The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_013385	Ammonifex degensii KC4, complete sequence	2129237	113409	146833	2129237	tRNA,transposase	Microcystis_virus(22.22%)	31	NA	NA
WP_015738175.1|113409_114060_+|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	40.9	1.4e-32
WP_015738176.1|114028_115621_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_083774210.1|115636_115924_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_015738177.1|115928_116879_+	GPR endopeptidase	NA	NA	NA	NA	NA
WP_015738178.1|116947_117178_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	46.0	1.0e-06
WP_015738179.1|117250_119308_-	ATP-dependent DNA helicase RecG	NA	A0A1V0SBR7	Catovirus	23.1	1.1e-06
WP_049757075.1|119511_122037_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	29.5	6.8e-11
WP_015738181.1|123103_123280_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_015738182.1|123356_123638_+	sporulation protein YqfC	NA	NA	NA	NA	NA
WP_015738175.1|123698_124349_+|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	40.9	1.4e-32
WP_015738183.1|124317_125910_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015738185.1|127148_128108_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	48.3	4.8e-50
WP_169302512.1|128114_130298_+	HDIG domain-containing protein	NA	NA	NA	NA	NA
WP_015738187.1|130218_130668_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_015738188.1|130657_131038_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_015738189.1|131034_131937_+	GTPase Era	NA	NA	NA	NA	NA
WP_015738190.1|131918_132485_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_041458729.1|134565_135219_+	DUF1614 domain-containing protein	NA	NA	NA	NA	NA
WP_015738192.1|135262_135655_+	HIT family protein	NA	NA	NA	NA	NA
WP_015738193.1|135655_136372_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	A0A2P9FI75	Pseudomonas_phage	44.3	4.9e-07
WP_169302513.1|136418_137444_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_015738195.1|137440_138745_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_015738196.1|138758_139778_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_015738197.1|139761_140244_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_015738198.1|140221_140908_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_015738199.1|140904_141375_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_169302580.1|141379_142381_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.1	1.7e-61
WP_015738201.1|142377_142572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015738202.1|142642_143329_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_083774316.1|143508_145152_+|transposase	IS1182-like element ISAmde1 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.1	1.4e-25
WP_015738204.1|145516_146833_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
>prophage 2
NC_013385	Ammonifex degensii KC4, complete sequence	2129237	188416	237862	2129237	protease,coat,integrase,tRNA,transposase	Micromonas_sp._RCC1109_virus(16.67%)	42	186927:186943	202831:202847
186927:186943	attL	AGTGAAGGCCATAGCCG	NA	NA	NA	NA
WP_015738244.1|188416_189571_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_015738245.1|190244_191366_+	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_169302516.1|191480_192506_+	glycoside hydrolase	NA	NA	NA	NA	NA
WP_015738247.1|192582_193692_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	31.2	1.5e-26
WP_015738248.1|193769_194948_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	32.0	1.0e-33
WP_015738249.1|194944_195856_-	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_041458732.1|195981_196407_+	DUF4912 domain-containing protein	NA	NA	NA	NA	NA
WP_015738250.1|196433_199241_+	DUF1957 domain-containing protein	NA	NA	NA	NA	NA
WP_015738251.1|199209_201216_+	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_015738252.1|201234_202287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015738253.1|202288_203098_+	histidinol-phosphatase	NA	NA	NA	NA	NA
202831:202847	attR	AGTGAAGGCCATAGCCG	NA	NA	NA	NA
WP_041458938.1|203210_203666_+	arginine decarboxylase, pyruvoyl-dependent	NA	NA	NA	NA	NA
WP_015738255.1|203686_204520_+	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	32.1	5.5e-18
WP_015738256.1|204523_205396_+	agmatinase	NA	A0A0N9R043	Chrysochromulina_ericina_virus	28.3	7.5e-10
WP_015738257.1|205671_206706_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_015738258.1|206677_207754_-	bis-aminopropyl spermidine synthase family protein	NA	NA	NA	NA	NA
WP_015738259.1|207853_210001_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	37.7	6.7e-76
WP_015738260.1|210020_210449_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_015738261.1|210471_210867_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_169302517.1|210938_211679_+	cell wall hydrolase	NA	Q0H257	Geobacillus_phage	33.7	4.9e-18
WP_015738263.1|211684_211981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015738264.1|211977_212814_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A1V0SCZ1	Indivirus	23.5	2.9e-11
WP_015738265.1|212910_213630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015738266.1|213644_214313_+	LysE family transporter	NA	NA	NA	NA	NA
WP_015738267.1|214328_215684_+	AmmeMemoRadiSam system protein A	NA	NA	NA	NA	NA
WP_015738268.1|215710_216724_+	AmmeMemoRadiSam system radical SAM enzyme	NA	NA	NA	NA	NA
WP_041458939.1|218590_219469_+	branched-chain-amino-acid transaminase	NA	NA	NA	NA	NA
WP_015738270.1|219487_221149_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_015738271.1|221178_222837_+	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	33.2	4.1e-65
