The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_013941	Escherichia coli O55:H7 str. CB9615, complete sequence	5386352	199837	276260	5386352	tRNA,protease,plate,transposase	uncultured_Caudovirales_phage(20.0%)	57	NA	NA
WP_001295561.1|199837_201190_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|201219_203652_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|203773_204259_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139282.1|204262_205288_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|205392_205848_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|205851_206640_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139681.1|206639_207788_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569419.1|207784_208381_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	3.9e-26
WP_001294782.1|208417_211900_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|211912_212872_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020954.1|212970_215112_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|215168_215558_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176547.1|215622_216918_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|216970_217231_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|217217_217418_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185305.1|217583_218129_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|218125_218548_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239181.1|218561_219272_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001359023.1|219471_220296_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260720.1|220348_222067_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094000.1|222177_222885_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202328.1|222881_223286_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874227.1|223403_224219_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294606.1|224258_224912_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000594002.1|224904_225936_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
WP_001140190.1|226123_226699_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997018.1|232455_233259_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_000648586.1|233255_234170_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|234410_235211_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211697.1|235288_236059_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644686.1|236106_237465_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|237536_238292_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001307587.1|238325_239048_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|239044_239512_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301976.1|239576_240308_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_001086136.1|240844_241645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302684.1|242122_242572_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000002702.1|242574_243471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284959.1|243491_243971_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087743.1|243936_245346_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_001303798.1|245356_248791_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240517.1|248899_250312_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088854.1|250316_251060_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614385.1|251056_253840_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.5	7.3e-83
WP_000343294.1|253848_254610_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246448.1|254614_255946_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080153.1|255948_256473_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000348794.1|257773_258856_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|258819_260670_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|260673_261087_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000123970.1|262619_262844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037397.1|262878_263379_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|264075_264594_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103342.1|264803_266945_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
WP_000509136.1|267020_271253_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_001419315.1|273868_274378_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000420853.1|275123_276260_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_013941	Escherichia coli O55:H7 str. CB9615, complete sequence	5386352	298717	352976	5386352	integrase,head,protease,portal,capsid,tail,holin,lysis,terminase	Enterobacteria_phage(40.62%)	68	314137:314150	355227:355240
WP_000749881.1|298717_299773_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|300060_301164_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893281.1|301175_302429_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	4.4e-96
WP_000023577.1|302633_303794_-|integrase	site-specific integrase	integrase	K7P7R5	Enterobacteria_phage	99.5	7.2e-226
WP_001281200.1|304107_304452_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	99.1	5.9e-59
WP_000103020.1|304552_305317_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	53.5	4.5e-51
WP_001289865.1|305313_305820_-	ead/Ea22-like family protein	NA	K7P6T4	Enterobacteria_phage	86.7	3.1e-56
WP_000763359.1|305816_306038_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	94.5	4.6e-33
WP_000188870.1|306136_306352_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000548536.1|306428_306620_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000149546.1|306592_306775_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	95.0	9.1e-27
WP_000186844.1|306771_307452_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_001418384.1|307448_308234_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.8e-148
WP_000995449.1|308239_308536_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000372937.1|308609_308753_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|308721_308886_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000213973.1|309109_309310_-	antirestriction Ral family protein	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	9.3e-33
WP_000281856.1|309576_310059_+	superinfection exclusion B family protein	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_000340011.1|310059_310383_-	antitermination protein	NA	A4KWR8	Enterobacteria_phage	99.1	1.0e-52
WP_000618044.1|310734_311139_-	hypothetical protein	NA	A0A088CQ79	Enterobacteria_phage	98.5	5.6e-69
WP_000028392.1|311135_311768_-	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
WP_001194218.1|311871_312087_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000251069.1|312206_312500_+	lambda phage CII family protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000185433.1|312532_313432_+	replication protein	NA	K7P7F0	Enterobacteria_phage	99.7	2.5e-173
WP_000788868.1|313428_314130_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.1	2.9e-129
WP_000145894.1|314126_314417_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	97.9	3.1e-45
314137:314150	attL	AAGAAGCAATTATT	NA	NA	NA	NA
WP_000736913.1|314490_314931_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000153282.1|314927_315455_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	2.8e-100
WP_001254239.1|315451_315634_+	NinE family protein	NA	A0A0P0ZDL7	Stx2-converting_phage	100.0	1.9e-29
WP_000566862.1|315630_315801_+	protein ninF	NA	K7PMD9	Enterobacterial_phage	96.4	9.3e-26
WP_001107957.1|315793_316399_+	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	98.0	8.1e-96
WP_001028867.1|316395_317067_+	serine/threonine protein phosphatase	NA	H6WZJ4	Escherichia_phage	95.0	1.1e-125
WP_000512794.1|317057_317576_+	DUF1133 family protein	NA	Q716B8	Shigella_phage	97.1	6.5e-94
WP_001419325.1|318077_318209_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000026511.1|318505_320347_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	77.9	3.6e-288
WP_024164617.1|320784_321000_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000075122.1|320999_321497_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	1.3e-91
WP_072020783.1|321713_321896_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	1.4e-14
WP_001302690.1|322422_322737_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_013009113.1|322817_323042_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_000235440.1|323443_323953_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	7.2e-13
WP_024201835.1|323924_325853_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	1.2e-262
WP_000258995.1|325836_326043_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	56.9	4.6e-11
WP_000831800.1|326039_327632_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.6	2.9e-185
WP_001253897.1|327621_329127_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	6.1e-100
WP_000256840.1|329163_329511_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522651.1|329568_330597_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.7e-115
WP_000201530.1|330648_331023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204539.1|331015_331369_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	68.4	7.4e-41
WP_000155463.1|331380_331914_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	71.4	2.0e-61
WP_000683050.1|331910_332306_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	96.2	7.2e-69
WP_024201836.1|332313_333054_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	95.9	4.4e-128
WP_000479164.1|333069_333492_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.1e-70
WP_000459458.1|333473_333908_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_000840217.1|333900_336450_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	88.0	0.0e+00
WP_000847332.1|336446_336776_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	99.1	5.6e-59
WP_001152620.1|336775_337474_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.4e-131
WP_013009116.1|337479_338223_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	4.3e-147
WP_071813424.1|338159_338792_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	3.2e-95
