The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_012881	Desulfovibrio salexigens DSM 2638, complete genome	4289847	453739	518245	4289847	plate,holin	Cronobacter_phage(50.0%)	49	NA	NA
WP_012766014.1|453739_454159_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_012766015.1|454193_455924_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_012766016.1|455887_456928_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_012766017.1|456924_459570_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	29.6	2.1e-95
WP_012766018.1|459591_461901_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_012766019.1|461913_465747_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_012766020.1|465743_466805_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_012766021.1|466957_467581_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_012766022.1|467598_468003_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_012766023.1|468194_468968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012766024.1|469086_470541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157047004.1|470735_471311_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_012766026.1|471314_472694_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_012766027.1|472762_473488_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_012766028.1|473581_477085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012766029.1|477095_477815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041721586.1|478041_479319_-	radical SAM protein	NA	NA	NA	NA	NA
WP_012766031.1|479348_480707_-	nitrogenase	NA	NA	NA	NA	NA
WP_015850325.1|480709_482074_-	nitrogenase iron-molybdenum cofactor biosynthesis protein NifE	NA	NA	NA	NA	NA
WP_015850326.1|482088_482544_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015850327.1|482608_482911_-	(2Fe-2S) ferredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_015850328.1|482927_484058_-	radical SAM protein	NA	NA	NA	NA	NA
WP_015850329.1|484183_485557_-	nitrogenase molybdenum-iron protein subunit beta	NA	NA	NA	NA	NA
WP_015850330.1|485712_487347_-	nitrogenase molybdenum-iron protein alpha chain	NA	NA	NA	NA	NA
WP_015850331.1|487365_487740_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_015850332.1|487741_488089_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_015850333.1|488296_489124_-	nitrogenase iron protein	NA	NA	NA	NA	NA
WP_015850334.1|489449_490556_+	pyruvate carboxyltransferase	NA	NA	NA	NA	NA
WP_015850335.1|490552_491419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015850336.1|491660_492674_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015850337.1|492870_494994_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_015850338.1|495128_496394_+	MFS transporter	NA	NA	NA	NA	NA
WP_015850339.1|496631_499316_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_015850340.1|499428_500250_+	outer membrane lipoprotein-sorting protein	NA	NA	NA	NA	NA
WP_015850341.1|500246_501551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157046909.1|501588_502080_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015850343.1|502151_506135_+	CoA activase	NA	NA	NA	NA	NA
WP_015850344.1|506154_506757_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_015850345.1|506775_507336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157046910.1|507542_508022_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_015850347.1|508152_508374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015850348.1|508455_509211_-	DUF362 domain-containing protein	NA	NA	NA	NA	NA
WP_041722066.1|509408_510227_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015850350.1|510403_510667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015850351.1|510666_511752_-	membrane protein	NA	NA	NA	NA	NA
WP_015850352.1|512506_513121_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_015850353.1|513183_514671_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_015850354.1|514701_517248_+|holin	choline trimethylamine-lyase	holin	A0A2K8HAT8	Bacteriophage	45.8	3.9e-06
WP_015850355.1|517315_518245_+|holin	choline TMA-lyase-activating enzyme	holin	NA	NA	NA	NA
>prophage 2
NC_012881	Desulfovibrio salexigens DSM 2638, complete genome	4289847	706284	717254	4289847	tRNA	Staphylococcus_phage(50.0%)	10	NA	NA
WP_015850535.1|706284_708780_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	46.0	8.0e-206
WP_157046915.1|709033_709495_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_015850537.1|709681_710152_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.7	4.4e-33
WP_015850538.1|710167_711385_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	41.5	3.1e-78
WP_015850539.1|711657_712314_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.4	6.8e-32
WP_041721620.1|712317_713418_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	32.5	8.5e-35
WP_015850541.1|713434_713890_-	cytidine deaminase	NA	S5YN57	Mycobacterium_phage	38.7	2.8e-24
WP_015850542.1|714084_715323_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	52.9	6.1e-98
WP_015850543.1|715664_716903_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_015850544.1|717023_717254_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	35.5	9.4e-05
