The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_013757	Geodermatophilus obscurus DSM 43160, complete sequence	5322497	657038	664275	5322497	protease	Pandoravirus(33.33%)	8	NA	NA
WP_012946836.1|657038_657626_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	26.8	6.6e-10
WP_012946837.1|657999_659988_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	H8ZJI5	Ostreococcus_tauri_virus	46.1	3.2e-109
WP_041241814.1|660070_660682_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	55.9	3.7e-48
WP_049788524.1|660720_661539_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	35.1	6.1e-22
WP_012946840.1|661531_661918_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_012946841.1|661991_662498_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4VNV0	Pandoravirus	37.5	3.6e-12
WP_012946842.1|662571_663078_+	DUF3180 domain-containing protein	NA	NA	NA	NA	NA
WP_166487544.1|663117_664275_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.1	3.9e-22
>prophage 2
NC_013757	Geodermatophilus obscurus DSM 43160, complete sequence	5322497	2047235	2109079	5322497	transposase,protease	Mycobacterium_phage(33.33%)	51	NA	NA
WP_081448999.1|2047235_2047790_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_012948106.1|2047805_2048264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012948107.1|2048260_2048509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012948108.1|2048965_2050477_+	recombinase family protein	NA	A0A0C5AAI5	Mycobacterium_phage	42.2	1.3e-89
WP_012948109.1|2050751_2050940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012948110.1|2050936_2051104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166487344.1|2051271_2051469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012948112.1|2051465_2053622_+	DUF3987 domain-containing protein	NA	A0A142K988	Gordonia_phage	40.2	7.2e-38
WP_012948114.1|2054002_2054272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012948115.1|2054846_2055287_+	hypothetical protein	NA	A0A0A7RXQ7	Mycobacterium_phage	36.8	4.8e-13
WP_012948116.1|2055767_2056178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012948117.1|2056164_2056359_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041242098.1|2056520_2056889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012948119.1|2057158_2058328_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_012948120.1|2058324_2059005_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_166487345.1|2061773_2062943_-	MFS transporter	NA	NA	NA	NA	NA
WP_166487622.1|2063275_2063566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012948123.1|2063562_2064342_+	DUF4386 domain-containing protein	NA	NA	NA	NA	NA
WP_081448852.1|2064387_2065335_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.0	4.2e-30
WP_012948124.1|2065416_2066310_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_012948126.1|2067367_2068120_-	DUF4386 domain-containing protein	NA	NA	NA	NA	NA
WP_012948127.1|2068279_2070916_+	winged helix family transcriptional regulator	NA	NA	NA	NA	NA
WP_166487346.1|2070846_2071623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012948128.1|2071604_2075030_-	winged helix family transcriptional regulator	NA	NA	NA	NA	NA
WP_049788562.1|2075203_2076196_+	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_012948130.1|2076234_2076930_+	DUF4386 domain-containing protein	NA	NA	NA	NA	NA
WP_166487347.1|2077041_2077971_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012948132.1|2078281_2078743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166487348.1|2079864_2080323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012948135.1|2080419_2080923_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012948136.1|2081041_2081416_+	DoxX family protein	NA	NA	NA	NA	NA
WP_012948137.1|2083130_2083430_+	DUF2218 domain-containing protein	NA	NA	NA	NA	NA
WP_012948138.1|2083524_2083905_+	VOC family protein	NA	NA	NA	NA	NA
WP_012948140.1|2085835_2086738_+	dioxygenase	NA	NA	NA	NA	NA
WP_012948141.1|2086779_2087637_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012948142.1|2087729_2088893_+	histidine kinase	NA	NA	NA	NA	NA
WP_012948143.1|2088889_2089588_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_049788564.1|2089718_2090663_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.3	7.1e-30
WP_012948145.1|2090659_2091592_+	integral membrane protein	NA	NA	NA	NA	NA
WP_012948146.1|2091892_2092327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049788210.1|2092426_2093371_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_012948149.1|2094883_2095117_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012948151.1|2099187_2099814_-	aldolase	NA	A0A077SK32	Escherichia_phage	47.5	2.8e-43
