The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_012563	Clostridium botulinum A2 str. Kyoto, complete genome	4155278	1685562	1722671	4155278	terminase,portal,integrase,head,bacteriocin,protease,plate,tail,capsid	Clostridium_phage(56.67%)	64	1683921:1683937	1701645:1701661
1683921:1683937	attL	AATAGAATTGTTTTTCT	NA	NA	NA	NA
WP_012704184.1|1685562_1686612_-|integrase	site-specific integrase	integrase	Q8SBN2	Clostridium_phage	62.6	3.2e-124
WP_079995167.1|1686598_1686838_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012704128.1|1687006_1687369_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012705054.1|1687814_1688015_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012704859.1|1688015_1688717_+	phage regulatory protein	NA	A0A0A7RVQ9	Clostridium_phage	68.9	3.3e-40
WP_012704391.1|1688717_1688879_+	hypothetical protein	NA	Q8SBM7	Clostridium_phage	62.7	1.4e-10
WP_012705376.1|1689034_1689229_+	hypothetical protein	NA	A0A143FMG3	Bacillus_phage	56.9	8.5e-07
WP_012705140.1|1689244_1689442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079995168.1|1689695_1690019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012704844.1|1690206_1690518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012704008.1|1690517_1690739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079995169.1|1690740_1690899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012705584.1|1690871_1691369_+	hypothetical protein	NA	A0A0A7S0G6	Clostridium_phage	51.5	8.8e-40
WP_012704670.1|1691368_1691998_+	recombinase	NA	A0A0F6N3I5	Staphylococcus_phage	39.1	5.7e-36
WP_012703716.1|1691999_1692284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012705739.1|1692294_1693182_+	hypothetical protein	NA	A0A0A7RTL4	Clostridium_phage	65.1	4.3e-61
WP_079995170.1|1693111_1693882_+	MerR family transcriptional regulator	NA	M9Q1J4	Clostridium_phage	45.1	4.5e-51
WP_012704502.1|1693894_1694449_+	hypothetical protein	NA	Q332D2	Clostridium_botulinum_C_phage	48.4	3.1e-41
WP_012703931.1|1694451_1694640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012705734.1|1694651_1694930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012705178.1|1694977_1695697_+	hypothetical protein	NA	A0A2H4J6H9	uncultured_Caudovirales_phage	42.6	6.8e-49
WP_041173624.1|1695686_1695917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012703695.1|1695931_1696120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012704875.1|1696365_1696551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012705674.1|1696589_1696784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012704041.1|1696912_1697962_+	nucleoid-associated protein	NA	J9QE81	Clostridium_phage	28.4	3.0e-37
WP_012703675.1|1698068_1698782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004442249.1|1698778_1698964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004442245.1|1699271_1699658_+	hypothetical protein	NA	A0A0A7RTL7	Clostridium_phage	69.3	2.6e-47
WP_003362103.1|1699917_1700130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012704099.1|1700130_1700736_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L2BY87	Clostridium_phage	75.1	2.0e-86
WP_012704456.1|1701033_1701531_+	hypothetical protein	NA	D2J052	Enterococcus_phage	27.7	2.0e-07
WP_154695166.1|1701681_1701948_+	HNH endonuclease	NA	A0A0A7RUC8	Clostridium_phage	42.5	3.3e-09
1701645:1701661	attR	AGAAAAACAATTCTATT	NA	NA	NA	NA
WP_012704742.1|1702108_1702591_+|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	33.3	2.9e-11
WP_012703687.1|1702590_1704333_+|terminase	terminase large subunit	terminase	A6M948	Geobacillus_virus	40.6	1.7e-122
WP_012705472.1|1704344_1705601_+|portal	phage portal protein	portal	Q2LIC9	Bacillus_phage	37.9	2.5e-75
WP_012705141.1|1705587_1706349_+|protease	Clp protease ClpP	protease	A0A0A7RTN2	Clostridium_phage	57.4	9.0e-68
WP_012704259.1|1706387_1707563_+|capsid	phage major capsid protein	capsid	Q9ZXF6	Bacillus_phage	30.5	8.2e-36
WP_012704689.1|1707607_1707865_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A6M953	Geobacillus_virus	42.7	3.2e-09
WP_012704060.1|1707883_1708219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012705623.1|1708228_1708438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012704983.1|1708440_1708854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012705324.1|1708914_1709340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012703694.1|1709542_1709833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012704248.1|1709837_1710923_+	hypothetical protein	NA	A0A090D804	Clostridium_phage	28.8	2.6e-28
WP_012704978.1|1710933_1711362_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_012703974.1|1711377_1711797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012705194.1|1712032_1714663_+|tail	phage tail tape measure protein	tail	A0A0U4IIN6	Exiguobacterium_phage	35.7	1.4e-35
