The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_012913	Aggregatibacter aphrophilus NJ8700, complete sequence	2313035	467872	511613	2313035	integrase,head,protease,tRNA,portal,capsid,terminase,tail	Mannheimia_phage(25.71%)	64	478617:478636	514477:514496
WP_005700197.1|467872_469183_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_005700198.1|469227_470085_-	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_005700199.1|470147_471101_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_005700200.1|471668_472631_-	hypothetical protein	NA	K4F6D5	Cronobacter_phage	43.2	3.6e-29
WP_044055203.1|472825_473011_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_044055294.1|473025_473214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080987744.1|473435_473618_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_012771319.1|473723_473957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012771320.1|473958_474300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012771321.1|474357_475152_-	DUF2303 family protein	NA	NA	NA	NA	NA
WP_012771322.1|475220_475580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044055205.1|475659_476073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012771324.1|476075_476687_-	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	72.3	3.9e-82
WP_012771325.1|476683_477466_-	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	59.5	6.0e-83
WP_012771326.1|477472_478435_-	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	47.3	1.1e-59
WP_012771327.1|478437_478602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012771328.1|478579_478861_-	hypothetical protein	NA	Q776W5	Haemophilus_phage	42.9	2.9e-08
478617:478636	attL	AAAAGTGCGGTGGTTTTTCG	NA	NA	NA	NA
WP_044055207.1|479706_480231_+	hypothetical protein	NA	Q7Y5W8	Haemophilus_phage	68.8	3.1e-59
WP_012771330.1|480324_480537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012771331.1|480914_481334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012771332.1|481323_481797_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_044055208.1|481808_482063_-	type II toxin-antitoxin system HicA family toxin	NA	K7PH44	Enterobacterial_phage	42.9	8.3e-10
WP_012771333.1|482216_482912_-	helix-turn-helix transcriptional regulator	NA	Q7Y5W5	Haemophilus_phage	64.0	4.3e-77
WP_012771334.1|483030_483243_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	52.2	5.6e-12
WP_012771335.1|483291_483735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012771336.1|483786_484494_+	phage regulatory protein/antirepressor Ant	NA	D0UIL6	Aggregatibacter_phage	99.6	6.9e-131
WP_012771337.1|484490_485216_+	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	83.6	1.5e-96
WP_012771338.1|485212_485857_+	replication P	NA	D0UIL4	Aggregatibacter_phage	43.8	6.9e-37
WP_012771339.1|485853_486372_+	DNA N-6-adenine-methyltransferase	NA	D0UIL3	Aggregatibacter_phage	81.2	1.7e-78
WP_012771340.1|486341_486977_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	27.4	5.4e-18
WP_044055209.1|487043_487328_+	DUF1364 domain-containing protein	NA	A0A0M3LQ97	Mannheimia_phage	75.6	3.5e-33
WP_006718646.1|487324_487687_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	49.2	6.0e-30
WP_012771342.1|487679_488186_+	antitermination protein	NA	K7PHU3	Enterobacteria_phage	32.0	4.2e-13
WP_148207219.1|488343_488565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044055211.1|488561_489104_+	lysozyme	NA	I6PBN2	Cronobacter_phage	50.6	1.3e-36
WP_012771345.1|489055_489226_+	DUF2570 family protein	NA	NA	NA	NA	NA
WP_049756018.1|489301_489583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044055212.1|489624_489936_+	HNH endonuclease	NA	B5WZZ4	Pseudomonas_phage	51.7	2.4e-19
WP_012771347.1|490043_490508_+	hypothetical protein	NA	Q77WA1	Escherichia_phage	43.0	8.3e-16
WP_012771348.1|490507_492019_+|terminase	terminase large subunit	terminase	K7PLY2	Enterobacterial_phage	66.6	1.3e-190
WP_012771349.1|492015_493254_+|portal	phage portal protein	portal	A0A0R6PDY3	Moraxella_phage	66.8	5.2e-150
WP_012771350.1|493243_493903_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0R6PFZ5	Moraxella_phage	63.4	1.4e-72
WP_012771351.1|493904_495098_+|capsid	phage major capsid protein	capsid	A0A0R6PKI4	Moraxella_phage	66.8	2.4e-139
WP_044055213.1|495144_495459_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	38.8	2.4e-14
WP_044055215.1|495458_495782_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	47.2	2.6e-16
WP_012771353.1|495774_496257_+	HK97 gp10 family phage protein	NA	A0A220NRP5	Escherichia_phage	31.5	8.9e-13
WP_012771354.1|496258_496603_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_012771355.1|496606_497263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012771356.1|497324_497732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044055217.1|497776_498001_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_044055296.1|498086_498509_+	membrane lipoprotein lipid attachment site-containing protein	NA	NA	NA	NA	NA
WP_012771359.1|498600_498792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012771360.1|498850_502183_+	tape measure protein	NA	A0A2P1CKJ3	Pantoea_phage	22.6	1.3e-30
WP_012771361.1|502198_502534_+|tail	phage tail protein	tail	A0A1W6JNT2	Morganella_phage	36.7	3.6e-13
WP_012771362.1|502533_503268_+|tail	phage minor tail protein L	tail	A0A0M3LSQ5	Mannheimia_phage	55.1	1.5e-72
WP_012771363.1|503270_504032_+	C40 family peptidase	NA	S5MQI8	Escherichia_phage	45.3	3.5e-56
WP_012771364.1|504055_504577_+|tail	tail assembly protein	tail	NA	NA	NA	NA
WP_049756019.1|504580_507925_+	host specificity protein J	NA	A0A0M3LR06	Mannheimia_phage	51.5	6.0e-257
WP_049756020.1|507925_508468_+	hypothetical protein	NA	A0A0M3LQG1	Mannheimia_phage	70.0	2.0e-16
WP_044055218.1|508467_508842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012771365.1|508807_509698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012771366.1|509767_510061_+	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	75.3	1.0e-35
WP_044055219.1|510088_510271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012771367.1|510413_511613_-|integrase	site-specific integrase	integrase	G9L697	Escherichia_phage	57.3	2.6e-130
514477:514496	attR	AAAAGTGCGGTGGTTTTTCG	NA	NA	NA	NA
>prophage 2