WP_000515634.1|338852_342266_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.4	0.0e+00
WP_001233141.1|342336_342936_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000741872.1|342995_344312_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	94.5	3.5e-67
WP_001024023.1|344313_344583_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	97.8	8.4e-45
WP_001117986.1|344694_345267_+	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	52.7	1.6e-45
WP_001144082.1|346006_346633_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.7e-25
WP_001132163.1|346815_347406_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_000950786.1|348405_349386_+	NleB family type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	50.5	5.9e-88
WP_001130496.1|351794_352976_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.6	1.1e-144
355227:355240	attR	AAGAAGCAATTATT	NA	NA	NA	NA
>prophage 3
NC_013941	Escherichia coli O55:H7 str. CB9615, complete sequence	5386352	687060	755159	5386352	tRNA,integrase,transposase,head,protease,portal,capsid,tail,lysis,terminase	Enterobacteria_phage(53.57%)	79	697221:697267	746636:746682
WP_000912351.1|687060_688446_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143558.1|688481_689003_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|689110_689323_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|689324_690191_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|690670_691213_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988382.1|691432_692125_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001419152.1|692155_694765_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691070.1|694777_695785_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255114.1|695795_696311_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_001359679.1|696313_696946_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
697221:697267	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_000051902.1|697280_698444_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000488399.1|698642_698921_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.7	2.1e-46
WP_000763385.1|698968_699187_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_001443983.1|699285_699567_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_013009139.1|699577_699769_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	8.0e-26
WP_000149544.1|699741_699924_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000611720.1|699920_700601_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	6.7e-131
WP_000100847.1|700597_701383_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|701388_701685_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000233576.1|701760_701967_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000866321.1|702447_702825_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000380250.1|702802_703864_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	41.7	1.9e-63
WP_000858974.1|703944_704634_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067457.1|704738_704969_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	69.3	3.8e-22
WP_001182899.1|705038_705578_+	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_000147876.1|705574_706594_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.4	4.0e-111
WP_000788810.1|706590_707292_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	1.4e-128
WP_000145915.1|707288_707591_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070451.1|707658_707991_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_032102575.1|708082_708190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|708247_709774_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001302427.1|710238_710790_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881074.1|710799_711597_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|711713_711815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054343.1|711811_712267_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.8e-60
WP_000224916.1|712266_712437_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_000774488.1|712429_712720_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_001099712.1|712716_713079_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|713075_713216_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204780.1|713301_713685_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000737275.1|713873_714956_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	76.3	8.9e-154
WP_000839596.1|715545_715761_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135277.1|715760_716258_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001228695.1|716474_716657_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738421.1|716747_717041_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001307652.1|717402_717597_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000453618.1|717985_718531_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	6.8e-94
WP_001027276.1|718505_720431_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198149.1|720427_720634_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001676384.1|720630_722232_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	3.8e-310
WP_000123270.1|722212_723532_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	2.6e-232
WP_001338090.1|723541_723874_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	6.5e-55
WP_000063237.1|723929_724955_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	6.6e-191
WP_000158927.1|724996_725392_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	1.6e-55
WP_000752967.1|725403_725757_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	8.4e-61
WP_000975093.1|725768_726347_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	2.3e-79
WP_000683117.1|726343_726739_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	6.5e-70
WP_024201838.1|726746_727487_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	8.9e-129
WP_000479189.1|727502_727925_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	86.4	1.3e-60
WP_000459456.1|727906_728341_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840280.1|728333_730913_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	92.9	0.0e+00
WP_000847379.1|730909_731239_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152569.1|731238_731937_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	1.3e-129
WP_000140754.1|731942_732686_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	2.7e-149
WP_000090854.1|732622_733225_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.1	1.2e-88
WP_000515282.1|733285_736699_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.2	0.0e+00
WP_001230375.1|736768_737368_+	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	5.7e-110
WP_064032193.1|737432_740261_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	92.3	3.2e-54
WP_000885575.1|740260_740845_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	2.1e-101
WP_000239876.1|740899_741568_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001226375.1|742113_743598_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201842.1|743784_744738_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000361110.1|745236_745821_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001298108.1|745845_746283_-	acetyltransferase	NA	NA	NA	NA	NA
WP_001177464.1|746725_747487_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
746636:746682	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224578.1|747669_748560_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001301880.1|748560_751533_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383932.1|751519_753757_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420897.1|754022_755159_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_013941	Escherichia coli O55:H7 str. CB9615, complete sequence	5386352	980788	1026322	5386352	integrase,protease,portal,tail,holin,lysis,terminase	Enterobacteria_phage(44.44%)	63	971318:971332	985756:985770
971318:971332	attL	CAATATCAACCTGAT	NA	NA	NA	NA
WP_000533643.1|980788_981859_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
WP_001303849.1|981836_982055_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|982094_982262_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000120060.1|982504_983107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763358.1|983317_983539_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	95.9	1.6e-33
WP_000188870.1|983637_983853_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000548536.1|983929_984121_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|984093_984276_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|984272_984953_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000995449.1|985741_986038_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
985756:985770	attR	CAATATCAACCTGAT	NA	NA	NA	NA
WP_000372937.1|986111_986255_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|986223_986388_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065351.1|986460_986829_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	4.5e-65
WP_000392419.1|987024_987474_-	hypothetical protein	NA	I6RSN8	Salmonella_phage	87.9	3.3e-70
WP_000088205.1|987758_988031_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.2e-40
WP_000478871.1|988463_988748_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_000854876.1|988759_989056_-	DUF1902 domain-containing protein	NA	NA	NA	NA	NA
WP_096246228.1|989228_989924_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	99.1	4.3e-133
WP_000067727.1|989998_990214_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000438491.1|990355_990655_+	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	96.0	2.0e-47
WP_000185506.1|990687_991587_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	99.7	5.5e-173
WP_000788868.1|991583_992285_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.1	2.9e-129
WP_000145894.1|992281_992572_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	97.9	3.1e-45
WP_000736913.1|992645_993086_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_001254218.1|993082_993265_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567000.1|993261_993432_+	protein ninF	NA	Q716C4	Shigella_phage	98.2	4.6e-25