WP_012705686.1|1714709_1715141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012703984.1|1715140_1716073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012704547.1|1716083_1716401_+	DUF2577 domain-containing protein	NA	NA	NA	NA	NA
WP_012705449.1|1716412_1716850_+	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
WP_012705663.1|1716861_1717971_+|plate	baseplate J/gp47 family protein	plate	A0A0A7RUN3	Clostridium_phage	33.5	9.8e-39
WP_012705196.1|1717982_1718513_+	DUF2313 domain-containing protein	NA	A0A2H4J1P4	uncultured_Caudovirales_phage	22.0	7.5e-05
WP_012704076.1|1719345_1719651_+	hypothetical protein	NA	J9QEB9	Clostridium_phage	37.0	5.6e-05
WP_012705345.1|1719666_1719852_+	hypothetical protein	NA	A0A2H4JGH3	uncultured_Caudovirales_phage	69.6	6.0e-10
WP_012704941.1|1719939_1720143_+|bacteriocin	bacteriocin UviB	bacteriocin	NA	NA	NA	NA
WP_012704333.1|1720144_1720318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012704505.1|1720360_1721119_+	N-acetylmuramoyl-L-alanine amidase	NA	I1TJX3	Clostridium_phage	60.9	1.5e-51
WP_021106503.1|1721266_1721407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012703947.1|1721442_1721595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012704407.1|1721581_1721764_+	hypothetical protein	NA	A0A0A7RTH9	Clostridium_phage	63.2	2.9e-09
WP_012703802.1|1721774_1722020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012705355.1|1722164_1722671_+	hypothetical protein	NA	A0A0A7S0D9	Clostridium_phage	63.1	4.2e-21
>prophage 2
NC_012563	Clostridium botulinum A2 str. Kyoto, complete genome	4155278	2060348	2144395	4155278	terminase,portal,head,integrase,protease,tail,capsid	Clostridium_phage(56.25%)	82	2102248:2102307	2144535:2144632
WP_078983312.1|2060348_2060807_-|protease	hydrogenase maturation protease	protease	NA	NA	NA	NA
WP_003359027.1|2060797_2062213_-	nickel-dependent hydrogenase large subunit	NA	NA	NA	NA	NA
WP_003358860.1|2062314_2063187_-	hydrogenase small subunit	NA	NA	NA	NA	NA
WP_012704847.1|2063454_2064156_+	conjugal transfer protein TraX	NA	NA	NA	NA	NA
WP_003358857.1|2064576_2064744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012703727.1|2065419_2068626_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_012705483.1|2068653_2069703_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.3	2.3e-58
WP_003358890.1|2070218_2070386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012705684.1|2072254_2073811_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.3e-52
WP_012705347.1|2074172_2075906_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_003358885.1|2075925_2077821_-	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_012703673.1|2077832_2078312_-	NADH-quinone oxidoreductase subunit NuoE	NA	NA	NA	NA	NA
WP_012705484.1|2078786_2079974_-	potassium transporter	NA	NA	NA	NA	NA
WP_003358887.1|2080233_2081112_-	ADP-ribosylglycohydrolase family protein	NA	G3M9X5	Bacillus_virus	40.6	2.7e-52
WP_003359094.1|2081351_2082446_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_012704920.1|2082555_2083692_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	31.6	2.2e-22
WP_003358993.1|2083875_2084388_+	DUF2953 domain-containing protein	NA	NA	NA	NA	NA
WP_003358933.1|2084455_2084896_+	sporulation protein YtfJ	NA	NA	NA	NA	NA
WP_003358977.1|2084956_2085538_-	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.1	6.9e-20
WP_003358854.1|2085530_2086277_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.8	1.7e-07
WP_003359065.1|2087053_2088277_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	30.6	3.8e-36
WP_003358846.1|2088399_2089122_-	EcsC family protein	NA	NA	NA	NA	NA
WP_021107022.1|2089280_2090339_-	endonuclease/exonuclease/phosphatase	NA	NA	NA	NA	NA
WP_003359091.1|2090480_2090729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012703822.1|2090835_2092140_-	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	56.1	1.2e-128
WP_003359005.1|2092425_2093241_-	purine-nucleoside phosphorylase	NA	Q5YFI9	Singapore_grouper_iridovirus	42.2	8.7e-61
WP_012705197.1|2093278_2094154_-	site-specific tyrosine recombinase XerD	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	26.5	1.0e-14
WP_003359007.1|2094205_2094433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003358910.1|2094423_2095077_-	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_003362492.1|2095283_2095820_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_012705366.1|2096313_2097840_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_003359052.1|2098655_2099414_-	C40 family peptidase	NA	A0A0A7RU71	Clostridium_phage	72.3	3.8e-42
WP_003358823.1|2101448_2102027_-	hypothetical protein	NA	NA	NA	NA	NA
2102248:2102307	attL	CAAACCCTATTTTTTAACCTTAATTTATCAGCTACCATTGCAATAAACTCAGAATTTGTT	NA	NA	NA	NA
WP_012705293.1|2102705_2103293_-	DUF4352 domain-containing protein	NA	A0A0A7RUM7	Clostridium_phage	36.5	1.7e-10