WP_166487593.1|2099833_2100688_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041241376.1|2100904_2101888_+	2-keto-3-deoxygluconate permease	NA	NA	NA	NA	NA
WP_012947618.1|2101927_2103190_+	ribulose-bisphosphate carboxylase	NA	NA	NA	NA	NA
WP_012948152.1|2103189_2104476_+	four-carbon acid sugar kinase family protein	NA	NA	NA	NA	NA
WP_012948153.1|2104515_2105565_+	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_049788212.1|2106164_2106908_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_166487349.1|2106813_2107236_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_012948155.1|2108047_2109079_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_013757	Geodermatophilus obscurus DSM 43160, complete sequence	5322497	2639596	2745861	5322497	transposase,integrase	Mycobacterium_phage(18.18%)	81	2643792:2643811	2750038:2750055
WP_041241466.1|2639596_2639989_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2R2ZGM9	Clostridioides_phage	50.7	6.8e-11
WP_012948636.1|2640276_2641458_-	serine hydrolase	NA	I3WV21	Mycobacterium_phage	30.9	5.9e-34
WP_166487371.1|2641546_2642602_-	beta-lactamase family protein	NA	A0A088FA76	Mycobacterium_phage	32.9	2.4e-34
WP_166487372.1|2642600_2642759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166487656.1|2642879_2644334_-	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
2643792:2643811	attL	CCCGGCCGCCGTCACGGTGA	NA	NA	NA	NA
WP_166487373.1|2644644_2646384_+	sensor histidine kinase	NA	NA	NA	NA	NA
2643792:2643811	attL	CCCGGCCGCCGTCACGGTGA	NA	NA	NA	NA
WP_012948640.1|2646371_2647019_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_166487374.1|2648392_2648689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012948643.1|2648834_2649134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012948644.1|2649130_2649898_-	ParA family protein	NA	NA	NA	NA	NA
WP_012948645.1|2650137_2652021_+	DUF4407 domain-containing protein	NA	NA	NA	NA	NA
WP_081448873.1|2652489_2652786_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	40.2	6.9e-08
WP_012948646.1|2653311_2655456_+	DEAD/DEAH box helicase	NA	A0A0U4JJX1	Arthrobacter_phage	32.0	5.1e-44
WP_012948648.1|2656063_2658010_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_166487657.1|2658408_2659386_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_012948651.1|2659929_2661030_+	AmmeMemoRadiSam system radical SAM enzyme	NA	NA	NA	NA	NA
WP_012948652.1|2661033_2661840_+	AmmeMemoRadiSam system protein B	NA	NA	NA	NA	NA
WP_012948653.1|2662283_2662541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012948654.1|2662614_2664261_-	MFS transporter	NA	NA	NA	NA	NA
WP_012948656.1|2665881_2666052_-	CsbD family protein	NA	NA	NA	NA	NA
WP_012948657.1|2666329_2666599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012948658.1|2667722_2668082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012948659.1|2668302_2669568_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_012948660.1|2670366_2670825_-	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_041241468.1|2671165_2671426_-	DUF2252 family protein	NA	NA	NA	NA	NA
WP_012948661.1|2671836_2672166_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_041241469.1|2672162_2672399_-	type II toxin-antitoxin system VapB family antitoxin	NA	NA	NA	NA	NA
WP_085949923.1|2673282_2674239_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_166487375.1|2674457_2677427_-	AfsR/SARP family transcriptional regulator	NA	NA	NA	NA	NA
WP_012948664.1|2677518_2678217_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_012948665.1|2678213_2679254_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_166487376.1|2679250_2679691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012948666.1|2679818_2679959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012948667.1|2680318_2681437_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012948668.1|2681580_2682864_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012948669.1|2682993_2683308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085949926.1|2683394_2684281_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012948670.1|2686697_2687633_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012948671.1|2687915_2689355_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012948672.1|2689351_2689633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166487377.1|2689783_2689975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049788257.1|2689968_2691015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012948673.1|2691364_2691922_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_166487378.1|2692082_2692256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012948674.1|2692386_2692713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012948675.1|2693390_2693792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012948676.1|2693788_2694103_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_085949965.1|2694563_2695741_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	36.8	2.1e-23