WP_015738272.1|222850_223345_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_015738273.1|223371_224364_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_015738274.1|224360_225938_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	39.8	2.8e-07
WP_015738275.1|225944_227210_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_015738276.1|227206_227698_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_015738277.1|227704_229273_+	citramalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	38.9	1.0e-09
WP_015738278.1|229370_230750_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_015738279.1|231009_232830_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q84421	Paramecium_bursaria_Chlorella_virus	39.5	6.6e-109
WP_015738280.1|232852_233455_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_015738281.1|233467_233737_-|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_015738282.1|233733_233979_-|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_015738283.1|235682_236270_+|transposase	IS607 family transposase	transposase	A0A1S5RGS9	Helicobacter_phage	39.1	1.8e-31
WP_015738284.1|236266_237862_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
>prophage 3
NC_013385	Ammonifex degensii KC4, complete sequence	2129237	302512	309103	2129237		Prochlorococcus_phage(33.33%)	6	NA	NA
WP_049757183.1|302512_303061_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.6	1.3e-20
WP_015738348.1|303057_304350_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.0	2.4e-20
WP_015738349.1|304374_305100_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	43.6	9.2e-46
WP_015738350.1|305089_306511_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	36.8	5.8e-60
WP_015738351.1|306514_307555_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	45.2	3.3e-73
WP_015738352.1|307567_309103_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.7	1.3e-68
>prophage 4
NC_013385	Ammonifex degensii KC4, complete sequence	2129237	323205	430556	2129237	tRNA,transposase,integrase	Catovirus(12.5%)	94	408981:409040	437999:438243
WP_015738368.1|323205_324798_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_156779817.1|324808_324949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015738369.1|325043_325364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015738370.1|325430_326543_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_049757082.1|326715_326964_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_156779818.1|326981_327473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015738371.1|327469_327946_+	NAD(P)H-dependent oxidoreductase subunit E	NA	NA	NA	NA	NA
WP_156779910.1|327953_329819_+	SLBB domain-containing protein	NA	NA	NA	NA	NA
WP_041458747.1|329791_330313_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_015738373.1|330340_332821_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_083774318.1|332884_334771_+	anaerobic carbon-monoxide dehydrogenase catalytic subunit	NA	NA	NA	NA	NA
WP_015738375.1|334763_336971_+	CO dehydrogenase/CO-methylating acetyl-CoA synthase complex subunit beta	NA	NA	NA	NA	NA
WP_015738376.1|336992_338333_+	acetyl-CoA decarbonylase/synthase complex subunit gamma	NA	NA	NA	NA	NA
WP_156779819.1|338343_340215_+	DUF4445 domain-containing protein	NA	NA	NA	NA	NA
WP_015738378.1|340221_340974_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_015738379.1|340993_341938_+	acetyl-CoA decarbonylase/synthase complex subunit delta	NA	NA	NA	NA	NA
WP_015738380.1|341950_342745_+	methyltetrahydrofolate cobalamin methyltransferase	NA	NA	NA	NA	NA
WP_015738381.1|342757_345745_+	CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein	NA	NA	NA	NA	NA
WP_015738382.1|345741_346167_+	hydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_015738383.1|346163_346835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015738384.1|346831_347770_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_015738385.1|348758_349556_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_015738386.1|349622_350519_+	dipicolinate synthase subunit DpsA	NA	NA	NA	NA	NA
WP_041458748.1|350524_351139_+	dipicolinate synthase subunit B	NA	NA	NA	NA	NA
WP_015738388.1|351157_352162_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_015738389.1|352185_353073_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_015738390.1|353069_353807_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015738391.1|353803_354565_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.5	5.7e-30
WP_015738392.1|354561_355512_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015738393.1|355600_356698_+	radical SAM protein	NA	NA	NA	NA	NA
WP_156779820.1|356694_357678_-	FprA family A-type flavoprotein	NA	NA	NA	NA	NA
WP_015738394.1|357877_359359_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015738395.1|360703_362296_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_169302521.1|362901_364080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015738397.1|364268_365627_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.3	1.0e-61
WP_015738398.1|365778_367182_-|transposase	ISLre2-like element ISAmde3 family transposase	transposase	NA	NA	NA	NA
WP_041458752.1|367313_367730_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_041458753.1|367751_368027_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015738399.1|369199_369418_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015738400.1|369546_370932_-	MFS transporter	NA	NA	NA	NA	NA