WP_001108059.1|993424_994045_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.6	4.1e-95
WP_001028854.1|994041_994707_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_000750160.1|994918_995878_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|996215_996338_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|996352_997042_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|997227_997971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|998056_998215_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_012578864.1|998295_998694_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|998836_999052_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075144.1|999051_999549_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	1.9e-90
WP_000092264.1|999545_1000013_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	98.1	2.5e-76
WP_001139679.1|1000000_1000153_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000349509.1|1000827_1001319_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_000934091.1|1001318_1003421_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.6	0.0e+00
WP_001072975.1|1003417_1003630_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985949.1|1003629_1005138_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.6	4.5e-289
WP_001097050.1|1007196_1007520_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|1007512_1007788_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677100.1|1007799_1008378_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	9.4e-102
WP_001079422.1|1008374_1008776_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000211123.1|1008786_1009530_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001300035.1|1009590_1009977_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_001161009.1|1009985_1010315_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000371992.1|1010286_1013352_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.0	0.0e+00
WP_000447257.1|1013351_1013681_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	1.5e-59
WP_001152339.1|1013690_1014389_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_001419734.1|1014394_1015138_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	4.5e-149
WP_000090845.1|1015074_1015683_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	1.1e-100
WP_000515307.1|1015743_1019157_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.7	0.0e+00
WP_001230272.1|1019226_1019826_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	95.5	7.7e-107
WP_000279047.1|1019890_1021204_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.7	2.4e-76
WP_001101707.1|1021205_1021475_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	97.8	9.3e-44
WP_000950813.1|1021651_1022632_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_115801843.1|1022665_1023685_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_072127173.1|1024181_1024343_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_000951026.1|1024511_1025393_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_001247931.1|1025623_1026322_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
>prophage 5
NC_013941	Escherichia coli O55:H7 str. CB9615, complete sequence	5386352	1574629	1643169	5386352	integrase,transposase,head,protease,capsid,tail,holin,terminase	Stx2-converting_phage(32.65%)	74	1567520:1567533	1584309:1584322
1567520:1567533	attL	TGGTATGCAGTAAC	NA	NA	NA	NA
WP_000113678.1|1574629_1575913_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.1	4.2e-102
WP_000113189.1|1575890_1576139_-	excisionase	NA	NA	NA	NA	NA
WP_000048548.1|1576203_1578654_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.4	3.5e-57
WP_001090200.1|1578746_1578938_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1578934_1579123_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000920491.1|1579681_1579915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|1579892_1580300_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|1580322_1580541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|1580613_1580913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|1581177_1581585_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|1581661_1581889_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705622.1|1581872_1582424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|1582395_1583436_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|1583347_1583890_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000450692.1|1583923_1584658_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.7	7.7e-109
1584309:1584322	attR	GTTACTGCATACCA	NA	NA	NA	NA
WP_001505071.1|1584654_1584819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|1585517_1586276_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|1586554_1586767_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_000975564.1|1586985_1587246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|1587315_1587594_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001265289.1|1587595_1588651_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
WP_000140002.1|1588651_1589017_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001059384.1|1589013_1589703_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_000023144.1|1591221_1593072_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_024164617.1|1593510_1593726_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000075132.1|1593725_1594223_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_001208681.1|1594439_1594625_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_001303878.1|1595151_1595466_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000074669.1|1595547_1595772_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001359494.1|1595813_1596344_+	HNH endonuclease	NA	H6WZK7	Escherichia_phage	92.6	2.6e-90
WP_001419048.1|1596459_1597023_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.1	9.2e-86
WP_001417827.1|1597019_1598681_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_000173096.1|1598744_1598864_+	hypothetical protein	NA	A0A0P0ZAJ3	Stx2-converting_phage	89.7	1.6e-11
WP_085959019.1|1598884_1600097_+|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	7.5e-101
WP_143714088.1|1600113_1601943_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	98.2	0.0e+00
WP_001063105.1|1601987_1602209_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	93.2	4.6e-33
WP_000125996.1|1604735_1605062_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	99.1	1.6e-53
WP_001007889.1|1605072_1605423_+|head	phage head closure protein	head	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
WP_000573390.1|1605419_1605866_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	5.2e-76
WP_000141141.1|1605862_1606207_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	98.2	3.6e-56
WP_001275473.1|1606273_1606990_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	3.3e-128
WP_001030057.1|1606995_1607370_+|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001453698.1|1607465_1607675_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212946.1|1607726_1610993_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	78.7	0.0e+00
WP_000807954.1|1610985_1611327_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001419047.1|1611326_1612025_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	96.6	1.3e-129
WP_014640511.1|1612035_1612779_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	3.8e-148
WP_064761467.1|1612724_1613354_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.6	1.2e-102
WP_000514949.1|1613594_1617071_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	98.4	0.0e+00
WP_085959019.1|1617152_1618366_-|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	7.5e-101
WP_029783341.1|1618384_1619023_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.7	5.2e-69
WP_000279047.1|1619087_1620401_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.7	2.4e-76
WP_001023357.1|1620402_1620672_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	100.0	3.8e-45
WP_000767050.1|1620892_1621435_+	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	8.4e-52
WP_106423857.1|1621379_1621574_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	87.2	1.1e-09
WP_106409364.1|1623583_1623706_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|1623812_1624724_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|1624789_1625359_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_001079491.1|1627818_1628325_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|1628370_1628871_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1628956_1629136_-	general stress protein	NA	NA	NA	NA	NA
WP_000443044.1|1629516_1630323_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|1630322_1631516_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983857.1|1631527_1632889_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000763520.1|1632889_1634485_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194629.1|1634484_1636047_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1636138_1636183_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|1636320_1637202_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1637198_1637819_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001419072.1|1637846_1639430_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|1639642_1640515_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278896.1|1640554_1641145_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|1641141_1641900_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|1642119_1643169_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 6
NC_013941	Escherichia coli O55:H7 str. CB9615, complete sequence	5386352	1726810	1778957	5386352	tRNA,integrase,protease,portal,tail,holin,terminase	Escherichia_phage(39.34%)	65	1727635:1727650	1781231:1781246
WP_000628061.1|1726810_1728043_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
1727635:1727650	attL	TCAGAAAAAAGCGCGC	NA	NA	NA	NA
WP_000387388.1|1728297_1729281_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001625136.1|1729555_1729726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123746.1|1729758_1731132_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000662472.1|1731260_1732196_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	1.7e-145
