The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_013530	Xylanimonas cellulosilytica DSM 15894, complete sequence	3742776	595109	630917	3742776	tail,terminase,capsid,head,protease	Brevibacterium_phage(58.33%)	38	NA	NA
WP_012877286.1|595109_596009_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_050758383.1|596153_597521_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_050758385.1|597545_598418_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_012877289.1|598632_599235_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012877290.1|599297_599984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012877291.1|600043_600538_-	YajQ family cyclic di-GMP-binding protein	NA	NA	NA	NA	NA
WP_012877292.1|601023_601449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012877293.1|601451_601730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012877294.1|602280_603075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012877295.1|603080_603305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012877296.1|603368_606005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012877297.1|606009_607323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012877299.1|607454_607796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012877300.1|607792_608431_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_012877301.1|608506_608857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012877302.1|608853_610185_-|tail	tail fiber protein	tail	A0A0U4JXW2	Arthrobacter_phage	67.1	3.7e-24
WP_012877303.1|610184_611354_-	siphovirus ReqiPepy6 Gp37-like family protein	NA	A0A2H4PGE3	Streptomyces_phage	26.4	2.8e-12
WP_012877304.1|611350_612295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012877305.1|612291_617178_-|tail	phage tail tape measure protein	tail	A0A2H4JEN9	uncultured_Caudovirales_phage	43.9	3.0e-71
WP_148220648.1|617215_617557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012877307.1|617630_618410_-	phage antirepressor KilAC domain-containing protein	NA	A0A2P1N2N7	Gordonia_phage	43.6	5.4e-44
WP_012877308.1|618406_618727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148220649.1|619064_619328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012877311.1|619477_620206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012877312.1|620303_620816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012877313.1|620817_621006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012877314.1|621077_621482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012877315.1|621478_621832_-	HK97 gp10 family phage protein	NA	A0A249XNM6	Brevibacterium_phage	52.3	6.9e-23
WP_012877316.1|621831_622272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012877317.1|622277_622661_-	hypothetical protein	NA	A0A249XQ72	Brevibacterium_phage	42.2	3.1e-08
WP_012877318.1|622748_623897_-|head	Mu-like prophage major head subunit gpT family protein	head	A0A249XNM5	Brevibacterium_phage	34.2	2.4e-40
WP_012877319.1|623910_624240_-	DUF2190 family protein	NA	A0A286N4E6	Arthrobacter_phage	41.3	9.7e-11
WP_012877320.1|624241_625639_-	hypothetical protein	NA	A0A249XNL5	Brevibacterium_phage	40.8	6.1e-38
WP_012877321.1|625668_625803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148220650.1|625987_626239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012877323.1|626244_627768_-|capsid	minor capsid protein	capsid	A0A249XNT1	Brevibacterium_phage	40.8	2.7e-63
WP_012877324.1|627769_629413_-	hypothetical protein	NA	A0A249XNL8	Brevibacterium_phage	47.6	1.0e-121
WP_012877325.1|629429_630917_-|terminase	phage terminase large subunit	terminase	A0A249XNL6	Brevibacterium_phage	58.4	6.3e-158
>prophage 2
NC_013530	Xylanimonas cellulosilytica DSM 15894, complete sequence	3742776	638484	647543	3742776		Mycobacterium_phage(33.33%)	16	NA	NA
WP_012877345.1|638484_638856_-	VRR-NUC domain-containing protein	NA	A0A1B1IPM4	uncultured_Mediterranean_phage	39.6	4.9e-11
WP_012877346.1|638932_639166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041582728.1|639446_639743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012877348.1|640154_640343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081444473.1|640827_641163_-	WhiB family transcriptional regulator	NA	A0A2P1CGA4	Mycobacterium_phage	47.5	4.0e-12
WP_012877350.1|641189_641822_-	HNH endonuclease	NA	A0A2P1N3E9	Mycobacterium_phage	56.5	2.5e-55
WP_012877351.1|641818_643480_-	DNA cytosine methyltransferase	NA	A0A1B3AYU4	Gordonia_phage	60.3	2.9e-180
WP_012877352.1|643476_643668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012877353.1|643664_644207_-	hypothetical protein	NA	A0A1D8ETM9	Propionibacterium_phage	33.1	4.2e-11
WP_012877354.1|644203_644350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012877355.1|644349_644649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012877356.1|644645_645176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012877357.1|645172_645538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012877358.1|645534_645819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012877359.1|645821_645983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187289417.1|646187_647543_-	AAA family ATPase	NA	A0A1P8VV42	Rathayibacter_phage	36.7	5.5e-68
>prophage 3
NC_013530	Xylanimonas cellulosilytica DSM 15894, complete sequence	3742776	1709365	1758206	3742776	integrase,protease,transposase	Planktothrix_phage(50.0%)	49	1708861:1708895	1741417:1741451