WP_012705176.1|2103421_2104180_-	SH3 domain-containing protein	NA	I1TJX3	Clostridium_phage	58.2	1.3e-50
WP_012705751.1|2104179_2104353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003360661.1|2104354_2104579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704217.1|2104790_2105270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704975.1|2105518_2105926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012705464.1|2106020_2106188_-	hypothetical protein	NA	A0A2H4J054	uncultured_Caudovirales_phage	77.4	2.3e-16
WP_012704570.1|2106189_2106516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704526.1|2106527_2107985_-	hypothetical protein	NA	E2ELJ8	Clostridium_phage	43.3	5.6e-50
WP_012704988.1|2107991_2109149_-	hypothetical protein	NA	A0A0C5AMZ5	Paenibacillus_phage	34.4	2.2e-65
WP_012705696.1|2109152_2110022_-|tail	phage tail family protein	tail	E2ELJ6	Clostridium_phage	40.3	2.0e-47
WP_012705149.1|2110037_2113964_-|tail	phage tail tape measure protein	tail	M1PKM6	Streptococcus_phage	52.0	2.7e-91
WP_012703799.1|2114253_2114646_-	hypothetical protein	NA	A0A0A7RUF5	Clostridium_phage	64.8	5.5e-37
WP_012705635.1|2114703_2115285_-|tail	tail protein	tail	A0A0A7RUI3	Clostridium_phage	73.2	1.5e-78
WP_012705429.1|2115348_2115705_-	hypothetical protein	NA	A0A0A7S158	Clostridium_phage	81.9	1.3e-48
WP_012703894.1|2115720_2116080_-	hypothetical protein	NA	A0A0A7RUF1	Clostridium_phage	83.8	8.3e-48
WP_012704283.1|2116080_2116449_-|head	phage head closure protein	head	A0A0A7RUH8	Clostridium_phage	63.8	1.4e-34
WP_012704655.1|2116438_2116732_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0A7RWM0	Clostridium_phage	41.3	4.1e-13
WP_012705399.1|2116816_2118049_-|capsid	phage major capsid protein	capsid	Q0SPK4	Clostridium_phage	50.0	1.1e-94
WP_012705608.1|2118101_2118845_-|protease	Clp protease ClpP	protease	A0A0A7RUD3	Clostridium_phage	76.3	3.1e-97
WP_012705476.1|2118837_2120088_-|portal	phage portal protein	portal	A0A0A7RUE7	Clostridium_phage	80.1	4.9e-188
WP_041173655.1|2120131_2120314_-	hypothetical protein	NA	A0A0A7RUH2	Clostridium_phage	72.2	1.7e-12
WP_012704297.1|2120337_2122056_-|terminase	terminase large subunit	terminase	A0A0A7RWL3	Clostridium_phage	92.1	0.0e+00
WP_012703719.1|2122048_2122510_-|terminase	phage terminase small subunit P27 family	terminase	A0A0A7S147	Clostridium_phage	58.4	7.4e-41
WP_041173628.1|2122645_2123113_-	HNH endonuclease	NA	Q0SPJ9	Clostridium_phage	43.3	6.4e-24
WP_012705034.1|2123117_2123282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704565.1|2123359_2124691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704890.1|2124877_2125438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704566.1|2125607_2125829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012703768.1|2125844_2127257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012703990.1|2127298_2127508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012705579.1|2127583_2127904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012705522.1|2127954_2128209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704854.1|2128282_2128804_-	endonuclease	NA	NA	NA	NA	NA
WP_012703712.1|2129198_2129636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012705714.1|2129667_2130345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704962.1|2130647_2133542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704884.1|2134182_2135319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704284.1|2135363_2136317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041173656.1|2136387_2136813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012705501.1|2137792_2138011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704862.1|2138131_2138788_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012703958.1|2139070_2139400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003362257.1|2139679_2139883_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012703833.1|2140006_2141428_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012705553.1|2141508_2141733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012705233.1|2141783_2142467_-	metallophosphatase	NA	NA	NA	NA	NA
WP_012705705.1|2142914_2143403_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_012705291.1|2143402_2144395_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	26.8	4.5e-11
2144535:2144632	attR	CAAACCCTATTTTTTAACCTTAATTTATCAGCTACCATTGCAATAAACTCAGAATTTGTTGGTTTTCCCTTCCCATTATTTATAGTATACCCAAATAT	NA	NA	NA	NA
>prophage 3
NC_012563	Clostridium botulinum A2 str. Kyoto, complete genome	4155278	2561915	2613317	4155278	terminase,portal,integrase,tail,plate,capsid	uncultured_Caudovirales_phage(35.29%)	75	2588983:2589000	2610398:2610415
WP_087943615.1|2561915_2562116_-	helix-turn-helix domain-containing protein	NA	A0A2H4J765	uncultured_Caudovirales_phage	72.3	5.0e-18