WP_000040839.1|1732247_1733483_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_000079604.1|1733484_1733700_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|1733799_1733988_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_001443846.1|1734025_1734175_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_000166313.1|1734230_1735040_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_000102213.1|1735032_1737705_-	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	96.1	6.2e-172
WP_001452559.1|1737804_1738080_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	92.3	3.7e-40
WP_000245528.1|1738154_1738331_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	93.1	9.7e-26
WP_000560227.1|1738324_1738546_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	95.9	1.2e-36
WP_000379547.1|1738954_1739107_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948458.1|1739424_1739901_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712068.1|1740024_1740282_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.4e-10
WP_000693796.1|1740343_1740766_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.7e-68
WP_013009175.1|1740843_1741632_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.7	6.1e-43
WP_000789014.1|1741638_1742379_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	83.3	2.3e-116
WP_000450850.1|1742404_1743175_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.4	1.9e-86
WP_001118161.1|1743190_1743586_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_000206794.1|1743642_1744227_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	83.5	5.5e-33
WP_001278450.1|1744342_1744447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000128513.1|1744635_1744848_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	3.6e-27
WP_000940306.1|1745408_1746008_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	93.0	5.9e-107
WP_000228035.1|1746007_1746298_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	7.4e-47
WP_000640158.1|1746294_1746849_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_000874263.1|1747770_1749717_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	97.5	0.0e+00
WP_014640514.1|1749854_1750034_+	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	98.3	1.1e-24
WP_001290217.1|1750074_1750347_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
WP_000284510.1|1750423_1750639_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000087714.1|1750643_1751177_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
WP_001056883.1|1751451_1752021_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	99.5	1.5e-104
WP_000455406.1|1752020_1752170_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_123005736.1|1752397_1752604_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	94.1	2.9e-29
WP_001139680.1|1752632_1752785_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_000343114.1|1752863_1753151_+	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	60.0	3.1e-29
WP_171815854.1|1753227_1753404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373410.1|1753664_1754141_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	99.4	9.5e-84
WP_001077622.1|1754137_1756261_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.9	0.0e+00
WP_000102415.1|1756257_1756470_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974545.1|1756469_1757972_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	99.8	1.4e-290
WP_001114424.1|1757916_1759941_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|1760028_1760355_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281348.1|1760347_1760629_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	100.0	2.1e-46
WP_000974958.1|1760631_1761255_+|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	100.0	8.9e-106
WP_000682716.1|1761267_1761666_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235038.1|1761673_1762426_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.6	2.9e-135
WP_000479043.1|1762439_1762862_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|1762888_1763197_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000918245.1|1763240_1765886_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	93.6	0.0e+00
WP_000847280.1|1765882_1766212_+|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_013009178.1|1766211_1766910_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	96.1	9.9e-130
WP_024201844.1|1766920_1767664_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.8	5.0e-148
WP_143714090.1|1767609_1768242_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	90.5	2.5e-95
WP_000514801.1|1768489_1771963_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.2	0.0e+00
WP_001253753.1|1772030_1772630_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	6.7e-111
WP_000279066.1|1772694_1773924_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	92.9	8.5e-76
WP_001023994.1|1773925_1774195_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZCV7	Stx2-converting_phage	96.6	1.9e-44
WP_001131657.1|1774307_1774883_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	1.8e-89
WP_013009182.1|1774955_1775585_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	90.8	5.7e-76
WP_001143784.1|1775666_1776308_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001295593.1|1777248_1777683_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837948.1|1777823_1778957_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	1.1e-117
1781231:1781246	attR	GCGCGCTTTTTTCTGA	NA	NA	NA	NA
>prophage 7
NC_013941	Escherichia coli O55:H7 str. CB9615, complete sequence	5386352	1960027	2017604	5386352	integrase,transposase,head,portal,capsid,tail,holin,terminase	Enterobacteria_phage(35.09%)	70	1993630:1993645	2025771:2025786
WP_000214712.1|1960027_1960231_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|1960266_1961727_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_001120551.1|1963230_1963473_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000343700.1|1963522_1964731_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	1.6e-47
WP_001121226.1|1964880_1965531_-	type III secretion system effector NleG7	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_001131642.1|1966241_1966817_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001023389.1|1966929_1967199_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	98.9	6.4e-45
WP_000279047.1|1967200_1968514_-|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.7	2.4e-76
WP_001230373.1|1968578_1969178_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	96.0	3.5e-107
WP_071781836.1|1972684_1973317_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	97.6	1.6e-94
WP_000140733.1|1973253_1973997_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	93.4	4.3e-139
WP_001152612.1|1974001_1974700_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847345.1|1974699_1975029_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_000082491.1|1975025_1977605_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.7	0.0e+00
WP_000533425.1|1977585_1977999_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	2.7e-42
WP_000479105.1|1978025_1978457_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000235022.1|1978470_1979223_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	4.6e-133
WP_000683056.1|1979230_1979626_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	4.4e-58
WP_000975025.1|1979622_1980156_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	3.8e-57
WP_001204558.1|1980170_1980524_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	1.9e-41
WP_000201503.1|1980516_1980900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522623.1|1980951_1981980_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000256723.1|1982037_1982385_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001253920.1|1982421_1983927_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	2.7e-100
WP_000831797.1|1983916_1985509_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	2.1e-183
WP_000259003.1|1985505_1985712_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	2.3e-10
WP_001418004.1|1985695_1987624_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	3.9e-261
WP_000235436.1|1987595_1988105_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000105085.1|1988499_1988727_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	98.7	1.1e-34
WP_012816791.1|1989151_1989337_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|1989564_1989711_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|1989710_1990280_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992088.1|1990550_1991084_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
WP_000731255.1|1991134_1991479_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	5.9e-59
WP_000284518.1|1991483_1991699_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|1991774_1992044_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|1992081_1992264_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|1992411_1994349_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
1993630:1993645	attL	CAGCACATTTTTCGGG	NA	NA	NA	NA
WP_000762928.1|1995427_1996249_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_001217410.1|1996245_1996620_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_001265028.1|1996632_1997679_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.5	1.4e-108
WP_001417850.1|1997680_1997959_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_001302544.1|1997899_1998085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018421.1|1998126_1998339_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_001278454.1|1998528_1998633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207995.1|1998748_1999618_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	77.2	1.0e-120
WP_000224233.1|1999628_1999892_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000256993.1|1999893_2000112_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	86.1	1.1e-26
WP_000935420.1|2000144_2000357_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_001151255.1|2000783_2001209_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.4	4.8e-63