>prophage 3
NC_012881	Desulfovibrio salexigens DSM 2638, complete genome	4289847	2261924	2387512	4289847	portal,terminase,protease,integrase,holin,tail,plate,tRNA	Vibrio_phage(12.9%)	113	2321306:2321362	2361924:2361980
WP_015851937.1|2261924_2263178_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	55.9	1.8e-129
WP_015851938.1|2263184_2263793_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.9	1.2e-62
WP_015851939.1|2264048_2265356_-	trigger factor	NA	NA	NA	NA	NA
WP_015851940.1|2265661_2265976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015851941.1|2266159_2267155_-	arsenic resistance protein	NA	NA	NA	NA	NA
WP_015851942.1|2267278_2267959_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_015851943.1|2268053_2268641_+	LysE family transporter	NA	NA	NA	NA	NA
WP_015851944.1|2268652_2269438_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_015851945.1|2269438_2269843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157046940.1|2269974_2270409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015851947.1|2270580_2272146_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_015851948.1|2272980_2274396_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_015851949.1|2274379_2276536_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	29.1	7.0e-49
WP_015851950.1|2276622_2278833_-	calcium-binding protein	NA	NA	NA	NA	NA
WP_015851951.1|2278874_2280323_-	calcium-binding protein	NA	NA	NA	NA	NA
WP_015851952.1|2280799_2282728_-	calcium-binding protein	NA	NA	NA	NA	NA
WP_015851953.1|2283945_2285283_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_015851954.1|2285272_2286904_-	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	26.2	2.2e-10
WP_015851955.1|2286927_2288490_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_157046941.1|2288539_2290057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015851957.1|2290205_2290961_+	DUF3450 domain-containing protein	NA	NA	NA	NA	NA
WP_015851958.1|2290957_2292382_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_015851959.1|2292368_2292998_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_015851960.1|2293002_2293413_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_015851961.1|2293412_2294075_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_081434590.1|2294035_2295235_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_015851963.1|2295472_2296465_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015851964.1|2296568_2297984_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_015851965.1|2297976_2299866_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_015851966.1|2300324_2300726_+	heme-binding protein	NA	NA	NA	NA	NA
WP_015851967.1|2300752_2303143_+	glycyl radical protein	NA	A0A2C9CWX5	Yersinia_phage	51.9	1.7e-08
WP_015851968.1|2303264_2304227_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_157046942.1|2304335_2306864_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_015851970.1|2307133_2307547_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_015851971.1|2307546_2308017_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_015851972.1|2308490_2308892_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_015851973.1|2309050_2309704_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	42.2	9.5e-42
WP_015851974.1|2310140_2312126_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_015851975.1|2312192_2312744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015851977.1|2313526_2314942_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_015851978.1|2315337_2315607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015851979.1|2315791_2316352_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_157046943.1|2317101_2318349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015851981.1|2318410_2319514_+	peptidase C14 caspase catalytic subunit p20	NA	NA	NA	NA	NA
WP_015851982.1|2319529_2321188_-	hypothetical protein	NA	NA	NA	NA	NA
2321306:2321362	attL	CTGGCGGAGAGGAGAGGATTTGAACCTCCGATAGCGTTAACTATACACGCTTTCCAG	NA	NA	NA	NA
WP_015851983.1|2321674_2322475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015851984.1|2322474_2322906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015851986.1|2323336_2324281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015851987.1|2324342_2325332_-	late control D family protein	NA	V5YTN9	Pseudomonas_phage	42.7	1.2e-67
WP_015851988.1|2325322_2325526_-|tail	tail protein	tail	R9TR63	Vibrio_phage	53.1	3.7e-13
WP_015851989.1|2325522_2325903_-|tail	phage tail protein	tail	D5LGY3	Escherichia_phage	41.0	4.0e-24
WP_015851990.1|2325914_2327927_-	hypothetical protein	NA	R9TRP8	Vibrio_phage	28.2	3.6e-39
WP_015851991.1|2328053_2328293_-|tail	phage tail assembly protein	tail	A0A193GYZ8	Enterobacter_phage	41.9	4.3e-08
WP_015851992.1|2328296_2328806_-|tail	phage major tail tube protein	tail	A0A088FRU2	Escherichia_phage	51.2	1.3e-41
WP_015851993.1|2328806_2329997_-|tail	tail protein	tail	D5LGY7	Escherichia_phage	55.0	2.9e-137