WP_012704359.1|2562526_2563075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012703837.1|2564258_2564489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041173633.1|2564846_2565395_-	hypothetical protein	NA	A0A0A7RVQ5	Clostridium_phage	39.2	7.2e-19
WP_012705094.1|2565406_2566396_-	hypothetical protein	NA	A0A0A7S0A3	Clostridium_phage	38.2	4.2e-33
WP_012704593.1|2566643_2567405_-	SH3 domain-containing protein	NA	I1TJX3	Clostridium_phage	56.8	3.4e-51
WP_012705426.1|2567442_2567637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012705558.1|2567653_2567908_-	membrane protein	NA	A0A0A7RTX0	Clostridium_phage	68.4	4.1e-25
WP_012703739.1|2568175_2568472_-	hypothetical protein	NA	J9QEB9	Clostridium_phage	46.5	1.3e-14
WP_012705275.1|2568487_2569654_-|tail	tail fiber protein	tail	A0A0A7RTQ0	Clostridium_phage	55.8	3.0e-62
WP_012705217.1|2569656_2570292_-	YmfQ family protein	NA	A0A2H4J1P4	uncultured_Caudovirales_phage	65.6	5.0e-72
WP_012704534.1|2570288_2571419_-|plate	baseplate J/gp47 family protein	plate	A0A2H4J7K8	uncultured_Caudovirales_phage	63.6	5.9e-124
WP_012703968.1|2571424_2571877_-	DUF2634 domain-containing protein	NA	A0A2H4J4Q8	uncultured_Caudovirales_phage	76.3	1.6e-64
WP_012704540.1|2571869_2572202_-	hypothetical protein	NA	A0A2H4J746	uncultured_Caudovirales_phage	68.9	1.3e-34
WP_012703953.1|2572185_2573154_-	hypothetical protein	NA	A0A2H4J063	uncultured_Caudovirales_phage	65.3	9.5e-115
WP_025775143.1|2573153_2573807_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2H4J045	uncultured_Caudovirales_phage	68.3	2.2e-59
WP_012704756.1|2573873_2574386_-	hypothetical protein	NA	A0A2H4J333	uncultured_Caudovirales_phage	56.0	1.2e-28
WP_012704001.1|2574439_2577418_-|tail	phage tail tape measure protein	tail	A0A2H4J055	uncultured_Caudovirales_phage	51.2	1.0e-215
WP_003385474.1|2577418_2577565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003385475.1|2577600_2578035_-	hypothetical protein	NA	A0A2H4J883	uncultured_Caudovirales_phage	74.8	1.1e-54
WP_003385476.1|2578058_2578469_-|tail	phage tail tube protein	tail	A0A2H4J032	uncultured_Caudovirales_phage	86.5	8.8e-62
WP_012704871.1|2578481_2579888_-|portal	phage portal protein	portal	A0A2H4J1N7	uncultured_Caudovirales_phage	80.3	1.1e-225
WP_012705505.1|2579887_2580079_-	hypothetical protein	NA	A0A2H4J7J8	uncultured_Caudovirales_phage	72.6	5.2e-17
WP_003385479.1|2580089_2580911_-	hypothetical protein	NA	A0A2H4J4Q0	uncultured_Caudovirales_phage	74.7	4.9e-120
WP_012704241.1|2580913_2581321_-	hypothetical protein	NA	A0A2H4J736	uncultured_Caudovirales_phage	70.1	2.4e-51
WP_012704063.1|2581322_2581709_-	hypothetical protein	NA	A0A2H4J057	uncultured_Caudovirales_phage	65.4	1.9e-42
WP_012704263.1|2581709_2582030_-	hypothetical protein	NA	A0A2H4J040	uncultured_Caudovirales_phage	57.4	3.9e-25
WP_003385482.1|2582032_2582224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012705425.1|2582280_2583333_-|capsid	phage capsid protein	capsid	D9ZND6	Clostridium_phage	50.6	1.8e-87
WP_012704375.1|2583346_2583739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704542.1|2583759_2584374_-	phage scaffold protein	NA	A0A0A7RW68	Clostridium_phage	35.8	3.8e-24
WP_012705730.1|2584589_2586248_-	exonuclease SbcC	NA	A0A2H4J048	uncultured_Caudovirales_phage	64.7	1.0e-193
WP_012705544.1|2586247_2587774_-|portal	phage portal protein	portal	D9ZNC8	Clostridium_phage	53.1	7.9e-140
WP_012704181.1|2587773_2589129_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	64.5	2.4e-156
2588983:2589000	attL	TTTTTCTTCTAATAGTTT	NA	NA	NA	NA
WP_012704107.1|2589128_2589836_-	hypothetical protein	NA	A0A0A8WFS6	Clostridium_phage	51.1	7.1e-51
WP_012705283.1|2589931_2590171_-	peptidase	NA	NA	NA	NA	NA
WP_012704091.1|2590286_2590505_-	hypothetical protein	NA	A0A0A7RTM8	Clostridium_phage	57.1	1.9e-10
WP_139368842.1|2590596_2591547_-	hypothetical protein	NA	A0A0K2FHC7	Achromobacter_phage	41.7	1.0e-07
WP_012704734.1|2592245_2592683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101526870.1|2592693_2592960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041173634.1|2592928_2593333_-	hypothetical protein	NA	A0A0E3Y4X1	Fusobacterium_phage	36.8	3.5e-10
WP_012705130.1|2593610_2593838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012705752.1|2593858_2594686_-	DNA adenine methylase	NA	A7YGL3	Campylobacter_phage	35.4	8.6e-32
WP_012705144.1|2594700_2594916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704946.1|2594932_2595928_-|integrase	tyrosine-type recombinase/integrase	integrase	B9UDL9	Salmonella_phage	24.5	4.9e-05
