The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_013595	Streptosporangium roseum DSM 43021, complete sequence	10341314	151567	213991	10341314	integrase,transposase,protease	Streptomyces_phage(33.33%)	60	166845:166863	204391:204409
WP_012886948.1|151567_152938_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_043654382.1|152934_153105_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_169369521.1|153125_154766_-	replication initiation protein	NA	NA	NA	NA	NA
WP_012886951.1|154855_155032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012886952.1|155031_156477_-	cell division protein FtsK	NA	NA	NA	NA	NA
WP_012886953.1|156566_156998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012886954.1|157110_157848_-	GntR family transcriptional regulator	NA	A0A291LID1	Streptomyces_phage	47.9	4.9e-10
WP_012886955.1|158298_158613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012886956.1|158905_159691_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012886957.1|159763_160213_+	NUDIX domain-containing protein	NA	A0A0F6YPF5	Sinorhizobium_phage	35.7	1.7e-05
WP_012886958.1|160628_161891_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_148268905.1|161944_164233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043651045.1|166059_166383_-	hypothetical protein	NA	NA	NA	NA	NA
166845:166863	attL	CGTGCCCGTCGCGTGCCCG	NA	NA	NA	NA
WP_012886961.1|167089_167446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012886963.1|168279_169242_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_148269430.1|169593_171033_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012886965.1|171029_172919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012886966.1|172915_174997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012886967.1|174993_175392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169369210.1|175353_175593_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012886968.1|175697_176900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148268906.1|176940_177516_-	YceI family protein	NA	NA	NA	NA	NA
WP_012886970.1|178092_178485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012886971.1|178632_179286_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_043651052.1|179437_179683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012886972.1|179802_180663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012886974.1|180999_181323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012886975.1|181420_181807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148268907.1|181810_182233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012886977.1|182568_183021_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012886978.1|183158_183776_+	LysE family translocator	NA	NA	NA	NA	NA
WP_012886979.1|183944_184670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012886980.1|184853_185423_+	cadmium resistance transporter	NA	NA	NA	NA	NA
WP_012886981.1|185475_186285_+|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_169369212.1|186414_187308_-	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_012886983.1|187313_188345_-	permease	NA	NA	NA	NA	NA
WP_012886984.1|188388_189252_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_012886985.1|189494_190223_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_012886986.1|190908_192090_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_012886987.1|192211_193051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012886988.1|193056_194007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012886989.1|194255_194825_+	SigE family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_081452994.1|194901_195471_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012886991.1|195482_196046_+	YceI family protein	NA	NA	NA	NA	NA
WP_081452995.1|196492_196846_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012886993.1|197397_197982_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_012886994.1|198183_198825_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_169369214.1|198821_200087_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_012886996.1|200095_201073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012886997.1|201101_201350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012886998.1|203845_204331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043651062.1|204612_204936_+	hypothetical protein	NA	NA	NA	NA	NA
204391:204409	attR	CGTGCCCGTCGCGTGCCCG	NA	NA	NA	NA
WP_012886999.1|205825_207619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043651070.1|208138_208321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043651074.1|208465_208813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043651077.1|208862_209468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012887001.1|210234_211008_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012887002.1|211004_211943_-	daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.5	3.1e-17
WP_012887003.1|211968_212640_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_012887004.1|213361_213991_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_013595	Streptosporangium roseum DSM 43021, complete sequence	10341314	4733265	4760444	10341314	integrase,transposase,tail,protease	Mycobacterium_phage(40.0%)	24	4752510:4752525	4773395:4773410
WP_012890893.1|4733265_4734474_+|tail	phage tail sheath family protein	tail	A0A191SAV9	Nostoc_phage	31.7	6.7e-17
WP_012890894.1|4734882_4735320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012890895.1|4735360_4737997_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_012890896.1|4737993_4738293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012890897.1|4738950_4739361_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_148269631.1|4739347_4740676_-	TIGR04053 family radical SAM/SPASM domain-containing protein	NA	NA	NA	NA	NA
WP_052316986.1|4741349_4741664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012890899.1|4742225_4742987_-	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.7	2.0e-22
WP_148269632.1|4743022_4744300_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	36.8	2.4e-49
WP_012890901.1|4744478_4745057_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_148269633.1|4746169_4746499_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_012890903.1|4746752_4747034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012890904.1|4747271_4748114_+|transposase	IS5-like element ISStro1 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	53.1	3.6e-78
WP_012890905.1|4748132_4748897_-	maleylpyruvate isomerase family mycothiol-dependent enzyme	NA	NA	NA	NA	NA