WP_049757085.1|372007_372529_-	UPF0236 family protein	NA	NA	NA	NA	NA
WP_049757086.1|372552_372813_-	UPF0236 family protein	NA	NA	NA	NA	NA
WP_169302522.1|372939_373152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041458755.1|373369_373945_+	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_015738402.1|374066_374996_+	aspartate carbamoyltransferase catalytic subunit	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	36.5	1.4e-33
WP_015738403.1|374992_376303_+	dihydroorotase	NA	NA	NA	NA	NA
WP_015738404.1|376328_377408_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.2	1.1e-55
WP_015738405.1|377413_380641_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_015738406.1|380637_381414_+	dihydroorotate dehydrogenase electron transfer subunit	NA	NA	NA	NA	NA
WP_015738407.1|381410_382337_+	dihydroorotate dehydrogenase	NA	A0A1V0SH91	Hokovirus	28.5	6.5e-12
WP_041458756.1|382333_383074_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_015738409.1|383055_383625_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_015738410.1|383630_386228_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	33.2	1.2e-71
WP_015738411.1|386214_388347_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	40.7	5.0e-15
WP_015738412.1|388351_388798_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_015738413.1|388794_389430_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	33.7	5.6e-23
WP_015738414.1|389431_389914_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_015738415.1|389916_391824_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_015738416.1|391840_393487_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_015738417.1|393450_394581_-	glutamate synthase	NA	NA	NA	NA	NA
WP_015738418.1|394783_396118_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_015738419.1|396213_397494_+	2-hydroxyacyl-CoA dehydratase	NA	NA	NA	NA	NA
WP_015738420.1|397972_399565_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015738421.1|399533_400184_-|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	40.4	1.4e-32
WP_049757088.1|400269_401076_-	chorismate-binding protein	NA	NA	NA	NA	NA
WP_015738423.1|401186_402149_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_015738424.1|402150_402873_+	endonuclease III	NA	G3CB03	Aeropyrum_pernix_spindle-shaped_virus	31.0	7.1e-14
WP_015738425.1|402886_403414_+	macro domain-containing protein	NA	A0A0K1L687	Scale_drop_disease_virus	47.4	7.2e-24
WP_015738426.1|403417_405547_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_015738427.1|405539_406871_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_015738428.1|406893_407952_+	DNA integrity scanning protein DisA	NA	NA	NA	NA	NA
WP_015738429.1|407896_409099_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
408981:409040	attL	ACGGAGCAGCCCATTATGCGGGCTACCTCTTTAGGGCTACAGGTGGTGAGGAGGGAGGCC	NA	NA	NA	NA
WP_015738430.1|409311_409791_+	CarD family transcriptional regulator	NA	NA	NA	NA	NA
WP_015738431.1|409961_411071_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_015738432.1|411057_412221_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_156779911.1|412263_412947_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_041458969.1|412946_414368_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	28.5	2.5e-47
WP_015738435.1|414381_415053_+	FAD-dependent thymidylate synthase	NA	A0A125SJ60	Acidianus_tailed_spindle_virus	42.2	7.2e-37
WP_156779823.1|415042_415810_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_041458758.1|415787_416279_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_156779824.1|416449_417049_+	RNA polymerase sporulation sigma factor SigH	NA	NA	NA	NA	NA
WP_015738439.1|417176_417497_+	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_015738440.1|417897_419100_+	elongation factor Tu	NA	A0A1V0SC62	Catovirus	28.2	1.7e-07
WP_156779825.1|419241_420426_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_015738442.1|420921_421128_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015738443.1|421160_423896_+	DUF3987 domain-containing protein	NA	A0A2H4J8K1	uncultured_Caudovirales_phage	35.5	9.1e-54
WP_015738444.1|423873_424227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015738445.1|424231_424432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015738446.1|424388_424823_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_169302523.1|426090_426261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015738448.1|426462_427113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015738449.1|427270_427504_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015738450.1|427643_428888_+|integrase	site-specific integrase	integrase	A0A023ZX87	Mycobacterium_phage	34.5	3.1e-41
WP_015738451.1|429152_430556_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
437999:438243	attR	GGCCTCCCTCCTCACCACCTGTAGCCCTAAAGAGGTAGCCCGCATAATGGGCTGCTCCGTGCTTTCCCGTGGGATTACCCACCCAAAGATGAAAGCCTTGCTGTGAACGAAACCCTGGCTCAATACATACGGTTTTAAGGATCGGGAGTGGCGTAGATCCGGTAGTCGATATGAGGAAAGATAGGGTGGCGGTACTCCAGCTCCTCAACAAAGTCTGGCTTAAGGCAGTTTCCGGTGATCTGCCG	NA	NA	NA	NA
>prophage 5
NC_013385	Ammonifex degensii KC4, complete sequence	2129237	435866	560782	2129237	tRNA,protease,transposase,integrase	Bacillus_phage(14.29%)	111	437811:437870	499768:499896
WP_015738458.1|435866_437549_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
437811:437870	attL	GATTGTAGAAGGGCCAGAGTTTCGTTCACAGAGGTTTTTGAAGTTGAAGAGCGTATTAAA	NA	NA	NA	NA
WP_015738460.1|438132_439719_-	DUF1957 domain-containing protein	NA	NA	NA	NA	NA
WP_156779912.1|439719_440328_-	DUF4912 domain-containing protein	NA	NA	NA	NA	NA