WP_012703725.1|2596644_2597034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704295.1|2597167_2597350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012705729.1|2597410_2597716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704168.1|2597749_2597902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704509.1|2597933_2598122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101526883.1|2598392_2598584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704046.1|2598634_2598982_-	hypothetical protein	NA	A0A0A7RTL9	Clostridium_phage	57.0	1.4e-28
WP_012705681.1|2598984_2599389_-	DUF1064 domain-containing protein	NA	D0R7I5	Paenibacillus_phage	42.1	4.8e-12
WP_012704186.1|2599539_2599905_-	hypothetical protein	NA	A0A0A7RVR5	Clostridium_phage	46.2	3.8e-24
WP_012703755.1|2599981_2600695_-	hypothetical protein	NA	A0A0A7RWW3	Clostridium_phage	62.3	5.1e-73
WP_012705518.1|2600721_2601114_-	hypothetical protein	NA	A0A0A7RUF3	Clostridium_phage	58.5	2.6e-34
WP_033045271.1|2601211_2601553_-	nucleotide pyrophosphohydrolase	NA	R4T830	Halovirus	55.4	5.0e-10
WP_012705051.1|2601591_2601831_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A0K2CZ86	Paenibacillus_phage	60.3	1.7e-20
WP_012705546.1|2601833_2602154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012705435.1|2602155_2603034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025775360.1|2603045_2603279_-	hypothetical protein	NA	A0A0A7RTQ4	Clostridium_phage	41.0	2.4e-11
WP_012704252.1|2603301_2604105_-	ATP-binding protein	NA	A0A2K9V3L7	Faecalibacterium_phage	35.1	1.6e-35
WP_012703960.1|2604064_2604937_-	replication protein	NA	Q7Y4K5	Streptococcus_phage	40.8	4.5e-39
WP_012705759.1|2604959_2605259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704559.1|2605544_2605691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012705442.1|2605693_2606554_-	hypothetical protein	NA	E5DV80	Deep-sea_thermophilic_phage	47.1	3.1e-56
WP_012704723.1|2606565_2607051_-	siphovirus Gp157 family protein	NA	A0A059T5F1	Listeria_phage	44.7	2.4e-26
WP_012705266.1|2607566_2607719_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003392449.1|2607739_2607949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704315.1|2607960_2608749_-	oxidoreductase	NA	A0A0E3T9K5	Staphylococcus_phage	64.1	2.4e-87
WP_012703750.1|2608802_2609024_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012705201.1|2609156_2609615_+	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	31.1	2.2e-05
WP_012704586.1|2609661_2610096_+	ImmA/IrrE family metallo-endopeptidase	NA	D6R412	Bacillus_phage	47.1	4.8e-26
WP_012703858.1|2610238_2611600_+	DUF4041 domain-containing protein	NA	X5JAC1	Clostridium_phage	57.8	2.0e-70
2610398:2610415	attR	AAACTATTAGAAGAAAAA	NA	NA	NA	NA
WP_012705666.1|2611694_2613317_+	resolvase	NA	A0A1L2BY67	Clostridium_phage	37.2	3.5e-93
>prophage 4
NC_012563	Clostridium botulinum A2 str. Kyoto, complete genome	4155278	2657572	2697336	4155278	portal,terminase,plate,tail	Clostridium_phage(83.33%)	48	NA	NA
WP_012705552.1|2657572_2657827_-	membrane protein	NA	A0A0A7RTX0	Clostridium_phage	69.6	1.8e-25
WP_012705470.1|2657930_2658641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704845.1|2658864_2659332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704282.1|2659996_2660386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012705342.1|2660507_2660717_-	hypothetical protein	NA	A0A2H4JGH3	uncultured_Caudovirales_phage	68.9	1.3e-08
WP_012704076.1|2660732_2661038_-	hypothetical protein	NA	J9QEB9	Clostridium_phage	37.0	5.6e-05
WP_012704615.1|2661053_2662298_-|tail	phage tail protein	tail	A0A2H4J039	uncultured_Caudovirales_phage	62.2	9.8e-72
WP_012704050.1|2662301_2662928_-	DUF2313 domain-containing protein	NA	A0A0A7RVP9	Clostridium_phage	75.1	2.1e-86
WP_012703970.1|2662908_2664003_-|plate	baseplate J/gp47 family protein	plate	A0A0A7S096	Clostridium_phage	76.4	2.1e-158
WP_012705610.1|2664003_2664411_-	DUF2634 domain-containing protein	NA	A0A0A7RTH1	Clostridium_phage	77.7	9.1e-51
WP_012704685.1|2664413_2664758_-	DUF2577 domain-containing protein	NA	A0A0A7RTJ2	Clostridium_phage	75.4	1.0e-39
WP_012705011.1|2664767_2665742_-	hypothetical protein	NA	A0A0A7RTZ4	Clostridium_phage	84.9	1.0e-156
WP_101526884.1|2665753_2666422_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7RVP5	Clostridium_phage	74.8	3.0e-91
WP_012704075.1|2666433_2668593_-	hypothetical protein	NA	A0A0A7S0K9	Clostridium_phage	54.9	5.4e-134
WP_012703789.1|2668678_2669257_-	hypothetical protein	NA	A0A0A7RTT9	Clostridium_phage	56.1	2.3e-55
WP_012704247.1|2669497_2669911_-	hypothetical protein	NA	A0A0A7RTN3	Clostridium_phage	74.1	6.4e-52
WP_012704883.1|2669926_2670391_-|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	80.5	6.0e-67
WP_012705498.1|2670394_2671705_-	hypothetical protein	NA	A0A0A7S087	Clostridium_phage	84.9	1.0e-212
WP_012705220.1|2671866_2672298_-	hypothetical protein	NA	A0A0A7RTI2	Clostridium_phage	73.8	2.3e-52
WP_012704653.1|2672299_2672791_-	HK97 gp10 family phage protein	NA	A0A0A7RTT0	Clostridium_phage	74.1	2.6e-60