WP_012948679.1|2695839_2696772_-	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_012948680.1|2699350_2700376_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_041242231.1|2700387_2701572_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012948682.1|2701668_2702492_-|transposase	IS5-like element ISGeob5 family transposase	transposase	NA	NA	NA	NA
WP_041241356.1|2702618_2703593_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012948683.1|2703723_2704528_+|transposase	IS5-like element ISGeob7 family transposase	transposase	NA	NA	NA	NA
WP_012948684.1|2705620_2706673_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	34.7	2.9e-48
WP_012948685.1|2706834_2711679_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_012948686.1|2712515_2713010_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	36.3	4.2e-18
WP_081448875.1|2713752_2714472_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
2714189:2714208	attR	TCACCGTGACGGCGGCCGGG	NA	NA	NA	NA
WP_081448876.1|2715104_2715509_-|integrase	tyrosine-type recombinase/integrase	integrase	G9FH48	Rhodococcus_phage	47.5	9.7e-21
2714189:2714208	attR	TCACCGTGACGGCGGCCGGG	NA	NA	NA	NA
WP_012948688.1|2716318_2716579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041241479.1|2716646_2716832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012948691.1|2719536_2720031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012948692.1|2720236_2720470_-	dodecin domain-containing protein	NA	NA	NA	NA	NA
WP_081448878.1|2720613_2721042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012948693.1|2721038_2721422_+	nitrile hydratase accessory protein	NA	NA	NA	NA	NA
WP_012948694.1|2721816_2723217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041241480.1|2723477_2723663_+	Lsr2 family protein	NA	NA	NA	NA	NA
WP_049788264.1|2723639_2724395_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_166487658.1|2724651_2725836_+	CapA family protein	NA	NA	NA	NA	NA
WP_166487379.1|2726839_2726986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166487380.1|2727945_2728191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012948697.1|2728396_2729152_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012948698.1|2729158_2729929_+	acetoacetate decarboxylase	NA	NA	NA	NA	NA
WP_166487659.1|2733058_2734663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012948701.1|2734844_2735162_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012948702.1|2735178_2736084_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_012948703.1|2737828_2739268_+	family 14 glycosylhydrolase	NA	NA	NA	NA	NA
WP_012948704.1|2740309_2742442_+	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	32.6	8.8e-28
WP_012946610.1|2743183_2744416_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	56.0	1.1e-112
WP_012948705.1|2744504_2744972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012948706.1|2744976_2745861_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2750038:2750055	attR	CGGCCGCACCGGCCGACC	NA	NA	NA	NA
>prophage 4
NC_013757	Geodermatophilus obscurus DSM 43160, complete sequence	5322497	3043617	3116080	5322497	transposase,integrase	uncultured_Caudovirales_phage(20.0%)	58	3088605:3088651	3115032:3115078
WP_012948966.1|3043617_3044427_-|transposase	IS5-like element ISGeob3 family transposase	transposase	NA	NA	NA	NA
WP_012948968.1|3045154_3046168_+	TerC/Alx family metal homeostasis membrane protein	NA	K4F9T9	Cronobacter_phage	38.7	4.3e-41
WP_166487399.1|3046801_3048256_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.6	1.8e-48
WP_012948970.1|3048290_3049931_-	exporter of polyketide antibiotics-like protein	NA	NA	NA	NA	NA
WP_012948971.1|3049927_3050842_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	3.9e-17
WP_166487400.1|3051803_3053126_-	cytochrome P450	NA	NA	NA	NA	NA
WP_012948973.1|3053554_3053734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166487401.1|3055161_3055818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085949966.1|3056052_3058872_+	DUF4040 domain-containing protein	NA	NA	NA	NA	NA