WP_169369324.1|4749024_4749423_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_043652455.1|4749324_4750737_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_043652458.1|4750735_4751983_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_043652461.1|4752011_4753280_+	MFS transporter	NA	NA	NA	NA	NA
4752510:4752525	attL	CTGACGGCGCCGGCGG	NA	NA	NA	NA
WP_043652463.1|4753389_4753581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043652465.1|4753609_4754020_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	44.7	9.8e-29
WP_012890909.1|4754592_4756251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012890910.1|4758033_4759386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012890911.1|4759652_4760018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081453168.1|4760084_4760444_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
4773395:4773410	attR	CTGACGGCGCCGGCGG	NA	NA	NA	NA
>prophage 3
NC_013595	Streptosporangium roseum DSM 43021, complete sequence	10341314	4920638	4969378	10341314	integrase,transposase	Bacillus_phage(50.0%)	46	4927352:4927369	4971452:4971469
WP_012891026.1|4920638_4921553_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_148269149.1|4921865_4922063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012891028.1|4922437_4925029_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_174435259.1|4925025_4925727_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.2	2.0e-29
WP_012891030.1|4926113_4927631_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
4927352:4927369	attL	GGGCGCGGTCGGTGGCGG	NA	NA	NA	NA
WP_043652537.1|4927766_4928894_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_012891032.1|4928913_4929600_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_169369332.1|4929661_4930051_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_052317000.1|4930302_4930500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052317001.1|4930658_4932197_-|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	39.2	5.2e-99
WP_043652547.1|4932138_4932636_-	DUF4158 domain-containing protein	NA	A0A125RQ78	Bacillus_phage	38.5	1.3e-14
WP_148269637.1|4933764_4934991_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012891034.1|4935705_4936146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012891035.1|4936285_4937377_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012891036.1|4937509_4938388_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012891037.1|4938490_4939924_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012891038.1|4940022_4940430_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012891039.1|4940479_4941364_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_148269638.1|4941741_4942281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012891041.1|4942466_4943819_+	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_012891042.1|4943875_4945030_+	catalase family protein	NA	NA	NA	NA	NA
WP_012891043.1|4945263_4945941_+	GAP family protein	NA	NA	NA	NA	NA
WP_012891044.1|4946199_4947366_-	MFS transporter	NA	NA	NA	NA	NA
WP_012891045.1|4947659_4948259_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012891046.1|4948554_4949466_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_148269639.1|4949563_4950343_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_148269150.1|4950348_4950567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169369334.1|4950573_4950717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148269640.1|4950774_4951275_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012891050.1|4951395_4954665_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_012891051.1|4954839_4956270_+	adenylosuccinate lyase	NA	NA	NA	NA	NA
WP_081453441.1|4956370_4957057_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_148269151.1|4957126_4958149_+	DUF4037 domain-containing protein	NA	NA	NA	NA	NA
WP_012891054.1|4958363_4959125_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043656299.1|4959301_4959934_-	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	NA	NA	NA	NA
WP_012891057.1|4960136_4960391_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012891058.1|4960652_4961780_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012891059.1|4961877_4962771_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_043652549.1|4962945_4963428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012891061.1|4963645_4964113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081453180.1|4964496_4965000_+	very short patch repair endonuclease	NA	V5UTF4	Oenococcus_phage	35.7	1.2e-07
WP_012891063.1|4965043_4965529_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_012891064.1|4965525_4966152_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_043652552.1|4967385_4967937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012891066.1|4968027_4968255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043652555.1|4968379_4969378_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
4971452:4971469	attR	GGGCGCGGTCGGTGGCGG	NA	NA	NA	NA
>prophage 4
NC_013595	Streptosporangium roseum DSM 43021, complete sequence	10341314	5155795	5280791	10341314	integrase,transposase	Staphylococcus_phage(20.0%)	100	5159252:5159277	5216034:5216059
WP_012891233.1|5155795_5156887_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012891234.1|5157310_5157628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043656397.1|5157806_5158337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012891236.1|5158344_5158935_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
5159252:5159277	attL	GCCCCTGGTGGCGCCGACCCGAGCGG	NA	NA	NA	NA
WP_012891237.1|5159450_5159885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012891238.1|5160118_5160346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043652629.1|5160401_5161298_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_043652633.1|5161820_5162687_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012891241.1|5162952_5166099_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_043652635.1|5166239_5167385_+	serine hydrolase	NA	NA	NA	NA	NA
WP_012891243.1|5167505_5168507_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_012891244.1|5168635_5169322_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_043652649.1|5171026_5172112_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	45.8	1.8e-05
WP_043652655.1|5172198_5173041_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_081453442.1|5173149_5174340_+	MFS transporter	NA	NA	NA	NA	NA
WP_012891249.1|5174603_5175179_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012891250.1|5175175_5175988_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_012891251.1|5176078_5176669_-	DUF1707 domain-containing protein	NA	NA	NA	NA	NA