WP_012047644.1|2672790_2673174_-	hypothetical protein	NA	A0A0A7S083	Clostridium_phage	84.3	5.7e-55
WP_012705337.1|2673175_2673520_-	hypothetical protein	NA	A0A0A7RTX9	Clostridium_phage	87.7	5.0e-50
WP_012704110.1|2673533_2674499_-	hypothetical protein	NA	A0A0A7RVZ1	Clostridium_phage	78.2	2.7e-141
WP_012704393.1|2674518_2675124_-	scaffold protein	NA	A0A0A7RTM5	Clostridium_phage	45.8	1.4e-23
WP_101526871.1|2675146_2675503_-	ABC transporter ATPase	NA	A0A2H4J4N9	uncultured_Caudovirales_phage	68.7	1.5e-36
WP_012704995.1|2675546_2675741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101526872.1|2675773_2677564_-	primosomal protein	NA	A0A0A7RVY7	Clostridium_phage	75.1	6.9e-151
WP_012704985.1|2677553_2679005_-|portal	phage portal protein	portal	A0A0A7S074	Clostridium_phage	89.1	6.6e-237
WP_012705413.1|2679017_2680256_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0A7RTE7	Clostridium_phage	91.5	4.2e-224
WP_012704115.1|2680245_2680815_-|terminase	terminase small subunit	terminase	U5PZD3	Bacillus_phage	35.8	1.1e-17
WP_003358039.1|2681386_2681866_-	hypothetical protein	NA	I2E8Y5	Clostridium_phage	43.7	2.7e-25
WP_012705294.1|2681867_2683238_-	DEAD/DEAH box helicase	NA	A0A1S7FYY5	Listeria_phage	60.0	4.7e-160
WP_041173637.1|2683400_2683682_-	VRR-NUC domain-containing protein	NA	A0A0A7RTE1	Clostridium_phage	81.7	1.2e-20
WP_012705577.1|2683947_2686371_-	virulence-associated E domain-containing protein	NA	A0A0A7RTG3	Clostridium_phage	88.3	0.0e+00
WP_012703959.1|2686416_2687442_-	nucleoid-associated protein	NA	A0A090D855	Clostridium_phage	33.8	2.2e-45
WP_012704591.1|2687479_2687710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012703855.1|2687748_2689716_-	DNA polymerase	NA	A0A0A7RTL3	Clostridium_phage	87.6	0.0e+00
WP_012705338.1|2689721_2690342_-	DUF2815 family protein	NA	A0A0A7RVM4	Clostridium_phage	91.4	1.8e-95
WP_012704721.1|2690353_2691499_-	DUF2800 domain-containing protein	NA	A0A0A7S066	Clostridium_phage	88.5	8.4e-195
WP_012704353.1|2691498_2691948_-	hypothetical protein	NA	A0A0A7RTD8	Clostridium_phage	49.7	8.6e-10
WP_012703807.1|2691981_2692236_-	hypothetical protein	NA	A0A0A7RTF9	Clostridium_phage	73.3	1.7e-26
WP_012705687.1|2692235_2692487_-	hypothetical protein	NA	A0A0A7RTK9	Clostridium_phage	65.4	4.0e-25
WP_012705088.1|2692505_2692859_-	hypothetical protein	NA	A0A0A7RVM0	Clostridium_phage	69.8	1.1e-36
WP_012703683.1|2692922_2693474_-	sigma-70 family RNA polymerase sigma factor	NA	M9Q2I8	Clostridium_phage	34.2	4.3e-19
WP_012704840.1|2693849_2694623_-	Rha family transcriptional regulator	NA	A0A0K2CZD5	Paenibacillus_phage	42.3	7.0e-44
WP_012704948.1|2694927_2695128_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012704245.1|2695419_2695794_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J076	uncultured_Caudovirales_phage	50.8	5.8e-20
WP_012705549.1|2695797_2697336_+	recombinase family protein	NA	M9Q2G2	Clostridium_phage	33.8	2.1e-68
>prophage 5
NC_012563	Clostridium botulinum A2 str. Kyoto, complete genome	4155278	2874599	2967887	4155278	terminase,tRNA,portal,bacteriocin,head,integrase,protease,tail,capsid	Clostridium_phage(48.39%)	90	2927985:2928044	2967949:2968028
WP_012704917.1|2874599_2877239_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	33.6	8.5e-65
WP_012704192.1|2877684_2878713_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003391902.1|2878725_2879214_-	photosystem reaction center subunit H	NA	NA	NA	NA	NA
WP_003391905.1|2879395_2879824_-	Fe-S cluster assembly scaffold protein NifU	NA	A0A2H4N7M4	Lake_Baikal_phage	54.5	4.2e-30
WP_012704929.1|2879825_2881019_-	cysteine desulfurase NifS	NA	NA	NA	NA	NA
WP_003391911.1|2881011_2881458_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_012703773.1|2881677_2882928_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	42.3	5.4e-86
WP_012704305.1|2883264_2884032_-	histidinol phosphate phosphatase	NA	NA	NA	NA	NA
WP_012703731.1|2884295_2885204_-	AEC family transporter	NA	NA	NA	NA	NA
WP_003389504.1|2885311_2886178_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	32.6	7.4e-10
WP_012705183.1|2886505_2887090_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_012703793.1|2887341_2888331_-	ornithine cyclodeaminase family protein	NA	A0A1V0SL93	Klosneuvirus	26.7	7.9e-16
WP_004441662.1|2888452_2889820_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_012704724.1|2890563_2891898_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_012705354.1|2892273_2892927_+	DUF4397 domain-containing protein	NA	NA	NA	NA	NA
WP_012705466.1|2893064_2893541_-	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012703685.1|2893905_2897667_-	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	23.4	6.3e-29
WP_012704939.1|2897864_2899214_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_012705517.1|2899210_2901688_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	39.2	4.0e-48
