The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_013204	Eggerthella lenta DSM 2243, complete sequence	3632260	911081	919200	3632260	transposase	Prochlorococcus_phage(33.33%)	6	NA	NA
WP_015760116.1|911081_912584_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.2	1.5e-58
WP_049760241.1|912689_913790_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.4	6.2e-62
WP_009306440.1|913794_914415_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.5	6.9e-26
WP_009306439.1|914513_915503_+	XdhC family protein	NA	A0A0P0IKN7	Acinetobacter_phage	27.3	8.8e-07
WP_009306438.1|915670_917245_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	50.8	7.9e-42
WP_009607906.1|917565_919200_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	32.5	1.7e-26
>prophage 2
NC_013204	Eggerthella lenta DSM 2243, complete sequence	3632260	3035385	3061495	3632260	capsid,tail,terminase,portal	Clostridium_phage(11.76%)	39	NA	NA
WP_015761272.1|3035385_3035811_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1U9WS25	Gordonia_phage	41.6	1.5e-08
WP_015761273.1|3035803_3036319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015761274.1|3036366_3036687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015761275.1|3036679_3037735_+	DUF1351 domain-containing protein	NA	NA	NA	NA	NA
WP_015761276.1|3037724_3038258_+	ERF family protein	NA	A0A218ML85	uncultured_virus	36.8	2.4e-11
WP_015761277.1|3038257_3038605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015761278.1|3038601_3039108_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_015761279.1|3039118_3039814_+	conserved phage C-terminal domain-containing protein	NA	X2CYF1	Lactobacillus_phage	52.9	4.7e-07
WP_015761280.1|3039842_3040478_+	ATP-binding protein	NA	C5IHL4	Burkholderia_virus	35.2	7.1e-10
WP_015761281.1|3040470_3041184_+	site-specific DNA-methyltransferase	NA	E1AC06	Pseudoalteromonas_phage	27.8	5.7e-16
WP_015761282.1|3041164_3041962_+	site-specific DNA-methyltransferase	NA	A0A173G9I2	Propionibacterium_phage	51.0	2.0e-62
WP_143924748.1|3041922_3042357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041691666.1|3042344_3042566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114522536.1|3042535_3043024_+	adenine methyltransferase	NA	A0A2H4ERL5	Lactococcus_phage	65.0	1.7e-48
WP_015761286.1|3043020_3043365_+	DUF4406 domain-containing protein	NA	A0A1I9SD28	Arthrobacter_phage	39.8	2.9e-10
WP_015761287.1|3043355_3043631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015761289.1|3043827_3044937_+	RNA-splicing ligase RtcB	NA	H7BVQ6	unidentified_phage	49.7	4.9e-99
WP_015761290.1|3044926_3045121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041691668.1|3045117_3045363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015761291.1|3045359_3045566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015761293.1|3045764_3045953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015761294.1|3045925_3046207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015761295.1|3046345_3048025_+|terminase	phage terminase, large subunit, PBSX family	terminase	B6CXD2	Clostridium_phage	38.3	4.4e-75
WP_015761296.1|3048055_3049459_+|portal	phage portal protein	portal	A0A1B1P863	Bacillus_phage	27.6	2.3e-32
WP_015761297.1|3049458_3050880_+	hypothetical protein	NA	A0A2K9V3K1	Faecalibacterium_phage	29.9	7.4e-23
WP_015761298.1|3050869_3051070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015761299.1|3051253_3051796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015761300.1|3051822_3052716_+	hypothetical protein	NA	A0A2H4JCM6	uncultured_Caudovirales_phage	34.1	2.6e-34
WP_015761301.1|3052728_3052875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015761302.1|3052864_3053224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015761303.1|3053228_3053558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015761304.1|3053558_3053891_+	hypothetical protein	NA	A0A2K9V3E3	Faecalibacterium_phage	39.4	4.7e-05
WP_015761305.1|3053887_3054283_+|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_015761306.1|3054282_3054987_+	Ig-like domain-containing protein	NA	A0A2I7QIP9	Bacillus_phage	42.2	2.3e-17
WP_015761307.1|3055086_3055545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015761308.1|3055516_3056191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015761309.1|3056183_3058601_+|tail	phage tail tape measure protein	tail	A0A0A7RVT5	Clostridium_phage	45.8	2.9e-75
WP_015761310.1|3058600_3059302_+|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_015761311.1|3059302_3061495_+|tail	phage tail protein	tail	I3NL88	Bifidobacterium_phage	36.4	1.5e-83
>prophage 3
NC_013204	Eggerthella lenta DSM 2243, complete sequence	3632260	3368465	3435036	3632260	holin,bacteriocin,transposase,integrase,tRNA	Bacillus_phage(42.86%)	59	3425912:3425931	3439034:3439053
WP_015761447.1|3368465_3369581_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_015761448.1|3369580_3372238_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_041691770.1|3372234_3373452_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	40.2	5.1e-73