WP_015738462.1|440563_442516_+	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_015738463.1|442587_443046_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_015738464.1|443050_443788_+	C40 family peptidase	NA	B6V2P9	Bacillus_phage	41.4	6.3e-10
WP_015738465.1|443815_447235_+	DNA polymerase III subunit alpha	NA	A0A291AVG1	Streptomyces_phage	43.0	1.5e-250
WP_041458973.1|447318_447537_+	trp RNA-binding attenuation protein MtrB	NA	NA	NA	NA	NA
WP_015738467.1|447563_447752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041458760.1|447770_448607_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_015738468.1|448625_449597_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_015738469.1|449593_450556_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_015738470.1|450571_452332_+	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	43.3	8.6e-13
WP_015738471.1|452346_452940_+	DedA family protein	NA	NA	NA	NA	NA
WP_015738472.1|452972_455840_+	intein-containing adenosylcobalamin-dependent ribonucleoside-diphosphate reductase	NA	R4T7H5	Halovirus	26.8	1.4e-76
WP_015738473.1|455850_457242_+	Mur ligase family protein	NA	NA	NA	NA	NA
WP_015738474.1|457213_457945_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_015738475.1|457971_458424_-	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	28.2	3.7e-13
WP_015738476.1|458556_459174_+	DUF3786 domain-containing protein	NA	NA	NA	NA	NA
WP_015738477.1|459157_459700_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_015738478.1|459743_461039_-|transposase	transposase	transposase	Q38466	Halobacterium_phage	37.3	1.2e-06
WP_015738479.1|461112_461721_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_015738480.1|461905_462931_+	galactose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_015738481.1|462923_464414_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_015738482.1|464410_466222_-	DUF342 domain-containing protein	NA	NA	NA	NA	NA
WP_015738483.1|466343_467615_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_015738484.1|467549_468434_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_015738485.1|468430_469336_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_041458978.1|469431_470304_-	phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_169302525.1|470612_471719_+	DUF2225 domain-containing protein	NA	NA	NA	NA	NA
WP_015738488.1|471708_473247_+	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_015738489.1|473216_474380_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_015738490.1|474638_475010_+	YlbF family regulator	NA	NA	NA	NA	NA
WP_156779827.1|475118_476831_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_169302526.1|476949_477132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015738492.1|477175_478471_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015738493.1|478702_479236_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_015738494.1|479248_479902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015738495.1|479982_482649_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_015738496.1|482653_483787_+	peptide chain release factor 2	NA	W8EDB3	Pseudomonas_phage	34.9	1.9e-05
WP_156779913.1|483863_484664_+	YitT family protein	NA	NA	NA	NA	NA
WP_015738498.1|484680_485502_+	transketolase	NA	A0A0P0YMZ3	Yellowstone_lake_phycodnavirus	34.7	2.5e-15
WP_015738499.1|485516_486473_+	transketolase family protein	NA	NA	NA	NA	NA
WP_015738500.1|486578_487268_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	37.6	1.8e-30
WP_015738501.1|487257_488148_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015738502.1|488160_489279_+	M23 family metallopeptidase	NA	Q8SBN9	Clostridium_phage	45.1	6.0e-20
WP_156779828.1|489367_490555_+	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	30.3	9.2e-19
WP_015738504.1|490570_491470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156779914.1|491466_492063_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_015738506.1|492254_493388_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	44.4	6.1e-28
WP_015738507.1|493415_495083_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	28.8	1.5e-19
WP_015738508.1|495150_495948_+	glutamate racemase	NA	NA	NA	NA	NA
WP_015738509.1|495958_496939_+	2-hydroxyacyl-CoA dehydratase	NA	NA	NA	NA	NA
WP_015738510.1|497084_498488_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_015738511.1|498546_499698_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_015738512.1|500208_500394_+	EamA family transporter	NA	NA	NA	NA	NA
499768:499896	attR	TTTAATACGCTCTTCAACTTCAAAAACCTCTGTGAACGAAACTCTGGCCCTTCTACAATCCCTAACACGGGGTTAGTTGACACCGCCTTGGCCTTTTGCTAAGATTTAATTTGCAGGTGGTGGATGTAG	NA	NA	NA	NA
WP_015738513.1|500429_501080_+|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	39.6	4.0e-32
WP_015738514.1|501048_502641_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015738515.1|503100_503352_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	41.2	4.3e-11
WP_015738516.1|503987_505289_+	trigger factor	NA	NA	NA	NA	NA
WP_015738517.1|505354_505957_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	53.6	2.8e-56
WP_015738518.1|505968_507231_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	62.3	3.0e-145
WP_049757095.1|507454_508726_-|transposase	transposase	transposase	W0UUA7	Sulfolobus_monocaudavirus	27.7	3.3e-06
WP_015738520.1|508946_510620_+|protease	ATP-dependent protease LonB	protease	A0A076FMQ5	Aureococcus_anophage	41.5	2.5e-09
WP_041458762.1|510732_513114_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.8	1.8e-178