WP_003403955.1|2901692_2901968_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_012704680.1|2901973_2903512_-	acyl--CoA ligase	NA	NA	NA	NA	NA
WP_012704932.1|2903528_2904539_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_004440771.1|2904547_2905405_-	bact protein	NA	NA	NA	NA	NA
WP_012705530.1|2905445_2907275_-	AMP-binding protein	NA	A0A2K9KZV5	Tupanvirus	29.6	8.8e-53
WP_003387898.1|2907314_2907827_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004440456.1|2907830_2908079_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_004440624.1|2908087_2909104_-	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_003385573.1|2909100_2910294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004440795.1|2910312_2911053_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_012704135.1|2911517_2912519_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_011986908.1|2912613_2913558_-	carbamate kinase	NA	NA	NA	NA	NA
WP_012705028.1|2914121_2915363_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	52.1	4.7e-98
WP_003403988.1|2915536_2916307_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_011986910.1|2916303_2916792_+	threonine/serine exporter	NA	NA	NA	NA	NA
WP_003359163.1|2916858_2917128_-	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_003394359.1|2917328_2918153_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_011986913.1|2918265_2918742_+	lipoprotein	NA	NA	NA	NA	NA
WP_012705123.1|2919152_2924018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012705534.1|2924094_2925318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012705559.1|2925471_2926527_+	FMN reductase	NA	NA	NA	NA	NA
WP_033049547.1|2926718_2927558_+	PHP domain-containing protein	NA	NA	NA	NA	NA
2927985:2928044	attL	TATTTTATGCTTCTAATAAAAAGGCATGGTAACCTCTCATAGCTTCATAAATATCTGCCT	NA	NA	NA	NA
WP_012704273.1|2928192_2928426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704872.1|2928613_2929201_-	DUF4352 domain-containing protein	NA	A0A0A7RUM7	Clostridium_phage	35.2	1.6e-08
WP_012704600.1|2929329_2930091_-	SH3 domain-containing protein	NA	I1TJX3	Clostridium_phage	56.5	3.4e-51
WP_012703930.1|2930132_2930306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704941.1|2930307_2930511_-|bacteriocin	bacteriocin UviB	bacteriocin	NA	NA	NA	NA
WP_012703739.1|2930769_2931066_-	hypothetical protein	NA	J9QEB9	Clostridium_phage	46.5	1.3e-14
WP_012704885.1|2932345_2933503_-	hypothetical protein	NA	A0A0C5AMZ5	Paenibacillus_phage	33.9	2.0e-63
WP_012704289.1|2933506_2934376_-|tail	phage tail family protein	tail	E2ELJ6	Clostridium_phage	42.3	3.7e-49
WP_012705149.1|2934391_2938318_-|tail	phage tail tape measure protein	tail	M1PKM6	Streptococcus_phage	52.0	2.7e-91
WP_012703788.1|2938607_2939000_-	hypothetical protein	NA	A0A0A7RUF5	Clostridium_phage	64.6	1.6e-36
WP_012705314.1|2939057_2939639_-|tail	tail protein	tail	A0A0A7RUI3	Clostridium_phage	73.2	3.0e-79
WP_012704967.1|2939702_2940059_-	hypothetical protein	NA	A0A0A7S158	Clostridium_phage	82.8	3.3e-49
WP_012704313.1|2940074_2940434_-	hypothetical protein	NA	A0A0A7RUF1	Clostridium_phage	84.7	1.7e-48
WP_012704550.1|2940434_2940803_-|head	phage head closure protein	head	A0A0A7RUH8	Clostridium_phage	63.8	6.3e-35
WP_012705070.1|2940792_2941086_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0A7RWM0	Clostridium_phage	43.5	2.9e-14
WP_012704630.1|2941170_2942403_-|capsid	phage major capsid protein	capsid	Q0SPK4	Clostridium_phage	49.7	4.1e-94
WP_012704826.1|2942476_2943202_-|protease	Clp protease ClpP	protease	A0A0A7RUD3	Clostridium_phage	86.6	3.7e-103
WP_012705308.1|2943194_2944445_-|portal	phage portal protein	portal	A0A0A7RUE7	Clostridium_phage	79.5	4.7e-183
WP_012703819.1|2944488_2944671_-	hypothetical protein	NA	A0A0A7RUH2	Clostridium_phage	70.4	1.7e-12
WP_012704014.1|2944694_2946452_-|terminase	terminase large subunit	terminase	A6M948	Geobacillus_virus	43.2	3.1e-119
WP_012704479.1|2946452_2946938_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	42.0	8.9e-21
WP_012705231.1|2947084_2947552_-	HNH endonuclease	NA	Q0SPJ9	Clostridium_phage	45.4	8.0e-27
WP_012705667.1|2947652_2949446_-	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_041173639.1|2949432_2949684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012703787.1|2949664_2950258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099883.1|2950279_2950477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704448.1|2950506_2950752_-	hypothetical protein	NA	A0A2H4J8H2	uncultured_Caudovirales_phage	45.7	2.3e-09