WP_000770544.1|2001249_2002215_-	hypothetical protein	NA	U5P0A0	Shigella_phage	65.0	4.3e-59
WP_000693859.1|2002239_2002665_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000471546.1|2002661_2002877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000104592.1|2002926_2003643_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	40.8	6.7e-49
WP_001414141.1|2003908_2004061_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|2004175_2004691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449178.1|2005239_2005428_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090185.1|2005424_2005628_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048562.1|2005707_2008179_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	57.4	1.4e-53
WP_000005551.1|2008250_2008502_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.9e-15
WP_001206152.1|2008521_2009817_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	7.4e-155
WP_001531709.1|2009842_2009947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836042.1|2010004_2011024_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.5	1.1e-17
WP_001358608.1|2011035_2012250_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	3.1e-46
WP_001358609.1|2012455_2012782_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705189.1|2012916_2013258_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|2013292_2013853_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001303515.1|2013855_2014566_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_000778147.1|2014673_2014979_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041706.1|2015177_2017604_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.8	5.5e-212
2025771:2025786	attR	CAGCACATTTTTCGGG	NA	NA	NA	NA
>prophage 8
NC_013941	Escherichia coli O55:H7 str. CB9615, complete sequence	5386352	2149819	2195331	5386352	tRNA,integrase,head,portal,capsid,tail,holin,plate,terminase	Enterobacteria_phage(72.0%)	62	2152222:2152246	2187973:2187997
WP_000029463.1|2149819_2150569_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154193.1|2150568_2151120_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956513.1|2151182_2152163_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
2152222:2152246	attL	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_000416306.1|2152352_2152748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001247208.1|2152758_2153694_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	50.8	5.6e-80
WP_000904674.1|2153782_2154091_-	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	52.1	8.7e-22
WP_001151410.1|2154187_2154466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917809.1|2154480_2154819_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	87.1	2.3e-52
WP_000158971.1|2154829_2155117_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
WP_000357028.1|2155128_2155371_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	97.5	3.4e-37
WP_000021659.1|2155367_2155481_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	4.0e-09
WP_000543034.1|2155574_2155985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|2156008_2156212_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153700.1|2156208_2156475_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000104296.1|2156471_2156771_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	2.8e-41
WP_013009203.1|2156782_2157400_+	ash family protein	NA	S5MQL6	Escherichia_phage	37.8	2.1e-06
WP_000564222.1|2157396_2157786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001288338.1|2157782_2160623_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.8	0.0e+00
WP_000686524.1|2160699_2161659_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	9.9e-181
WP_000211272.1|2161663_2161975_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	98.1	2.6e-50
WP_001163778.1|2162038_2162371_+	carboxylate--amine ligase	NA	A0A0A7NV51	Enterobacteria_phage	98.2	7.1e-54
WP_001080490.1|2162367_2162706_+	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	100.0	1.6e-56
WP_000087800.1|2163197_2164244_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	1.3e-205
WP_000613756.1|2164243_2165995_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	98.3	0.0e+00
WP_001262673.1|2166149_2166986_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_001055104.1|2167009_2168062_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
WP_000632329.1|2168107_2168908_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	90.6	7.3e-129
WP_000063081.1|2169010_2169505_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.8	4.6e-89
WP_000864903.1|2169504_2169705_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	1.0e-31
WP_013009204.1|2169707_2170031_+|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	98.1	2.3e-49
WP_000072327.1|2170027_2170420_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_013009205.1|2170416_2170824_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	1.6e-63
WP_000920594.1|2170961_2171429_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000356334.1|2171421_2172057_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	2.4e-114
WP_077626244.1|2172068_2172635_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.8	1.2e-98
WP_001067548.1|2172652_2172982_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_001111942.1|2172985_2173882_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	1.1e-154
WP_000071724.1|2173874_2174483_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.5e-86
WP_059279521.1|2176054_2176558_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	55.2	6.0e-44
WP_033875510.1|2176586_2177045_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	56.0	1.3e-42
WP_001057722.1|2177051_2177663_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	79.5	7.2e-84
WP_000503763.1|2177662_2178121_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	53.1	5.3e-39
WP_137531352.1|2178131_2178599_-|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	70.6	9.1e-47
WP_001165544.1|2178631_2179231_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	86.3	2.6e-86
WP_000979954.1|2179257_2179746_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_000853426.1|2179758_2182566_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	91.7	0.0e+00
WP_000333503.1|2182552_2182708_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651572.1|2182716_2183091_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_000290447.1|2183146_2183659_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	9.2e-93
WP_000005363.1|2183658_2184843_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.5	4.3e-226
WP_000132801.1|2185000_2186110_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	6.3e-195
WP_001057122.1|2186304_2186970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000488101.1|2187119_2187380_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|2187570_2187711_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001229265.1|2188014_2188314_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
2187973:2187997	attR	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_000672314.1|2188318_2190706_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018588.1|2190720_2191704_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|2191986_2192031_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|2192153_2192510_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2192562_2192760_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|2192856_2193399_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144201.1|2193402_2195331_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	9.4e-130
>prophage 9
NC_013941	Escherichia coli O55:H7 str. CB9615, complete sequence	5386352	2440336	2516409	5386352	integrase,transposase,head,protease,portal,capsid,tail,holin,terminase	Enterobacteria_phage(39.02%)	69	2459261:2459276	2523230:2523245
WP_001023389.1|2440336_2440606_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	98.9	6.4e-45
WP_001230272.1|2441986_2442586_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	95.5	7.7e-107
WP_000515115.1|2442653_2446130_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	94.0	0.0e+00
WP_000649829.1|2446263_2446791_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_143714091.1|2446981_2447620_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	88.2	1.1e-95
WP_013009225.1|2447559_2448300_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	92.6	3.8e-140
WP_001357740.1|2448305_2449004_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000847304.1|2449003_2449333_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_000082475.1|2449329_2451909_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.1	0.0e+00
WP_000533419.1|2451889_2452303_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	1.0e-41
WP_000479105.1|2452329_2452761_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000235021.1|2452774_2453527_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	4.6e-133
WP_000683076.1|2453534_2453930_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	6.7e-59
WP_000974984.1|2453926_2454460_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.6	1.9e-56
WP_001204554.1|2454475_2454829_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201512.1|2454821_2455205_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522623.1|2455256_2456285_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000256723.1|2456342_2456690_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001253920.1|2456726_2458232_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	2.7e-100
WP_000831797.1|2458221_2459814_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	2.1e-183
2459261:2459276	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_000259002.1|2459810_2460017_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_024201851.1|2460000_2461929_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.3e-259
WP_000235436.1|2461900_2462410_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001329960.1|2462811_2462997_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000347012.1|2463133_2463271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000736381.1|2463687_2463882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122991286.1|2463967_2464153_-	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	96.7	6.0e-18
