The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_012803	Micrococcus luteus NCTC 2665, complete sequence	2501097	31065	59094	2501097	transposase	Corynebacterium_phage(50.0%)	20	NA	NA
WP_010078638.1|31065_32319_+|transposase	IS256-like element ISMlu1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.2	6.8e-81
WP_010079746.1|32351_33143_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_168104827.1|33373_34237_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010079744.1|34558_35776_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012750668.1|35772_36873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012750669.1|37024_37624_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012750670.1|37813_39064_+	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_041779793.1|39110_42644_+	relaxase domain-containing protein	NA	V5UQN3	Mycobacterium_phage	24.3	8.5e-36
WP_012750672.1|42701_43832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144407139.1|43878_44520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012750674.1|44714_45239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010078638.1|45255_46509_-|transposase	IS256-like element ISMlu1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.2	6.8e-81
WP_144407140.1|46588_46942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010078638.1|47075_48329_+|transposase	IS256-like element ISMlu1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.2	6.8e-81
WP_111763571.1|48389_51149_-	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_082229693.1|51200_52334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010079362.1|52330_53593_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_111763551.1|54460_54715_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_111763566.1|55437_56640_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	1.6e-31
WP_012750681.1|57786_59094_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	71.1	2.2e-178
>prophage 2
NC_012803	Micrococcus luteus NCTC 2665, complete sequence	2501097	333350	371182	2501097	tRNA,transposase	Corynebacterium_phage(33.33%)	31	NA	NA
WP_012750723.1|333350_334676_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	33.4	4.7e-56
WP_012750724.1|334855_335383_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_010078638.1|335660_336914_+|transposase	IS256-like element ISMlu1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.2	6.8e-81
WP_012750725.1|336946_337450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160113777.1|337449_339288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010079362.1|339226_340489_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_041779771.1|340501_342127_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_012750726.1|342327_343290_-	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_012750727.1|343370_344165_-	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_041779772.1|344291_345299_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_012750729.1|345360_345933_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010079502.1|346050_346965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010079501.1|346952_347492_-	NUDIX hydrolase family protein	NA	NA	NA	NA	NA
WP_010079500.1|347548_348676_-	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_010079499.1|348801_349125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012750730.1|349137_351471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010079496.1|351473_352079_-	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_010079495.1|352075_353122_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_010079494.1|353168_354419_-	NTP transferase domain-containing protein	NA	A0A291LA53	Escherichia_phage	24.7	8.0e-05
WP_010079493.1|354495_355437_-	formamidopyrimidine-DNA glycosylase	NA	NA	NA	NA	NA
WP_010079492.1|355451_355964_-	VOC family protein	NA	NA	NA	NA	NA
WP_029248257.1|361126_361585_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_010079488.1|361690_362758_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010079487.1|362989_363496_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_010079486.1|363579_364215_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_010079485.1|364689_365478_+	winged helix-turn-helix transcriptional regulator	NA	W8CYM9	Bacillus_phage	41.6	4.9e-08
WP_010079484.1|365548_366073_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_010079483.1|366470_368315_+	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_010079482.1|368571_368811_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012750732.1|368835_370089_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.2	3.1e-81
WP_010079480.1|370300_371182_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	30.2	1.1e-27
>prophage 3
NC_012803	Micrococcus luteus NCTC 2665, complete sequence	2501097	704293	765891	2501097	protease,holin,transposase,tRNA,integrase	uncultured_virus(14.29%)	55	707382:707398	718312:718328
WP_010079186.1|704293_705637_+|transposase	IS256-like element ISMlu11 family transposase	transposase	A0A218MNI5	uncultured_virus	37.6	2.5e-36