WP_012948977.1|3058868_3059210_+	NADH-ubiquinone oxidoreductase subunit 4L	NA	NA	NA	NA	NA
WP_012948978.1|3059206_3060766_+	monovalent cation/H+ antiporter subunit D family protein	NA	NA	NA	NA	NA
WP_012948979.1|3060762_3061182_+	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_012948980.1|3061178_3061439_+	pesticidal protein Cry26Aa	NA	NA	NA	NA	NA
WP_012948981.1|3061435_3061795_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_012948982.1|3061829_3063185_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	35.4	2.6e-62
WP_012948983.1|3063181_3065035_-	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_012948984.1|3065043_3065316_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_012948985.1|3065500_3066139_-	universal stress protein	NA	NA	NA	NA	NA
WP_012948986.1|3066239_3066524_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_012948987.1|3066599_3067043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012948988.1|3067140_3068358_-	transcriptional regulator CdaR	NA	NA	NA	NA	NA
WP_012948989.1|3068378_3069038_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_041242309.1|3069034_3070000_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_166487402.1|3070498_3071119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012948992.1|3071388_3072012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166487403.1|3072553_3073594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166487404.1|3073675_3074167_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_012948994.1|3074449_3076057_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_166487405.1|3076959_3077124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012948995.1|3077856_3079266_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_012948996.1|3079262_3080288_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_012948997.1|3080741_3080966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012948998.1|3081701_3084407_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_166487406.1|3084892_3085042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012948999.1|3085020_3085164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012949001.1|3086516_3087773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166487407.1|3088286_3088457_-	hypothetical protein	NA	NA	NA	NA	NA
3088605:3088651	attL	CACTGTCGGGCTGACAGGATTTGAACCTGCGACCCCTTGACCCCCAG	NA	NA	NA	NA
WP_012949003.1|3089596_3089998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012949004.1|3090176_3091268_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	34.4	6.7e-16
WP_012949005.1|3091320_3092766_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	43.3	1.4e-69
WP_012949006.1|3092922_3094545_-	anion transporter	NA	NA	NA	NA	NA
WP_012949007.1|3095288_3097007_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_081449014.1|3097071_3099108_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.7	5.4e-43
WP_012949009.1|3099151_3100483_-	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_012949010.1|3100514_3103199_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_166487408.1|3103300_3103522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081449015.1|3104156_3104990_+	response regulator	NA	NA	NA	NA	NA
WP_012949012.1|3105042_3105186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012949013.1|3105365_3106592_-	MFS transporter	NA	NA	NA	NA	NA
WP_166487409.1|3107253_3107628_+|integrase	site-specific integrase	integrase	A0A2I7SC08	Paenibacillus_phage	33.0	4.3e-07
WP_012949014.1|3108127_3108463_-	Lsr2 family protein	NA	A0A160DEV0	Gordonia_phage	36.6	1.2e-11
WP_166487410.1|3108848_3109076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041241516.1|3110522_3111332_+|transposase	IS5-like element ISGeob2 family transposase	transposase	NA	NA	NA	NA
WP_012949017.1|3112006_3112432_-	cyclase	NA	NA	NA	NA	NA
WP_081449016.1|3112849_3113071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081449017.1|3113408_3113678_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012949019.1|3113793_3114927_+|integrase	site-specific integrase	integrase	A0A023ZX87	Mycobacterium_phage	46.4	3.1e-72
WP_012947386.1|3115192_3116080_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
3115032:3115078	attR	CACTGTCGGGCTGACAGGATTTGAACCTGCGACCCCTTGACCCCCAG	NA	NA	NA	NA
>prophage 5
NC_013757	Geodermatophilus obscurus DSM 43160, complete sequence	5322497	3653889	3716905	5322497	transposase,integrase	Mycobacterium_phage(28.57%)	53	3654062:3654092	3713952:3713982
WP_012948683.1|3653889_3654695_-|transposase	IS5-like element ISGeob7 family transposase	transposase	NA	NA	NA	NA