WP_032140280.1|2464374_2464461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092850.1|2465015_2465549_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.7	3.9e-102
WP_000731214.1|2465591_2466581_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	64.4	6.8e-108
WP_000411813.1|2466585_2466792_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	1.2e-30
WP_000874327.1|2467084_2468935_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000261910.1|2469702_2470416_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265268.1|2471036_2471855_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090265.1|2472007_2472379_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_001217436.1|2472368_2472740_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265288.1|2472752_2473802_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	2.0e-110
WP_010917803.1|2473803_2474082_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_000975564.1|2474151_2474412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000401168.1|2474566_2475670_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_001004959.1|2475650_2476301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2476466_2476622_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000101550.1|2476993_2477953_-	SIR2 family protein	NA	NA	NA	NA	NA
WP_001151172.1|2478393_2478801_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.5	1.8e-62
WP_000054513.1|2478841_2479807_-	hypothetical protein	NA	U5P0A0	Shigella_phage	59.6	2.2e-55
WP_000705361.1|2479787_2480309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476994.1|2480292_2480520_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003381.1|2480597_2481005_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000379559.1|2481197_2481350_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_000559930.1|2481463_2481979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449169.1|2482520_2482709_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199480.1|2482705_2482894_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000990641.1|2482986_2485404_+	exonuclease	NA	V5UQJ3	Shigella_phage	60.1	6.0e-174
WP_000094838.1|2485462_2485666_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533608.1|2485665_2486691_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	56.7	2.9e-101
WP_001302302.1|2486926_2487724_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000480501.1|2496457_2497510_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000378596.1|2497824_2499141_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|2499242_2500697_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532909.1|2501039_2501756_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|2504142_2505093_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011474.1|2505194_2506112_-	nitrogen assimilation transcriptional regulator NAC	NA	NA	NA	NA	NA
WP_000986329.1|2506568_2507504_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193830.1|2507565_2508645_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2508656_2509400_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973176.1|2509396_2509942_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001419103.1|2511613_2513761_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000502860.1|2514131_2514770_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	51.0	2.1e-54
WP_085959019.1|2515196_2516409_+|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	7.5e-101
2523230:2523245	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
>prophage 10
NC_013941	Escherichia coli O55:H7 str. CB9615, complete sequence	5386352	2677587	2687033	5386352		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001359338.1|2677587_2678724_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_013009241.1|2678720_2680724_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	99.9	0.0e+00
WP_001359339.1|2680848_2681310_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	2.4e-76
WP_001295430.1|2681351_2681822_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2681868_2682588_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001359340.1|2682584_2684270_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.8	5.1e-305
WP_001240401.1|2684491_2685223_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2685282_2685390_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2685370_2686102_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569336.1|2686106_2687033_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 11
NC_013941	Escherichia coli O55:H7 str. CB9615, complete sequence	5386352	2932965	2938391	5386352	integrase	Enterobacteria_phage(50.0%)	6	2923416:2923432	2935380:2935396
2923416:2923432	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000368131.1|2932965_2933898_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958698.1|2934209_2935367_+|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	99.7	1.4e-221
WP_000257010.1|2935541_2936678_-	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
2935380:2935396	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000960724.1|2936687_2937368_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000403518.1|2937354_2937822_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.0	1.8e-63
WP_000950857.1|2937821_2938391_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
>prophage 12
NC_013941	Escherichia coli O55:H7 str. CB9615, complete sequence	5386352	3124151	3200788	5386352	tRNA,capsid,tail,holin,plate,terminase	Salmonella_phage(46.81%)	81	NA	NA
WP_000940018.1|3124151_3124889_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553451.1|3125007_3125811_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_001301747.1|3125955_3126810_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000982994.1|3127000_3128281_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_000244203.1|3128272_3129412_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000423257.1|3129571_3130462_-	DNA-binding transcriptional regulator HcaR	NA	NA	NA	NA	NA
WP_000211172.1|3130597_3131959_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_001276062.1|3131955_3132474_+	3-phenylpropionate/cinnamic acid dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_001080102.1|3132473_3132794_+	bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_001281372.1|3132790_3133603_+	3-phenylpropionate-dihydrodiol/cinnamic acid-dihydrodiol dehydrogenase	NA	NA	NA	NA	NA
WP_000660772.1|3133612_3134815_+	phenylpropionate dioxygenase ferredoxin reductase subunit	NA	NA	NA	NA	NA
WP_001087250.1|3134911_3135334_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000158561.1|3135381_3136254_-	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_000700787.1|3136265_3137360_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_001276664.1|3137392_3138391_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000493510.1|3138415_3139927_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	1.1e-13
WP_001124894.1|3139949_3140933_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001358959.1|3141029_3144311_-	DUF5107 domain-containing protein	NA	NA	NA	NA	NA
WP_001200779.1|3144428_3145622_+	ROK family protein	NA	NA	NA	NA	NA
WP_000919153.1|3145684_3146938_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	1.3e-100
WP_000883120.1|3147265_3148456_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|3148500_3148839_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001295369.1|3148899_3150234_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215861.1|3150223_3150937_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001301750.1|3151101_3152529_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	25.6	1.8e-16
WP_000970087.1|3153104_3156992_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	5.9e-131
WP_000734212.1|3157248_3158805_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001298403.1|3158801_3159338_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000190651.1|3159362_3159998_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001013779.1|3160206_3161055_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001288816.1|3161693_3162341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000904993.1|3162413_3162962_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	89.0	2.8e-87
WP_077626228.1|3162988_3163390_+|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	37.7	5.9e-10
WP_000376430.1|3163393_3163813_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	53.7	7.2e-35
WP_001030527.1|3163784_3164387_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	4.3e-97
WP_001096936.1|3164386_3165232_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	56.0	5.7e-47
WP_000049950.1|3165231_3165912_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.8	2.6e-103
WP_001197088.1|3165908_3167108_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	83.4	1.4e-184
WP_001270630.1|3167107_3167461_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	89.7	1.5e-54
WP_001007932.1|3167460_3168213_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	66.3	2.0e-88
WP_000213604.1|3168275_3168446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000044735.1|3168449_3169004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000832850.1|3169011_3169359_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	81.1	6.0e-27
WP_000081725.1|3169361_3170426_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	81.4	3.2e-156
WP_000155119.1|3170428_3170731_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	92.0	2.2e-49
WP_001298404.1|3170730_3171318_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.0	3.4e-83
WP_000990892.1|3171317_3173306_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	74.2	2.5e-271
WP_000393952.1|3173483_3173936_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	71.3	5.2e-55
WP_000109253.1|3173939_3174380_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	9.2e-57
WP_000046937.1|3174390_3175536_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.8	6.1e-161