WP_015851994.1|2330006_2330303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015851995.1|2330306_2333096_-	hypothetical protein	NA	A0A0C5AEQ0	Bacteriophage	31.9	8.8e-12
WP_015851996.1|2333097_2333790_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	47.0	2.7e-31
WP_015851997.1|2333789_2334668_-|plate	baseplate J family protein	plate	V9IQV9	Stenotrophomonas_phage	46.5	2.2e-62
WP_015851998.1|2334664_2335006_-|plate	phage baseplate protein	plate	V5YTB2	Pseudomonas_phage	53.6	3.7e-29
WP_015851999.1|2335002_2335806_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	47.2	9.0e-26
WP_015852000.1|2335783_2336353_-	hypothetical protein	NA	Q8H9N6	Vibrio_phage	35.4	2.4e-17
WP_015852001.1|2336334_2336853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015852002.1|2336853_2337159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157046944.1|2337155_2337449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015852004.1|2337372_2337858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015852005.1|2337854_2338295_-	N-acetylmuramyl-L-alanine amidase, negative regulator of AmpC, AmpD	NA	D6QWP6	uncultured_phage	33.1	3.5e-16
WP_081434591.1|2338137_2338737_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_015852006.1|2338753_2339077_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_015852007.1|2339089_2341192_-	hypothetical protein	NA	K7PGT6	Enterobacteria_phage	30.6	4.1e-46
WP_015852008.1|2341184_2342648_-|portal	phage portal protein	portal	R9TNK3	Vibrio_phage	25.0	2.2e-30
WP_015852009.1|2342644_2342848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015852010.1|2343006_2344281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015852011.1|2344423_2344621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015852012.1|2344782_2345022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015852013.1|2345266_2346562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015852014.1|2346657_2347161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015852015.1|2347203_2347857_-	hypothetical protein	NA	A0A0U4J8W4	Pseudomonas_phage	38.9	4.7e-33
WP_015852016.1|2347967_2348489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015852017.1|2348915_2349140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015852018.1|2349141_2351103_-|terminase	terminase GpA	terminase	A0A2K9V301	Faecalibacterium_phage	31.2	2.0e-66
WP_015852019.1|2351092_2351650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015852020.1|2351751_2352186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015852021.1|2352593_2354960_-	toprim domain-containing protein	NA	A0A1U9ZA69	Proteus_phage	27.0	4.5e-33
WP_015852022.1|2354962_2355430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015852023.1|2355601_2355958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157046945.1|2355962_2356283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015852025.1|2356768_2357296_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015852026.1|2357386_2358085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015852027.1|2358126_2359212_-	hypothetical protein	NA	A0A1S5SAB0	Streptococcus_phage	34.6	9.2e-50
WP_015852028.1|2359438_2359930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041721824.1|2359934_2360195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081434592.1|2360414_2361506_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_015852031.1|2362108_2363026_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
2361924:2361980	attR	CTGGCGGAGAGGAGAGGATTTGAACCTCCGATAGCGTTAACTATACACGCTTTCCAG	NA	NA	NA	NA
WP_015852032.1|2363029_2363824_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_015852033.1|2363880_2365857_+	peptidase U32	NA	Q6DW11	Phage_TP	38.3	7.9e-15
WP_015852034.1|2365915_2366800_-	helix-turn-helix transcriptional regulator	NA	Q6J1W4	Lactobacillus_phage	36.1	5.6e-05
WP_015852035.1|2367172_2368192_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015852036.1|2368318_2368837_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_015852037.1|2368857_2370135_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_157047026.1|2370161_2371484_+	hydantoinase/carbamoylase family amidase	NA	NA	NA	NA	NA
WP_015852039.1|2371480_2372524_+	dihydroorotase	NA	NA	NA	NA	NA
WP_015852040.1|2372591_2373287_+	orotate phosphoribosyltransferase	NA	Q58MW1	Prochlorococcus_phage	29.4	1.2e-07
WP_015852041.1|2373334_2375506_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_015852042.1|2375686_2378098_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_015852043.1|2378110_2378641_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_041722234.1|2378665_2380057_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.4	1.8e-50
WP_015852045.1|2380220_2383454_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_015852046.1|2383625_2383898_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_015852047.1|2383942_2384209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015852048.1|2384264_2384498_+	SlyX family protein	NA	NA	NA	NA	NA
WP_015852049.1|2384548_2385484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015852050.1|2385571_2387512_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	36.1	3.4e-87