WP_010079185.1|705670_707173_+	conjugal transfer protein TraC	NA	NA	NA	NA	NA
WP_010079184.1|707172_709077_+	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
707382:707398	attL	CGCGTTCGGGGCCACCG	NA	NA	NA	NA
WP_010079183.1|709081_709462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010079181.1|709730_710579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010079180.1|710575_710953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010079173.1|714742_715681_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A220NQQ9	Corynebacterium_phage	32.5	2.7e-13
WP_041779801.1|715872_717153_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_174260671.1|717101_717503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010079170.1|718099_718945_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
718312:718328	attR	CGGTGGCCCCGAACGCG	NA	NA	NA	NA
WP_029248231.1|719032_719695_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_174260683.1|719817_720699_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	48.4	5.0e-62
WP_010079167.1|720695_721766_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_010079166.1|721846_722680_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	45.8	3.1e-61
WP_010079165.1|722812_723736_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_012750785.1|723877_724384_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_010079162.1|724508_725729_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_041779776.1|725909_726794_-	peptidoglycan endopeptidase	NA	C1KFN7	Lactobacillus_virus	38.1	1.5e-13
WP_010079160.1|727106_728303_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_010079159.1|728238_728913_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_010079158.1|729317_730175_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_010079157.1|730278_731115_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_029248229.1|731322_732090_+	UMP kinase	NA	NA	NA	NA	NA
WP_010079155.1|732143_732701_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_010079154.1|732726_733563_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_010079153.1|733612_734212_+	DivIVA domain-containing protein	NA	NA	NA	NA	NA
WP_010079152.1|734367_735522_+	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_043055195.1|735530_736586_+	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_012750788.1|736582_738022_+	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_010079148.1|738130_738649_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010079147.1|738707_739355_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010079146.1|739468_741085_+	acetyl-CoA carboxylase subunit beta	NA	A0A1B2ITV7	Pike_perch_iridovirus	62.5	2.4e-17
WP_029248227.1|741122_743222_+	acetyl-CoA carboxylase	NA	NA	NA	NA	NA
WP_012750789.1|743237_744425_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010079143.1|744426_744957_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_010079142.1|744953_745832_+	CoA ester lyase	NA	NA	NA	NA	NA
WP_010079141.1|746033_746408_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_010079140.1|746404_748027_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_043055197.1|748166_749402_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_010079138.1|749398_750766_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_065423801.1|750871_752056_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_010079136.1|752030_752963_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010079135.1|753085_754912_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_174260672.1|754955_755705_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_010079133.1|755834_756422_+	ribosome assembly cofactor RimP	NA	NA	NA	NA	NA
WP_012750790.1|756423_757410_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_010079132.1|757452_757794_+	YlxR family protein	NA	NA	NA	NA	NA
WP_012750791.1|757986_760779_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	29.5	1.8e-20
WP_010079129.1|760859_761306_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_080555869.1|761319_762285_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_010079127.1|762281_762650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010079126.1|762661_763093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010079125.1|763092_764070_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_010079124.1|764066_764909_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010079123.1|764886_765891_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 4
NC_012803	Micrococcus luteus NCTC 2665, complete sequence	2501097	1037859	1106355	2501097	integrase,protease,tRNA,transposase	Tupanvirus(18.75%)	54	1030858:1030878	1060401:1060421
1030858:1030878	attL	AGAAGGCCCTCGACGCCCTGC	NA	NA	NA	NA
WP_010078872.1|1037859_1039050_-|integrase	site-specific integrase	integrase	A0A1B3AYT2	Gordonia_phage	35.4	3.2e-43
WP_010078871.1|1039340_1039967_-	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	27.7	3.7e-11
WP_010078870.1|1040057_1041713_+	polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB	NA	NA	NA	NA	NA