WP_000503648.1|3175539_3176103_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.7	1.7e-79
WP_001142480.1|3176077_3176467_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	96.1	2.5e-66
WP_000008731.1|3176453_3177008_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	71.7	8.0e-66
WP_000042171.1|3177004_3177412_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.8	9.7e-69
WP_001040696.1|3177377_3177746_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	87.7	8.8e-53
WP_000627481.1|3177786_3178728_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	87.2	6.3e-156
WP_001066731.1|3178739_3179246_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	80.5	1.7e-70
WP_000873179.1|3179249_3180470_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	87.8	1.9e-200
WP_000184962.1|3180484_3181219_-|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	85.6	2.3e-97
WP_000113493.1|3181109_3182576_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	91.6	2.3e-261
WP_001130776.1|3182575_3184198_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.6	0.0e+00
WP_000162796.1|3184200_3184773_-|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	69.6	1.4e-60
WP_000779566.1|3184834_3185359_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	66.9	4.5e-42
WP_001157004.1|3185342_3185819_-	glycoside hydrolase family 104 protein	NA	Q8SBE0	Shigella_phage	94.9	5.0e-85
WP_000781777.1|3185822_3186164_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	92.8	7.3e-54
WP_001174014.1|3186609_3186951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001244505.1|3186982_3187405_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	64.2	5.2e-41
WP_001284072.1|3187689_3189876_-	replication protein	NA	B6SCY1	Bacteriophage	72.4	3.2e-174
WP_000170998.1|3189879_3190092_-	helix-turn-helix transcriptional regulator	NA	A0A0R6PHL1	Moraxella_phage	42.9	7.9e-06
WP_000049986.1|3190212_3190836_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	44.8	3.3e-36
WP_000801676.1|3191469_3191619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000051352.1|3191615_3192518_+	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
WP_001113505.1|3192520_3193822_+	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	55.5	3.0e-132
WP_000769005.1|3193837_3194386_+	DUF2815 family protein	NA	Q775A5	Bordetella_phage	65.9	2.1e-66
WP_000551014.1|3194438_3195068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065474.1|3195114_3197178_+	DNA polymerase	NA	Q775A3	Bordetella_phage	67.7	5.7e-274
WP_130234667.1|3197263_3197773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001177149.1|3197778_3198330_+	YfbU family protein	NA	NA	NA	NA	NA
WP_000638863.1|3198372_3198642_+	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	63.5	5.1e-26
WP_001101052.1|3198647_3199358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000627622.1|3199396_3200788_+	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	73.5	2.2e-213
>prophage 13
NC_013941	Escherichia coli O55:H7 str. CB9615, complete sequence	5386352	3214947	3315071	5386352	tRNA,integrase,transposase,head,protease,capsid,tail,holin,lysis,terminase	Enterobacteria_phage(32.1%)	115	3254274:3254289	3314995:3315010
WP_001302911.1|3214947_3215685_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|3215816_3217151_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001383425.1|3217183_3218065_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189215.1|3218167_3218755_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|3218810_3219194_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262720.1|3219498_3220188_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	3.5e-55
WP_000997403.1|3220235_3221273_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3221479_3221899_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000138184.1|3221967_3222666_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_000082974.1|3222697_3225358_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|3225471_3226827_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001322343.1|3226872_3227196_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000852126.1|3227192_3228491_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	7.4e-46
WP_001235102.1|3234254_3236828_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040152.1|3236957_3237689_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079092.1|3237685_3238666_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3238800_3239538_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|3239808_3240150_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3240253_3240301_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_000200089.1|3240399_3241560_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225204.1|3241602_3242724_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168032.1|3242734_3243805_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	6.9e-90
WP_001301878.1|3244014_3244380_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|3244529_3245048_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969027.1|3245037_3246264_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589828.1|3246279_3246762_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3246838_3247186_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|3247227_3247995_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3248025_3248574_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3248592_3248841_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|3248977_3250339_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|3250505_3251297_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_077626229.1|3251318_3252605_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|3252659_3253253_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059167.1|3253375_3254254_+	NAD(+) kinase	NA	NA	NA	NA	NA
3254274:3254289	attL	CTGTATATAAAACCAG	NA	NA	NA	NA
WP_000880923.1|3254339_3256001_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3256149_3256491_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|3256552_3256843_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|3256832_3257309_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3257440_3257923_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|3258768_3259017_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001132161.1|3259518_3260109_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001117988.1|3261653_3262226_-	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	52.7	2.1e-45
WP_001023480.1|3262336_3262606_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	98.9	7.1e-44
WP_000279045.1|3262607_3263921_-|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.5	6.9e-76
WP_013009255.1|3263985_3264609_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.9	1.1e-68
WP_000514730.1|3264678_3268155_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	95.4	0.0e+00
WP_134789912.1|3268401_3269034_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	88.5	2.2e-96
WP_024201854.1|3268979_3269717_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.5e-147
WP_001428824.1|3269771_3270695_-	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	100.0	1.3e-177
WP_001154347.1|3270765_3270939_-	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	98.2	1.7e-22
WP_001302649.1|3271046_3271367_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_013009257.1|3271383_3272082_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	99.6	3.3e-133
WP_000807964.1|3272081_3272423_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_000212977.1|3272415_3275658_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.8	0.0e+00
WP_001513217.1|3275705_3275915_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000710949.1|3276010_3276385_-|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001275485.1|3276399_3277116_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.2	1.8e-126
WP_000133388.1|3277182_3277527_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3277523_3277970_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007889.1|3277966_3278317_-|head	phage head closure protein	head	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
WP_000125988.1|3278327_3278654_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063099.1|3281342_3281564_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173078.1|3281608_3283546_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.5	0.0e+00
WP_001368653.1|3283609_3285271_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.3	0.0e+00
WP_000958380.1|3285267_3285831_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_013009260.1|3286121_3286487_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	95.0	4.2e-63
WP_000095747.1|3286528_3286729_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	95.5	8.1e-29
WP_000828065.1|3286861_3287188_-	TonB family protein	NA	H6WZK5	Escherichia_phage	88.9	4.7e-50
WP_013009262.1|3287534_3287759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082579.1|3287755_3288250_-|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	94.2	4.6e-73
WP_000539792.1|3288257_3288404_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3288403_3288973_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992088.1|3289243_3289777_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
WP_000731241.1|3289827_3290172_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_029785460.1|3290176_3290392_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
WP_143714089.1|3290757_3291970_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.4	1.7e-100
WP_000143024.1|3292087_3293938_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	98.7	0.0e+00
WP_000466957.1|3294509_3294941_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_001356551.1|3295402_3295555_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204862.1|3295803_3296238_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	99.3	1.8e-81
WP_000144764.1|3296230_3296425_-	phage NinH family protein	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001108006.1|3296421_3297027_-	recombination protein NinG	NA	Q8VNP2	Enterobacteria_phage	100.0	1.9e-97
WP_001004030.1|3297026_3297749_-	phage antirepressor KilAC domain-containing protein	NA	Q4A1A3	Enterobacteria_phage	99.6	5.4e-131
