344_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	66.4	2.9e-56
WP_012967917.1|2230330_2230813_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.6	1.4e-53
WP_012967918.1|2230822_2231203_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	79.4	2.7e-57
WP_012967919.1|2231202_2234289_+	kinase	NA	A0A286S259	Klebsiella_phage	49.3	7.1e-281
WP_012967920.1|2234366_2236256_+	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	51.8	3.6e-150
>prophage 4
NC_013850	Klebsiella variicola At-22, complete sequence	5458505	2840266	2846689	5458505		Escherichia_phage(100.0%)	7	NA	NA
WP_012968278.1|2840266_2841355_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	98.1	1.4e-207
WP_012968279.1|2841441_2841702_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	96.5	4.6e-40
WP_012968280.1|2841996_2842857_+	class A beta-lactamase LEN-13	NA	A0A077SL40	Escherichia_phage	90.2	3.9e-144
WP_012968281.1|2842874_2843636_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	98.8	3.6e-133
WP_012968282.1|2843896_2844799_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	98.3	5.5e-157
WP_012968283.1|2844810_2846076_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	97.4	7.6e-229
WP_012541792.1|2846068_2846689_+	aldolase	NA	A0A077SK32	Escherichia_phage	98.1	5.7e-113
>prophage 5
NC_013850	Klebsiella variicola At-22, complete sequence	5458505	3618687	3628135	5458505	tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_012968624.1|3618687_3620409_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.0	4.5e-14
WP_008805841.1|3620448_3621153_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3621504_3621723_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_012542332.1|3621841_3624121_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	3.7e-165
WP_002896520.1|3624151_3624469_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3624794_3625016_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_008805839.1|3625082_3627023_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.0	2.9e-38
WP_008805838.1|3627019_3628135_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