WP_010078869.1|1041709_1043437_+	polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB	NA	NA	NA	NA	NA
WP_010078868.1|1043433_1044819_+	DUF2029 domain-containing protein	NA	NA	NA	NA	NA
WP_010078867.1|1044855_1046301_-	DUF2079 domain-containing protein	NA	NA	NA	NA	NA
WP_010078866.1|1046689_1047241_+	single-stranded DNA-binding protein	NA	A0A222ZFS3	Arthrobacter_phage	36.0	8.3e-15
WP_010078865.1|1047339_1049022_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	28.5	5.3e-44
WP_010078864.1|1049208_1050228_-	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_010078863.1|1050306_1051017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010078862.1|1051054_1052128_-	OsmC family protein	NA	NA	NA	NA	NA
WP_010078861.1|1052919_1053432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012750838.1|1053592_1056199_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	27.2	7.6e-42
WP_010078860.1|1056374_1056848_+	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_010078858.1|1057782_1058610_-	DUF1345 domain-containing protein	NA	NA	NA	NA	NA
WP_010078857.1|1058877_1059771_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010078856.1|1059970_1061335_+	trigger factor	NA	NA	NA	NA	NA
1060401:1060421	attR	AGAAGGCCCTCGACGCCCTGC	NA	NA	NA	NA
WP_174260673.1|1061602_1062217_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	48.9	1.2e-41
WP_002855988.1|1062258_1062924_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	46.9	6.5e-38
WP_012750840.1|1063098_1064397_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.5	1.4e-132
WP_010078853.1|1064459_1065077_+	DsbA family protein	NA	NA	NA	NA	NA
WP_010078852.1|1065162_1065498_-	membrane protein	NA	NA	NA	NA	NA
WP_010078851.1|1065860_1068545_-|tRNA	valine--tRNA ligase	tRNA	A0A2K9KZB8	Tupanvirus	37.4	3.4e-162
WP_010078850.1|1068684_1069479_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012750841.1|1069522_1070272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010078848.1|1070390_1072106_+	nitrite/sulfite reductase	NA	NA	NA	NA	NA
WP_010078847.1|1072102_1072828_+	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
WP_010078846.1|1072860_1073796_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_010078845.1|1073795_1075136_+	sulfate adenylyltransferase	NA	A0A1V0SGC3	Hokovirus	25.8	6.3e-24
WP_010078844.1|1075167_1075893_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	2.6e-24
WP_010078843.1|1075882_1076806_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_010078842.1|1076802_1078071_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_012750842.1|1078067_1079498_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010078840.1|1079578_1080214_+	TIGR03085 family protein	NA	NA	NA	NA	NA
WP_010078839.1|1080492_1083909_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	32.9	5.3e-152
WP_012750843.1|1083908_1085462_+	dihydrofolate synthase	NA	NA	NA	NA	NA
WP_012750844.1|1085458_1085959_+	DUF4233 domain-containing protein	NA	NA	NA	NA	NA
WP_012750845.1|1086034_1086457_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	48.5	8.6e-28
WP_012750846.1|1086501_1087161_-	vitamin K epoxide reductase family protein	NA	NA	NA	NA	NA
WP_041779780.1|1087429_1090834_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_002853919.1|1091065_1091371_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_002853915.1|1091422_1091680_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_012750848.1|1091849_1093397_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_012750849.1|1093400_1094606_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.5	3.5e-58
WP_010078834.1|1094678_1096028_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.8	2.5e-89
WP_010078833.1|1096107_1096329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010078832.1|1096403_1097051_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_002853902.1|1097047_1097473_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_010078831.1|1097486_1098152_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_155116183.1|1098476_1099061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010079362.1|1102691_1103954_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_162497514.1|1103892_1104276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010078826.1|1104849_1104996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012750851.1|1105101_1106355_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.2	8.9e-81
>prophage 5
NC_012803	Micrococcus luteus NCTC 2665, complete sequence	2501097	1123940	1134748	2501097	transposase	Corynebacterium_phage(25.0%)	9	NA	NA
WP_010078807.1|1123940_1125284_-|transposase	IS256-like element ISMlu11 family transposase	transposase	A0A218MNI5	uncultured_virus	38.1	1.4e-36
WP_012750854.1|1125417_1126686_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	74.2	2.3e-177
WP_012750855.1|1126800_1127253_-	DUF1931 family protein	NA	NA	NA	NA	NA
WP_012750854.1|1127366_1128635_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	74.2	2.3e-177
WP_010078804.1|1129139_1129385_+	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	54.3	1.8e-17