WP_015738522.1|513037_514039_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015738523.1|514167_515550_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.9	1.0e-61
WP_015738524.1|515554_516997_+	phosphoglucosamine mutase	NA	A0A127AWJ1	Bacillus_phage	27.8	8.8e-32
WP_083774320.1|516953_517211_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_015738525.1|517207_517630_+|transposase	IS200/IS605 family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	44.9	2.3e-25
WP_015738526.1|517613_518924_+|transposase	transposase	transposase	W0UUA7	Sulfolobus_monocaudavirus	28.6	3.8e-05
WP_015738527.1|519113_519338_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_015738528.1|519288_519696_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_015738529.1|519638_521102_-	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_015738530.1|521264_521639_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_015738531.1|521607_522087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041458988.1|522122_523271_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_041458763.1|523419_523641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015738533.1|523634_524030_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_015738534.1|524242_525019_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015738535.1|525015_525198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015738536.1|525521_526844_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_049757096.1|526890_528084_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_015738539.1|528359_529763_-|transposase	ISLre2-like element ISAmde4 family transposase	transposase	NA	NA	NA	NA
WP_015738540.1|529905_530730_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_015738541.1|530771_531446_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_015738542.1|531514_534604_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	36.9	6.1e-30
WP_156779829.1|534965_535328_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_015738544.1|535212_535662_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_015738545.1|535814_537167_+	sugar transferase	NA	NA	NA	NA	NA
WP_049757187.1|537263_537587_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_015738547.1|537769_539365_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_015738548.1|539443_539962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083774229.1|540651_542244_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015738551.1|542367_543282_+	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_083774230.1|543560_545441_+	chloride channel protein	NA	NA	NA	NA	NA
WP_015738553.1|545457_546942_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_015738554.1|546938_547211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015738555.1|547601_548015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156779915.1|548054_548933_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_015738557.1|548932_549730_+	TIGR02186 family protein	NA	NA	NA	NA	NA
WP_015738558.1|549899_551735_+	two-component system sensor histidine kinase AtoS	NA	B5LWN8	Feldmannia_species_virus	42.7	5.1e-08
WP_015738559.1|551709_553122_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_041458768.1|553124_553574_+	universal stress protein	NA	NA	NA	NA	NA
WP_083774231.1|553764_554307_+	translation initiation factor IF-3	NA	A0A2I7S9Q1	Vibrio_phage	34.2	9.1e-14
WP_015738562.1|554360_554561_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_015738563.1|554585_554942_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_015738564.1|555020_555821_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_015738565.1|555889_555982_+	YqzL family protein	NA	NA	NA	NA	NA
WP_015738566.1|557359_558382_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.2	3.9e-34
WP_041458769.1|558400_560782_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 7
NC_013385	Ammonifex degensii KC4, complete sequence	2129237	1020397	1030035	2129237	transposase	Bacillus_phage(33.33%)	9	NA	NA
WP_156779928.1|1020397_1022068_-|transposase	IS1182-like element ISAmde1 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.1	1.4e-25
WP_015739016.1|1022320_1024048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015739017.1|1024060_1024300_+	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_015739018.1|1024304_1025039_+	HesA/MoeB/ThiF family protein	NA	A0A1V0SAV8	Catovirus	29.4	1.4e-12
WP_015739019.1|1025035_1026388_-	histone deacetylase	NA	A0A2K9L473	Tupanvirus	39.8	6.6e-29
WP_015739020.1|1026522_1027284_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_015739021.1|1027298_1027994_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	42.9	1.2e-45
WP_015739022.1|1027987_1029244_+	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	41.1	4.1e-41
WP_015739023.1|1029279_1030035_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.9	1.4e-20
>prophage 8
NC_013385	Ammonifex degensii KC4, complete sequence	2129237	1065064	1201735	2129237	tRNA,protease,transposase,integrase	Acinetobacter_phage(13.04%)	120	1187257:1187275	1201800:1201818
WP_015739059.1|1065064_1065727_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_015739060.1|1065772_1066090_-	carbohydrate-binding protein	NA	NA	NA	NA	NA