WP_012891252.1|5177967_5179080_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_148269162.1|5180446_5181259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012891255.1|5181689_5181986_+	DUF4287 domain-containing protein	NA	NA	NA	NA	NA
WP_052317012.1|5182701_5183028_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_012891256.1|5183471_5184068_-	cadmium resistance transporter	NA	NA	NA	NA	NA
WP_012891257.1|5184252_5184645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148269163.1|5185675_5186188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148269164.1|5186324_5187365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012891259.1|5187666_5188110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148269643.1|5188106_5189393_-	MFS transporter	NA	NA	NA	NA	NA
WP_174435299.1|5189778_5190474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012891262.1|5190610_5190982_-	DUF4158 domain-containing protein	NA	A0A125RQ78	Bacillus_phage	39.3	1.1e-15
WP_148269165.1|5191144_5191444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012891264.1|5192009_5193557_-	rifampin monooxygenase	NA	NA	NA	NA	NA
WP_012891265.1|5193696_5194227_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	39.6	8.6e-17
WP_043656418.1|5196851_5197457_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_169369346.1|5197493_5198681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012891268.1|5198819_5199533_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.0	8.2e-31
WP_012891269.1|5199529_5200267_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_043652674.1|5200507_5200717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012891270.1|5200958_5201543_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	36.1	1.2e-22
WP_012891271.1|5201835_5203029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012891272.1|5203474_5204515_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012891273.1|5204725_5205592_-	universal stress protein	NA	NA	NA	NA	NA
WP_012891274.1|5205803_5208260_-	cation-transporting P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	28.9	2.3e-56
WP_052317015.1|5208571_5208940_-|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
WP_012891275.1|5209287_5209962_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_012891276.1|5210080_5211178_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012891278.1|5212815_5213349_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012891279.1|5213345_5214077_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	3.7e-34
WP_012891280.1|5214082_5215873_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_012891281.1|5216084_5217314_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
5216034:5216059	attR	CCGCTCGGGTCGGCGCCACCAGGGGC	NA	NA	NA	NA
WP_012891282.1|5217936_5218548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012891283.1|5218650_5219862_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_012891284.1|5220461_5221343_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_081453443.1|5221329_5222697_-	ATPase	NA	NA	NA	NA	NA
WP_081453444.1|5223421_5223814_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012891288.1|5224043_5225672_+	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_012891289.1|5225668_5226673_+	reductase	NA	NA	NA	NA	NA
WP_012891290.1|5226693_5227839_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_081453445.1|5231800_5232571_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_012891293.1|5232804_5233494_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_169369348.1|5233617_5234133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012891294.1|5234399_5235194_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_012891295.1|5235193_5235904_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	1.9e-11
WP_012891296.1|5235915_5236794_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_012891297.1|5236790_5237837_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_012891298.1|5238000_5239245_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_081453194.1|5239241_5240048_+	creatininase family protein	NA	NA	NA	NA	NA
WP_012891300.1|5240060_5240939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012891301.1|5240938_5241268_+	extradiol ring-cleavage dioxygenase LigAB, LigA subunit	NA	NA	NA	NA	NA
WP_043656439.1|5241320_5242337_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_012891303.1|5242333_5242945_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_012891304.1|5242962_5243811_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_148269166.1|5243943_5244372_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012890197.1|5244595_5246353_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_148269167.1|5246461_5247202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043652687.1|5247327_5250462_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	39.6	1.7e-192
WP_012891307.1|5250831_5251125_-	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_086012369.1|5251306_5252383_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_086012424.1|5252412_5252676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043652693.1|5253067_5254063_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	30.2	5.5e-17
WP_012891311.1|5257031_5263703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043652695.1|5264704_5264914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012891314.1|5265566_5266250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148269168.1|5266246_5266630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012891316.1|5267116_5267494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012891317.1|5267919_5268498_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043652699.1|5268564_5269818_+	MFS transporter	NA	NA	NA	NA	NA
WP_081453195.1|5270736_5271231_+	NPP1 family protein	NA	NA	NA	NA	NA
WP_148269644.1|5271291_5271861_+	VOC family protein	NA	NA	NA	NA	NA
WP_043652709.1|5272745_5273003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081453196.1|5273264_5273525_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_043652712.1|5273543_5274149_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012891322.1|5274148_5275237_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_012891323.1|5275244_5275943_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012891324.1|5275939_5276653_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_012891325.1|5276744_5276945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081453197.1|5277395_5278202_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012891326.1|5279027_5279390_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_012891327.1|5279489_5280149_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_043652720.1|5280164_5280791_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