NC_012913	Aggregatibacter aphrophilus NJ8700, complete sequence	2313035	1786784	1856250	2313035	plate,tRNA,protease,integrase	Staphylococcus_phage(15.38%)	59	1778260:1778279	1857387:1857406
1778260:1778279	attL	TAAAAAAACGACCGCACTTT	NA	NA	NA	NA
WP_005702062.1|1786784_1787219_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_005702061.1|1787215_1788052_-	virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_005702060.1|1788048_1788522_-	YchJ family protein	NA	NA	NA	NA	NA
WP_005702059.1|1788524_1789193_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_005702058.1|1789318_1790818_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	45.0	1.1e-82
WP_005702056.1|1791061_1791877_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_005702055.1|1791952_1793785_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	43.6	3.6e-131
WP_005702054.1|1793833_1794610_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005702053.1|1794748_1795021_-	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.2	4.2e-20
WP_005702052.1|1795186_1795777_-	DUF416 family protein	NA	NA	NA	NA	NA
WP_005702051.1|1795794_1796859_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_005702050.1|1796866_1797649_-	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_005702049.1|1797965_1802234_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.0	5.4e-69
WP_005702047.1|1802337_1806366_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	26.2	1.4e-21
WP_005702046.1|1806634_1807006_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_005702045.1|1807057_1807549_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_005702044.1|1807912_1808602_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_005630840.1|1808606_1809035_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_005702043.1|1809204_1809756_-	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_005702041.1|1809757_1810168_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_005702040.1|1811032_1811548_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_005702039.1|1812310_1812619_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005702038.1|1812615_1812963_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_005702037.1|1813025_1813583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005702035.1|1813569_1813758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005702034.1|1813757_1814003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049756048.1|1813995_1814838_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_005702032.1|1815077_1815380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005702031.1|1815659_1816157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005594660.1|1817287_1817671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005702029.1|1817829_1818141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005702028.1|1818165_1818618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012771837.1|1818631_1818892_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_005594653.1|1818902_1819112_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_012771838.1|1819305_1819809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005702023.1|1819931_1821176_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	40.6	5.9e-85
WP_005702022.1|1822042_1823134_+	YdcF family protein	NA	NA	NA	NA	NA
WP_005702021.1|1823555_1824680_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	28.0	6.2e-25
WP_005702020.1|1824747_1826661_+	N-6 DNA methylase	NA	A0A1W6JNK1	Staphylococcus_phage	46.8	5.4e-154
WP_080514048.1|1827763_1828267_+	restriction endonuclease subunit S	NA	A0A1W6JNN3	Staphylococcus_phage	34.0	2.9e-14
WP_012771842.1|1828536_1831137_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	21.6	1.8e-30
WP_012771843.1|1831161_1832487_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	31.1	8.9e-47
WP_012771844.1|1832576_1833281_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_005702013.1|1833337_1834027_-	nicotinamide riboside transporter PnuC	NA	U5J9C5	Bacillus_phage	34.4	1.8e-35
WP_012771846.1|1834224_1837083_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.0	6.5e-18
WP_005702011.1|1837085_1837745_+|tRNA	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA	tRNA	NA	NA	NA	NA
WP_005702010.1|1837936_1838434_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_005702008.1|1838455_1839940_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_005702007.1|1839949_1840366_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_005702004.1|1840366_1842118_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_005702002.1|1842081_1843080_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_005702001.1|1843081_1843867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005702000.1|1843881_1844568_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_005701999.1|1844571_1845915_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_012771847.1|1845911_1846769_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_005701996.1|1846794_1847421_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_005701995.1|1847422_1848850_+	type VI secretion system domain-containing protein	NA	NA	NA	NA	NA
WP_005701994.1|1848846_1852530_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_005701993.1|1853019_1856250_+|protease	autotransporter serine protease	protease	NA	NA	NA	NA
1857387:1857406	attR	TAAAAAAACGACCGCACTTT	NA	NA	NA	NA
>prophage 3
NC_012913	Aggregatibacter aphrophilus NJ8700, complete sequence	2313035	2261685	2271720	2313035	tRNA,integrase	Escherichia_phage(16.67%)	8	2259082:2259096	2265561:2265575
2259082:2259096	attL	AAAGTGCGGTCATTT	NA	NA	NA	NA
WP_005701717.1|2261685_2262927_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	38.6	9.8e-72
WP_012771980.1|2263325_2265197_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.5	1.0e-35
WP_012771981.1|2265249_2267046_-	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	31.6	2.1e-43
2265561:2265575	attR	AAAGTGCGGTCATTT	NA	NA	NA	NA
WP_005701713.1|2267168_2267384_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_005701711.1|2267608_2268637_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.5	4.7e-112
WP_012771983.1|2268708_2268942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005701708.1|2268941_2269520_+	thymidine kinase	NA	A0A076YPF1	Citrobacter_phage	51.6	2.4e-52
WP_005701707.1|2269704_2271720_-	NAD-dependent DNA ligase LigA	NA	A0A289ZTZ3	Serratia_phage	49.1	3.3e-141