WP_169302548.1|1066188_1066965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015739062.1|1067646_1068282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015739063.1|1070072_1070324_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015739064.1|1070295_1070706_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_015739066.1|1071077_1071446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156779864.1|1071574_1071745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015739067.1|1071943_1072534_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_169302549.1|1072496_1073432_-	MFS transporter	NA	NA	NA	NA	NA
WP_041458820.1|1074056_1074956_-	UbiA family prenyltransferase	NA	NA	NA	NA	NA
WP_015739069.1|1075860_1076574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015739070.1|1077423_1077927_+	amidase domain-containing protein	NA	NA	NA	NA	NA
WP_015739072.1|1078279_1078498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015739073.1|1078694_1079927_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q38466	Halobacterium_phage	30.3	2.2e-07
WP_041459095.1|1080788_1082081_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.0	1.3e-31
WP_015739075.1|1082286_1083468_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	71.2	1.4e-152
WP_015739076.1|1083460_1083871_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_015739077.1|1083923_1085804_+	protein PrkA	NA	F9VHR5	Thermus_phage	37.0	2.9e-107
WP_041458821.1|1085811_1086933_+	DUF444 family protein	NA	NA	NA	NA	NA
WP_015739079.1|1086929_1087949_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_015739080.1|1088104_1088551_-	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	37.7	2.1e-16
WP_015739081.1|1088708_1089857_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_015739082.1|1089938_1092173_-	hydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_015739083.1|1092179_1093430_-	CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein	NA	NA	NA	NA	NA
WP_015739084.1|1093639_1095547_-	adenylyl-sulfate reductase subunit alpha	NA	NA	NA	NA	NA
WP_015739085.1|1095567_1096011_-	adenylyl-sulfate reductase subunit beta	NA	NA	NA	NA	NA
WP_015739086.1|1096237_1097101_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_015739087.1|1097452_1097854_+|transposase	IS200/IS605 family transposase	transposase	A0A0H3UZM0	Geobacillus_virus	53.4	9.0e-35
WP_015739088.1|1099244_1100642_+	phosphodiester glycosidase family protein	NA	NA	NA	NA	NA
WP_015739089.1|1100942_1101239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015739090.1|1101301_1101721_+	NifB/NifX family molybdenum-iron cluster-binding protein	NA	NA	NA	NA	NA
WP_169302550.1|1101659_1102109_+	dinitrogenase iron-molybdenum cofactor	NA	NA	NA	NA	NA
WP_015739092.1|1102105_1102942_+	P-loop NTPase	NA	NA	NA	NA	NA
WP_015739093.1|1102938_1103781_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_015739094.1|1103825_1104116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015739095.1|1104261_1106385_+	DUF3553 domain-containing protein	NA	A7KV33	Bacillus_phage	39.6	3.3e-120
WP_015739096.1|1106381_1107254_+	DUF2837 family protein	NA	NA	NA	NA	NA
WP_015739097.1|1107308_1109327_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.6	2.1e-132
WP_015739098.1|1109385_1109667_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_015739099.1|1109692_1111162_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_015739100.1|1111158_1112598_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_015739101.1|1112610_1112805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015739102.1|1112833_1113979_+	homocitrate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	36.6	2.7e-07
WP_015739103.1|1113988_1115245_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_015739104.1|1115263_1115764_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_015739105.1|1115771_1116776_+	isocitrate/isopropylmalate dehydrogenase family protein	NA	NA	NA	NA	NA
WP_015739106.1|1116831_1117074_-	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_015739107.1|1117156_1118437_-	AAA-associated domain-containing protein	NA	G3M9Y6	Bacillus_virus	39.1	1.3e-31
WP_015739108.1|1118449_1120168_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_015739109.1|1120544_1121414_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_015739110.1|1121418_1122576_+	DNA polymerase IV	NA	A0A290GHP0	Caldibacillus_phage	30.4	2.5e-21
WP_015739111.1|1122620_1123547_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_015739112.1|1123550_1124237_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_169302551.1|1124632_1124968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015739114.1|1125825_1127421_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_049757129.1|1127651_1128344_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_041459098.1|1128349_1128733_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_015739115.1|1128927_1129143_+	DUF5320 domain-containing protein	NA	NA	NA	NA	NA
WP_015739116.1|1129676_1131002_-|transposase	transposase	transposase	F9VHY8	Thermus_phage	26.1	3.7e-16
WP_015739117.1|1131033_1131723_-|transposase	IS607 family transposase	transposase	A0A125SJ73	Acidianus_tailed_spindle_virus	47.7	1.7e-41
WP_015739118.1|1132268_1132820_+	permease	NA	NA	NA	NA	NA
WP_015739119.1|1132827_1133217_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015739120.1|1133424_1135692_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_015739121.1|1135698_1136361_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_083774262.1|1138814_1139546_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_015739123.1|1139639_1140368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015739124.1|1140485_1141730_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_169302552.1|1141807_1144150_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_015739126.1|1144142_1145000_+	DNRLRE domain-containing protein	NA	NA	NA	NA	NA