3654062:3654092	attL	ACGCCGCGGCGGGCGATCCGCGGAGTGATGC	NA	NA	NA	NA
WP_012949499.1|3655908_3658965_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012949500.1|3659444_3659648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081448914.1|3659877_3660066_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012949501.1|3660128_3661394_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_012949502.1|3661624_3661777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166487432.1|3661945_3662182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166487433.1|3662730_3663204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166487434.1|3663262_3663730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012949505.1|3664386_3664860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166487435.1|3664887_3665187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166487436.1|3666285_3667188_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_012949507.1|3667189_3669571_+	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_012949509.1|3670683_3671373_-	TIGR02391 family protein	NA	NA	NA	NA	NA
WP_166487437.1|3671861_3672353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166487438.1|3672342_3673056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012949511.1|3673211_3673535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041241549.1|3673764_3676098_+	hypothetical protein	NA	A0A1J0MDN5	Mycobacterium_phage	40.7	2.3e-58
WP_012949514.1|3676260_3676485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166487439.1|3677040_3677205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041241550.1|3677201_3677396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012949516.1|3677392_3678223_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_166487440.1|3679055_3680117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012949518.1|3680151_3681810_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_012949519.1|3682246_3683128_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041241552.1|3683311_3684178_+	SDR family NAD(P)-dependent oxidoreductase	NA	A0A2P0VP75	Tetraselmis_virus	25.2	8.5e-06
WP_041241553.1|3684497_3684695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012949522.1|3685020_3685950_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012949523.1|3686162_3686624_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_012949524.1|3686677_3687103_-	DUF3052 domain-containing protein	NA	NA	NA	NA	NA
WP_012949525.1|3687459_3690273_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_166487708.1|3690287_3691283_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_012949527.1|3691292_3692498_-	amidohydrolase	NA	NA	NA	NA	NA
WP_166487709.1|3692619_3693159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012949529.1|3693161_3693839_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_166487710.1|3693980_3695063_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012949531.1|3695346_3696549_+	acyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_012949532.1|3696545_3697514_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_012949533.1|3697590_3697830_+	acyl carrier protein	NA	E3SMK8	Prochlorococcus_phage	45.0	2.0e-05
WP_012949534.1|3697979_3699221_+	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_085949973.1|3699446_3700769_+	propionyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
WP_012949536.1|3701008_3701509_-	DUF3145 domain-containing protein	NA	NA	NA	NA	NA
WP_085949974.1|3701882_3702701_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	31.2	1.1e-07
WP_012949538.1|3703116_3704028_+	maleylpyruvate isomerase family mycothiol-dependent enzyme	NA	NA	NA	NA	NA
WP_166487711.1|3704110_3705304_-	M23 family metallopeptidase	NA	A0A1W6JQH9	Corynebacterium_phage	48.4	1.5e-21
WP_012949540.1|3705959_3707057_+	phosphate ABC transporter substrate-binding protein PstS	NA	NA	NA	NA	NA
WP_012949541.1|3707244_3708342_-|integrase	site-specific integrase	integrase	A0A0E3XBN7	Gordonia_phage	39.7	9.6e-55
WP_012949542.1|3708426_3708639_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012949544.1|3710709_3711537_-	DMT family transporter	NA	NA	NA	NA	NA
WP_012949545.1|3711817_3712843_+	AAA family ATPase	NA	V5UQM2	Mycobacterium_phage	38.3	2.1e-48
WP_085949937.1|3712955_3713760_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012948680.1|3714683_3715709_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
3713952:3713982	attR	ACGCCGCGGCGGGCGATCCGCGGAGTGATGC	NA	NA	NA	NA
WP_041242231.1|3715720_3716905_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