WP_009305266.1|3373528_3374179_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015761450.1|3374555_3375332_+	N(G),N(G)-dimethylarginine dimethylaminohydrolase	NA	NA	NA	NA	NA
WP_015761451.1|3375632_3377135_+	amino acid permease	NA	NA	NA	NA	NA
WP_009305269.1|3377288_3377657_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_009305270.1|3377878_3378382_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_009305271.1|3378387_3379086_+	LrgB family protein	NA	NA	NA	NA	NA
WP_015761453.1|3379656_3380829_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_009305273.1|3380938_3381733_-	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_015760409.1|3382023_3382878_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.0	3.2e-45
WP_009305655.1|3382874_3383393_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_009305276.1|3383877_3384396_-	ferritin	NA	NA	NA	NA	NA
WP_015761454.1|3384546_3385743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015761455.1|3385971_3386865_-	polysulfide reductase NrfD	NA	NA	NA	NA	NA
WP_009305279.1|3386871_3387414_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_015761456.1|3387413_3389615_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_009305281.1|3389629_3390364_-	molecular chaperone TorD family protein	NA	NA	NA	NA	NA
WP_009305282.1|3390444_3391206_-	ferredoxin-like protein	NA	NA	NA	NA	NA
WP_009305283.1|3391588_3393718_+	aldehyde ferredoxin oxidoreductase	NA	NA	NA	NA	NA
WP_009305284.1|3393844_3394438_-	iron-sulfur cluster assembly scaffold protein	NA	NA	NA	NA	NA
WP_009608516.1|3394535_3395582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015761458.1|3395729_3397283_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041691771.1|3397406_3398627_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_015761460.1|3398695_3399733_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_015761461.1|3399871_3400783_-	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	26.9	3.8e-12
WP_158539342.1|3400928_3402272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015761463.1|3402485_3404024_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_015761464.1|3404102_3405557_-	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_015761465.1|3405783_3407262_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015761466.1|3407466_3409032_+	flavocytochrome c	NA	M1HTN0	Paramecium_bursaria_Chlorella_virus	27.2	3.7e-23
WP_009305293.1|3409252_3409540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009305294.1|3409965_3410244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009305295.1|3410275_3410698_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_015761467.1|3410702_3411008_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_114522558.1|3411010_3412849_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_057385068.1|3412911_3413148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009608472.1|3413189_3413381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009608429.1|3413490_3414078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015761469.1|3414188_3417836_+	S8 family serine peptidase	NA	A0A127AWU5	Bacillus_phage	36.1	1.4e-17
WP_015761470.1|3417963_3418182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015761471.1|3418240_3419182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009305303.1|3419507_3419768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015761472.1|3419816_3421988_-|bacteriocin	NHLP bacteriocin export ABC transporter permease/ATPase subunit	bacteriocin	F2Y2R6	Organic_Lake_phycodnavirus	29.7	3.5e-16
WP_041691681.1|3422000_3424145_-|bacteriocin	NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit	bacteriocin	W8CYL7	Bacillus_phage	25.6	4.7e-29
WP_009608476.1|3424198_3424708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009305307.1|3424704_3424992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015761474.1|3425362_3425728_-	Nif11-like leader peptide family natural product precursor	NA	NA	NA	NA	NA
WP_009305310.1|3425762_3426068_-	hypothetical protein	NA	NA	NA	NA	NA
3425912:3425931	attL	GCTCGGTGAGCTCGCCTTCC	NA	NA	NA	NA
WP_035578662.1|3426492_3427275_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015761477.1|3427952_3428321_-	Nif11-like leader peptide family natural product precursor	NA	NA	NA	NA	NA
WP_009305314.1|3428333_3428726_-	Nif11-like leader peptide family natural product precursor	NA	NA	NA	NA	NA
WP_015761478.1|3428722_3430150_-	radical SAM protein	NA	NA	NA	NA	NA
WP_009608461.1|3430208_3430556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041691682.1|3430683_3430998_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_114522555.1|3431161_3431380_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_143924750.1|3431539_3432898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009307321.1|3433917_3435036_+|transposase	IS256-like element ISEle1 family transposase	transposase	NA	NA	NA	NA
3439034:3439053	attR	GCTCGGTGAGCTCGCCTTCC	NA	NA	NA	NA