WP_015739127.1|1145228_1145882_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015739128.1|1147335_1148631_+|transposase	transposase	transposase	Q38466	Halobacterium_phage	37.3	5.2e-07
WP_015739129.1|1148674_1149049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015739130.1|1149188_1149884_+	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_015739131.1|1150076_1151639_+	exonuclease	NA	NA	NA	NA	NA
WP_015739132.1|1151686_1153156_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.4	6.5e-99
WP_015739133.1|1153264_1154566_+	chromosome segregation ATPase	NA	NA	NA	NA	NA
WP_015739134.1|1154518_1156351_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_015739135.1|1156328_1156595_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_015739136.1|1156675_1158214_+	DUF4445 domain-containing protein	NA	NA	NA	NA	NA
WP_015739137.1|1158220_1158889_+	DUF2225 domain-containing protein	NA	NA	NA	NA	NA
WP_015739138.1|1159033_1160539_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_083774264.1|1160974_1161358_-	zf-TFIIB domain-containing protein	NA	NA	NA	NA	NA
WP_015739140.1|1161474_1162068_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_015739141.1|1162194_1164159_-	bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_015739142.1|1164160_1164739_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_015739143.1|1164738_1165395_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_015739144.1|1165449_1166754_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_015739145.1|1166757_1167861_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_015739146.1|1168191_1169874_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_083774329.1|1170095_1170872_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_015739148.1|1170928_1171945_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_015739149.1|1171948_1173040_-	histidinol-phosphate transaminase	NA	A0A1X7BZP2	Faustovirus	28.9	2.2e-22
WP_015739150.1|1173104_1173902_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_015739151.1|1173898_1175086_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_015739152.1|1175087_1175717_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_015739153.1|1175704_1176505_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	39.8	2.3e-37
WP_015739154.1|1176479_1177526_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	39.8	5.9e-62
WP_015739155.1|1177533_1178115_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	59.8	5.4e-65
WP_015739156.1|1178111_1179569_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_015739157.1|1179862_1181266_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_015739162.1|1185381_1185774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015739163.1|1185878_1186868_-	DUF814 domain-containing protein	NA	NA	NA	NA	NA
WP_041459107.1|1186864_1187326_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
1187257:1187275	attL	CGTGCGGGTTCGACTCCCG	NA	NA	NA	NA
WP_156779867.1|1187478_1188699_+	cobaltochelatase subunit CobN	NA	NA	NA	NA	NA
WP_015739165.1|1190656_1191316_-|transposase	IS607 family transposase	transposase	A0A1V0S8F8	Catovirus	35.4	2.2e-22
WP_049757133.1|1191340_1191571_+	cobaltochelatase subunit CobN	NA	NA	NA	NA	NA
WP_083774266.1|1191592_1192147_+	cobaltochelatase subunit CobN	NA	NA	NA	NA	NA
WP_049757135.1|1193067_1193934_+	cobaltochelatase subunit CobN	NA	NA	NA	NA	NA
WP_015739166.1|1194232_1195162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015739167.1|1195262_1195466_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015739168.1|1195462_1196314_+	bifunctional DNA primase/polymerase	NA	A0A0K1LKD4	Vibrio_phage	38.6	5.8e-31
WP_015739169.1|1196283_1197576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041458826.1|1198182_1198404_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015739170.1|1198379_1198919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015739171.1|1198881_1199187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015739172.1|1199147_1199447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015739173.1|1199717_1200365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015739174.1|1200568_1200784_+	helix-turn-helix transcriptional regulator	NA	A0A2K9V4D5	Faecalibacterium_phage	53.6	2.8e-11
WP_015739175.1|1200799_1201735_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2I6UGM5	Salinibacter_virus	24.6	5.6e-11
1201800:1201818	attR	CGGGAGTCGAACCCGCACG	NA	NA	NA	NA
>prophage 9
NC_013385	Ammonifex degensii KC4, complete sequence	2129237	1938234	1997591	2129237	protease,transposase,integrase	Staphylococcus_phage(28.57%)	59	1938109:1938168	1959908:1960033
1938109:1938168	attL	TGTAGAAGGGCCAGAGTTTCGTTCACAGAGGTTTTTGAAGTTGAAGAGCGTATTAAAGAG	NA	NA	NA	NA
WP_015739890.1|1938234_1939395_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_049757213.1|1939418_1939772_-	arsenate reductase ArsC	NA	NA	NA	NA	NA
WP_015739892.1|1940004_1941312_+|transposase	transposase	transposase	W0UUA7	Sulfolobus_monocaudavirus	29.7	8.3e-05
WP_041458882.1|1941819_1942884_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_015739895.1|1943813_1944254_-	copper chaperone Copz family protein	NA	NA	NA	NA	NA
WP_015739896.1|1944279_1944615_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015739897.1|1944730_1945075_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_015739898.1|1945079_1946390_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_015739899.1|1946386_1947127_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_156779965.1|1947211_1949239_-	DNA translocase FtsK	NA	G1FGP1	Mycobacterium_phage	49.9	1.2e-87