1708861:1708895	attL	CAAGGGGTCGCAGGTTCAAATCCTGTCAGCCCGAC	NA	NA	NA	NA
WP_012878341.1|1709365_1710634_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U4B2E0	Arthrobacter_phage	36.2	1.5e-51
WP_012878342.1|1710712_1711738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012878343.1|1711737_1712256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012878344.1|1712252_1712705_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_012878345.1|1712998_1713451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012878346.1|1713450_1713699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012878347.1|1713761_1715540_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_012878348.1|1715536_1716070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050758167.1|1716066_1716633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187289430.1|1716768_1717524_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_041582768.1|1717432_1717939_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_187289431.1|1718073_1720170_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_148220700.1|1720861_1721854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050758168.1|1722176_1722656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012878351.1|1723186_1724311_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_012878352.1|1724307_1725030_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.5	1.0e-20
WP_012878353.1|1725026_1726109_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_012878354.1|1726575_1727172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081444388.1|1727564_1727939_+	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_012878356.1|1728194_1728509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012878357.1|1728640_1729123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012878358.1|1729115_1730195_+	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_012878359.1|1730191_1730884_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.2	2.4e-19
WP_148220701.1|1730880_1732017_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_041582773.1|1733896_1734418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012878362.1|1734831_1735143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012878363.1|1735370_1735814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012878364.1|1736182_1737634_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_012878366.1|1738566_1738833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081444484.1|1739196_1740405_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_012878368.1|1740592_1740979_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012878369.1|1741556_1741823_-	hypothetical protein	NA	NA	NA	NA	NA
1741417:1741451	attR	CAAGGGGTCGCAGGTTCAAATCCTGTCAGCCCGAC	NA	NA	NA	NA
WP_012878371.1|1742264_1743095_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_012878372.1|1743235_1743796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012878373.1|1743986_1745417_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_012878374.1|1745413_1745761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187289432.1|1745757_1745913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050758472.1|1746038_1746491_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012878377.1|1746699_1747008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012878378.1|1747004_1747775_+	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_012878379.1|1748126_1750625_+	Ig-like domain repeat protein	NA	NA	NA	NA	NA
WP_050758171.1|1750989_1751478_-	nitroreductase family deazaflavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012878381.1|1751572_1752865_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012878382.1|1752861_1753554_-	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	26.4	2.4e-11
WP_187289433.1|1753684_1754902_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_012878384.1|1754898_1755561_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012878385.1|1755514_1756219_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012878386.1|1756215_1757358_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_012878387.1|1757360_1758206_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 4
NC_013530	Xylanimonas cellulosilytica DSM 15894, complete sequence	3742776	2106639	2121190	3742776	tail,plate	Bacillus_phage(50.0%)	12	NA	NA
WP_012878710.1|2106639_2108670_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_012878711.1|2108669_2110625_-|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_012878712.1|2110627_2111023_-	GPW/gp25 family protein	NA	J9PVB9	Bacillus_phage	30.3	9.2e-08
WP_012878713.1|2111034_2111799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012878714.1|2111795_2112623_-	Rhs element Vgr protein	NA	NA	NA	NA	NA
WP_012878715.1|2112627_2113851_-	phage late control D family protein	NA	NA	NA	NA	NA
WP_148220719.1|2113847_2114558_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_012878717.1|2114563_2114749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012878718.1|2114748_2115285_-|tail	phage tail protein	tail	T2KSM5	uncultured_phage	30.5	1.6e-07
WP_012878719.1|2115281_2117342_-|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	34.6	5.2e-09
WP_012878720.1|2117343_2117787_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_012878721.1|2117836_2121190_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	E3SL60	Synechococcus_phage	24.9	5.1e-06