WP_000211412.1|3297823_3298528_-	phage antirepressor Ant	NA	Q8VNP5	Enterobacteria_phage	96.6	6.5e-129
WP_001254208.1|3298805_3298988_-	NinE family protein	NA	Q4A1A6	Enterobacteria_phage	96.7	3.1e-27
WP_000153282.1|3298984_3299512_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	2.8e-100
WP_000736897.1|3299508_3299949_-	recombination protein NinB	NA	Q8H9Z8	Enterobacteria_phage	99.3	7.0e-81
WP_000145931.1|3300022_3300313_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000788877.1|3300309_3301011_-	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	100.0	9.9e-130
WP_000185457.1|3301007_3301946_-	replication protein	NA	C1JJ53	Enterobacteria_phage	99.4	3.7e-172
WP_000035947.1|3301978_3302275_-	hypothetical protein	NA	A0A0N7C1W0	Escherichia_phage	96.9	1.3e-46
WP_000276885.1|3302384_3302570_-	Cro/Cl family transcriptional regulator	NA	K7PHK4	Enterobacteria_phage	100.0	1.2e-26
WP_001095982.1|3302650_3303301_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	100.0	4.9e-123
WP_000256573.1|3303615_3303921_+	hypothetical protein	NA	K7PJM7	Enterobacteria_phage	99.0	7.0e-48
WP_000930321.1|3303923_3304262_+	hypothetical protein	NA	K7PJW2	Enterobacteria_phage	99.1	5.8e-59
WP_000167595.1|3304395_3304866_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000065350.1|3305015_3305384_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	98.4	1.0e-64
WP_001198860.1|3305456_3305621_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000372926.1|3305589_3305754_+	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	98.1	3.2e-23
WP_000995439.1|3305808_3306105_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100845.1|3306110_3306896_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000186825.1|3306892_3307573_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.1	1.3e-131
WP_000682317.1|3307569_3307752_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	98.3	2.8e-28
WP_000548523.1|3307724_3307916_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	95.2	1.8e-25
WP_000188857.1|3307992_3308208_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	98.6	3.8e-32
WP_000774248.1|3308306_3308528_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	100.0	3.8e-35
WP_001290004.1|3308524_3309343_+	ead/Ea22-like family protein	NA	A0A1I9LJM5	Stx_converting_phage	57.9	6.7e-61
WP_000628782.1|3309339_3309843_+	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	43.3	1.4e-56
WP_000457735.1|3309930_3310173_+	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	100.0	1.2e-37
WP_001030149.1|3310176_3310323_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	87.5	5.9e-21
WP_013009269.1|3310495_3311680_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	87.6	5.3e-200
WP_000101041.1|3312172_3313096_+	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	87.4	6.9e-155
WP_001358980.1|3313386_3314616_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	99.3	4.9e-233
WP_000448924.1|3314654_3315071_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	98.6	1.1e-70
3314995:3315010	attR	CTGGTTTTATATACAG	NA	NA	NA	NA
>prophage 14
NC_013941	Escherichia coli O55:H7 str. CB9615, complete sequence	5386352	3716164	3723565	5386352	transposase	Shigella_phage(16.67%)	9	NA	NA
WP_085959019.1|3716164_3717377_+|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	7.5e-101
WP_001323397.1|3717498_3717657_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_001234731.1|3717811_3718630_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.3	2.3e-45
WP_000213700.1|3718720_3719206_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	2.4e-13
WP_001186192.1|3719220_3719697_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|3719759_3719981_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001285587.1|3720054_3720423_+	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_013009286.1|3721262_3722804_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	8.3e-129
WP_001016257.1|3722818_3723565_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
>prophage 15
NC_013941	Escherichia coli O55:H7 str. CB9615, complete sequence	5386352	5306262	5358235	5386352	integrase,head,portal,capsid,tail,holin,terminase	Enterobacteria_phage(45.28%)	64	5303176:5303201	5360309:5360334
5303176:5303201	attL	CGGATAAGGCGTTCACGCCGCATCCG	NA	NA	NA	NA
WP_001218277.1|5306262_5307486_+|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	98.5	4.0e-235
WP_001159679.1|5307668_5311496_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_000206744.1|5311892_5312513_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	90.8	6.3e-112
WP_001242714.1|5312512_5312875_-	phage protein	NA	K7PH61	Enterobacteria_phage	97.4	1.7e-64
WP_000008230.1|5312865_5313402_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	99.4	1.6e-100
WP_000081297.1|5313529_5314354_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	99.6	4.6e-150
WP_000135680.1|5314419_5314782_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_001311077.1|5315484_5316177_-	helix-turn-helix domain-containing protein	NA	S5FUZ3	Shigella_phage	96.5	2.9e-121
WP_001191669.1|5316274_5316535_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_000526667.1|5316527_5317079_+	hypothetical protein	NA	S5FXP0	Shigella_phage	95.1	2.1e-95
WP_001250269.1|5317254_5317434_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104941.1|5317423_5318365_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.0	6.4e-140
WP_013009328.1|5318361_5318856_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	1.1e-85
WP_000066917.1|5318855_5319509_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210181.1|5319505_5319832_+	LexA family transcriptional regulator	NA	U5P451	Shigella_phage	100.0	9.2e-54
WP_000771483.1|5319828_5320224_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	97.6	9.7e-66
WP_001072669.1|5320386_5321202_+	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.3	8.5e-149
WP_001519432.1|5321209_5322199_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	4.3e-195
WP_001047103.1|5322212_5322965_+	antitermination protein	NA	Q8SBE4	Shigella_phage	98.4	3.4e-136
WP_122632654.1|5323243_5323333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000087755.1|5323387_5323600_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066486.1|5323900_5324116_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	75.0	5.9e-25
WP_000839580.1|5324868_5325084_+|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	93.0	1.9e-31
WP_000193257.1|5325088_5325433_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	91.7	7.0e-36
WP_001315200.1|5325398_5325671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992048.1|5325776_5326310_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.9	1.5e-98
WP_001071779.1|5326306_5326798_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_000066496.1|5327166_5327379_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071528545.1|5327389_5327578_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|5327725_5327881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|5328053_5328227_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000548594.1|5328522_5328729_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	80.9	2.6e-22
WP_032143631.1|5328982_5329174_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	8.0e-26
WP_000867568.1|5329562_5330111_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001304453.1|5330082_5332011_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	3.3e-260
WP_000258997.1|5331994_5332201_+|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_000831760.1|5332197_5333790_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	6.5e-185
WP_001253894.1|5333779_5335285_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.2	1.3e-99
WP_000256813.1|5335321_5335669_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.6e-22
WP_000522651.1|5335726_5336755_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.7e-115
WP_000201530.1|5336806_5337181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204540.1|5337173_5337527_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_001007375.1|5337538_5338117_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.2	1.7e-79
WP_000683149.1|5338113_5338509_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	5.0e-70
WP_001577918.1|5338516_5339257_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	6.1e-130
WP_000479163.1|5339272_5339695_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	2.4e-70
WP_000459487.1|5339676_5340111_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	97.5	6.5e-63
WP_000840309.1|5340103_5342665_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.2	0.0e+00
WP_000847318.1|5342661_5342991_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	95.4	1.9e-54
WP_001179670.1|5342990_5343689_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	95.7	4.9e-129
WP_064717060.1|5343693_5344437_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	5.2e-145
WP_013009330.1|5344334_5344976_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	8.6e-96
WP_153274582.1|5345048_5345387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000515647.1|5345453_5348852_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.3	0.0e+00
WP_001230356.1|5348918_5349518_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	1.8e-111
WP_013009332.1|5349582_5352411_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	92.4	2.5e-54
WP_000885582.1|5352410_5352986_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	7.2e-102
WP_000086527.1|5353083_5353674_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836769.1|5354052_5354286_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	6.4e-33
WP_001372053.1|5354354_5354468_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	77.8	1.4e-06
WP_001217537.1|5354894_5355143_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	2.4e-38
WP_000202563.1|5355362_5356949_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001295748.1|5357341_5357947_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|5358073_5358235_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
5360309:5360334	attR	CGGATAAGGCGTTCACGCCGCATCCG	NA	NA	NA	NA