WP_015739901.1|1949414_1950104_-	DUF2344 domain-containing protein	NA	NA	NA	NA	NA
WP_015739902.1|1950075_1951935_-	TIGR03960 family B12-binding radical SAM protein	NA	NA	NA	NA	NA
WP_015739903.1|1951944_1952610_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_015739904.1|1952684_1955123_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	39.7	9.4e-135
WP_015739905.1|1955128_1956199_-	protein arginine kinase	NA	NA	NA	NA	NA
WP_015739906.1|1956173_1956707_-	UvrB/UvrC motif-containing protein	NA	NA	NA	NA	NA
WP_169302574.1|1956732_1957305_-	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015739908.1|1957372_1958149_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_041458883.1|1958111_1958708_+	XTP/dITP diphosphatase	NA	C7C696	Ugandan_cassava_brown_streak_virus	32.5	2.9e-13
WP_015739910.1|1958656_1959841_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_015739911.1|1960271_1960961_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
1959908:1960033	attR	CTCTTTAATACGCTCTTCAACTTCAAAAACCTCTGTGAACGAAACTCTGGCCCTTCTACAAGGAGATTTTGCGCGCACTTTGACTTGCCCCCGACCTTTAGGTATAATGGTATATGACCGTGCGGG	NA	NA	NA	NA
WP_015739912.1|1960960_1961866_+	radical SAM protein	NA	NA	NA	NA	NA
WP_015739913.1|1961862_1962990_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_015739915.1|1964602_1965283_+	cobalt transporter CbiM	NA	NA	NA	NA	NA
WP_015739916.1|1965289_1965607_+	PDGLE domain-containing protein	NA	NA	NA	NA	NA
WP_015739917.1|1965603_1966497_+	cobalt ECF transporter T component CbiQ	NA	NA	NA	NA	NA
WP_015739918.1|1966488_1967550_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_169302575.1|1967750_1969325_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	7.0e-06
WP_015739920.1|1969406_1970252_+	KaiC domain-containing protein	NA	NA	NA	NA	NA
WP_041459238.1|1970248_1970485_-	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
WP_015739922.1|1970525_1972100_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_015739923.1|1972101_1973502_-	phosphoglucomutase/phosphomannomutase family protein	NA	A0A127AWJ1	Bacillus_phage	24.2	9.8e-20
WP_015739924.1|1973518_1974256_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_015739925.1|1974300_1975233_-	SDR family oxidoreductase	NA	A0A1V0SAI6	Catovirus	31.8	1.7e-36
WP_015739926.1|1975235_1976108_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	57.4	1.4e-85
WP_083774339.1|1976153_1977122_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_015739928.1|1977249_1977705_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_015739929.1|1977701_1978958_-	LCP family protein	NA	NA	NA	NA	NA
WP_015739930.1|1979053_1979557_+	DUF4330 domain-containing protein	NA	NA	NA	NA	NA
WP_169302576.1|1979678_1980698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156779896.1|1980759_1982916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015739933.1|1982919_1983939_+	2-hydroxyglutaryl-CoA dehydratase	NA	NA	NA	NA	NA
WP_015739934.1|1983992_1984184_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_015739935.1|1984180_1984645_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	57.7	1.7e-40
WP_015739936.1|1984637_1985873_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	51.1	3.8e-108
WP_015739937.1|1985896_1986547_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.0	1.0e-35
WP_041459240.1|1986547_1987651_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.1	1.5e-47
WP_015739939.1|1987724_1988927_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015739940.1|1988923_1989610_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.9	3.5e-39
WP_015739941.1|1989631_1990921_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_015739942.1|1991040_1991760_-	YIP1 family protein	NA	NA	NA	NA	NA
WP_083774340.1|1991852_1992308_-	SdpI family protein	NA	NA	NA	NA	NA
WP_015739943.1|1992444_1993740_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q38466	Halobacterium_phage	36.4	5.2e-07
WP_156779898.1|1993800_1993977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015739944.1|1993925_1994303_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015739945.1|1994372_1994921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015739946.1|1995206_1995350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156779899.1|1995557_1995968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015739948.1|1996187_1997591_+|transposase	ISLre2-like element ISAmde2 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NC_013385	Ammonifex degensii KC4, complete sequence	2129237	2099215	2106859	2129237	tRNA	Bacillus_phage(14.29%)	9	NA	NA
WP_015740065.1|2099215_2100259_-	DUF348 domain-containing protein	NA	G9B1C7	Bacillus_phage	53.0	4.7e-19
WP_015740066.1|2100444_2100969_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	C7F482	Cyanophage	33.1	5.9e-10
WP_015740067.1|2100961_2101747_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_041459261.1|2101760_2103302_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	37.0	6.4e-97
WP_015740069.1|2103523_2103793_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	63.4	2.9e-21
WP_015740070.1|2103785_2104616_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.4	2.7e-57
WP_015740071.1|2104612_2105299_-	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_015740072.1|2105303_2106266_-	DNA polymerase III subunit delta'	NA	A0A1V0SHJ7	Hokovirus	22.7	8.6e-07
WP_015740073.1|2106250_2106859_-	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	41.8	7.0e-23