WP_010078803.1|1129396_1129864_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	31.7	4.4e-09
WP_012750856.1|1129860_1132038_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	52.8	2.0e-208
WP_010078801.1|1132296_1133268_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	74.9	2.3e-137
WP_012750857.1|1133707_1134748_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.0	2.4e-31
>prophage 6
NC_012803	Micrococcus luteus NCTC 2665, complete sequence	2501097	2199531	2253234	2501097	integrase,transposase	Corynebacterium_phage(30.0%)	51	2197685:2197702	2252535:2252552
2197685:2197702	attL	GGACGAGTGGCAGGAGCC	NA	NA	NA	NA
WP_012750681.1|2199531_2200839_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	71.1	2.2e-178
WP_169577800.1|2202630_2203170_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010080079.1|2203228_2204656_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	40.7	4.3e-87
WP_010080078.1|2204694_2205876_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_010080077.1|2205933_2206845_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_010080076.1|2206870_2207863_+	TRIC cation channel family protein	NA	NA	NA	NA	NA
WP_029248293.1|2207889_2209404_+	DUF1846 family protein	NA	NA	NA	NA	NA
WP_010080074.1|2209737_2210685_+	DNA (cytosine-5-)-methyltransferase	NA	A0A2I7RTK8	Vibrio_phage	36.6	2.8e-34
WP_010080073.1|2210728_2211256_-	HNH endonuclease	NA	A0A2P0QEG9	Haloarcula_hispanica_pleomorphic_virus	48.1	5.3e-11
WP_010080072.1|2213759_2214632_-	CoA transferase	NA	NA	NA	NA	NA
WP_010080071.1|2214884_2215451_+	DinB family protein	NA	NA	NA	NA	NA
WP_010080070.1|2215544_2218076_+	HAD-IC family P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	25.8	3.2e-21
WP_010080069.1|2218082_2218238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010079481.1|2218703_2219957_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.2	3.1e-81
WP_010080066.1|2220296_2220749_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_010080065.1|2220892_2221492_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010080064.1|2221472_2221865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010080063.1|2221985_2222621_-	cobalt transporter	NA	NA	NA	NA	NA
WP_010080062.1|2222620_2223382_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_010080061.1|2223378_2224044_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_010079590.1|2225369_2226623_+|transposase	IS256-like element ISMlu1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.2	6.8e-81
WP_010080056.1|2227409_2227775_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012751102.1|2227896_2228949_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_002855764.1|2228972_2229401_+	low molecular weight phosphatase family protein	NA	NA	NA	NA	NA
WP_010080054.1|2229429_2230767_+	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_010080053.1|2230865_2231225_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010080052.1|2231221_2231824_+	cadmium resistance transporter	NA	NA	NA	NA	NA
WP_010080051.1|2232195_2233065_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_010080050.1|2233431_2233821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012751103.1|2233820_2235101_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_080555890.1|2235292_2236366_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A220NQQ9	Corynebacterium_phage	32.5	3.1e-13
WP_010080047.1|2236479_2237235_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_174260677.1|2237231_2237732_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_010080043.1|2238867_2239938_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012751104.1|2239962_2240838_-	ArgP/LysG family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_010080041.1|2240909_2241524_+	amino acid transporter	NA	NA	NA	NA	NA
WP_012751105.1|2241561_2242074_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010080039.1|2242149_2242491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010080038.1|2242686_2243718_-	methionine synthase	NA	NA	NA	NA	NA
WP_012751106.1|2243714_2244761_-	DUF1852 domain-containing protein	NA	NA	NA	NA	NA
WP_010080036.1|2244757_2246062_-	cystathionine gamma-synthase	NA	A0A0B5JD48	Pandoravirus	30.0	2.3e-18
WP_010080035.1|2246063_2247413_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_010080034.1|2247709_2248438_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_080555889.1|2248576_2249761_+	MFS transporter	NA	NA	NA	NA	NA
WP_010080032.1|2249806_2250220_+	VOC family protein	NA	NA	NA	NA	NA
WP_012751107.1|2250267_2250780_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010080030.1|2250992_2251205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010080029.1|2251261_2251585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010080028.1|2251563_2251860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010080027.1|2251870_2252284_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_010080025.1|2252919_2253234_+|transposase	transposase	transposase	Q9ETV7	Enterobacteria_phage	45.0	6.4e-12
2252535:2252552	attR	GGCTCCTGCCACTCGTCC	NA	NA	NA	NA