WP_012342305.1|2950876_2951059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012705708.1|2951127_2951340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012705255.1|2951416_2951737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041173674.1|2951767_2951956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041173640.1|2951962_2952217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012705444.1|2952258_2952846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704791.1|2953141_2953597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704465.1|2953624_2953921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012705168.1|2954220_2957115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704216.1|2957794_2958931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704930.1|2958976_2959930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025775505.1|2960006_2960435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704590.1|2961075_2961495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012705315.1|2961930_2962587_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012704696.1|2962869_2963199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041173641.1|2963424_2963628_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012704679.1|2963838_2964048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157452756.1|2964319_2964736_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_012704818.1|2964854_2965538_-	metallophosphatase	NA	NA	NA	NA	NA
WP_012704210.1|2965603_2965834_-	hypothetical protein	NA	Q331U1	Clostridium_botulinum_C_phage	54.3	1.9e-13
WP_033045323.1|2965847_2966183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079995176.1|2966885_2967887_-|integrase	site-specific integrase	integrase	A7J266	Streptococcus_phage	28.4	2.8e-08
2967949:2968028	attR	TATTTTATGCTTCTAATAAAAAGGCATGGTAACCTCTCATAGCTTCATAAATATCTGCCTTACTAGCTATTTCCCAAGGT	NA	NA	NA	NA
>prophage 6
NC_012563	Clostridium botulinum A2 str. Kyoto, complete genome	4155278	3293762	3303198	4155278		Synechococcus_phage(42.86%)	7	NA	NA
WP_012705771.1|3293762_3295262_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.6	7.2e-69
WP_012705191.1|3295475_3296093_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.6	2.6e-25
WP_012099415.1|3296219_3297215_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	M4QRQ6	Synechococcus_phage	43.7	9.9e-67
WP_003385256.1|3297275_3298724_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.1	7.2e-58
WP_012047943.1|3298815_3299520_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	42.1	6.0e-42
WP_012705495.1|3299519_3299999_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	49.4	2.8e-27
WP_078983280.1|3300627_3303198_-	selenium-dependent xanthine dehydrogenase	NA	A0A0P0IVM8	Acinetobacter_phage	32.4	1.3e-09
>prophage 7
NC_012563	Clostridium botulinum A2 str. Kyoto, complete genome	4155278	3452705	3475565	4155278		Clostridium_phage(81.82%)	28	NA	NA
WP_012705457.1|3452705_3453488_-	hypothetical protein	NA	A0A218M352	Acidovorax_phage	34.1	2.2e-05
WP_012704814.1|3453578_3454664_-	hypothetical protein	NA	A0A0A7RU66	Clostridium_phage	69.5	1.9e-140
WP_012705721.1|3454675_3455674_-	hypothetical protein	NA	A0A0A7RW91	Clostridium_phage	72.6	1.8e-140
WP_003360052.1|3455685_3455940_-	hypothetical protein	NA	A0A0A7S0T0	Clostridium_phage	81.0	1.1e-33
WP_012704958.1|3455945_3457841_-	hypothetical protein	NA	A0A0A7RU09	Clostridium_phage	49.1	2.3e-104
WP_012703961.1|3457855_3459091_-	hypothetical protein	NA	A0A0A7RU28	Clostridium_phage	83.2	1.6e-202
WP_012703835.1|3459113_3460091_-	hypothetical protein	NA	A0A0A7RU61	Clostridium_phage	60.5	3.5e-109
WP_012704658.1|3460092_3461442_-	caspase family protein	NA	A0A0A7RW86	Clostridium_phage	74.1	2.7e-75
WP_012705004.1|3461456_3461798_-	hypothetical protein	NA	A0A0A7S0S4	Clostridium_phage	55.7	2.1e-16
WP_012705384.1|3461810_3462896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704056.1|3462882_3463317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012705047.1|3463329_3464871_-	membrane protein	NA	A0A0A7RU22	Clostridium_phage	42.4	5.8e-05
WP_012704573.1|3465055_3465223_-	hypothetical protein	NA	A0A0A7RW80	Clostridium_phage	68.5	4.3e-15
WP_003357967.1|3465257_3465674_-	hypothetical protein	NA	A0A0A7S0S0	Clostridium_phage	71.2	9.0e-46
WP_012704139.1|3465688_3466576_-	hypothetical protein	NA	A0A0A7RTZ9	Clostridium_phage	74.8	2.4e-120
WP_012704829.1|3466580_3467000_-	hypothetical protein	NA	A0A0A7RU17	Clostridium_phage	73.4	7.1e-59
WP_012704384.1|3467005_3467353_-	hypothetical protein	NA	A0A0A7RU51	Clostridium_phage	60.7	1.5e-33
WP_003357709.1|3467357_3467723_-	hypothetical protein	NA	A0A0A7RW73	Clostridium_phage	57.9	1.2e-33
WP_003357791.1|3467722_3468007_-	hypothetical protein	NA	A0A0A7S0R4	Clostridium_phage	59.2	3.0e-24
WP_012704555.1|3468673_3469195_-	hypothetical protein	NA	A0A0A7RVS1	Clostridium_phage	50.0	1.1e-35
WP_012704130.1|3469307_3469628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072587365.1|3469684_3470533_-	ATP-binding protein	NA	A0A2K9V3L7	Faecalibacterium_phage	34.4	1.2e-31
WP_012705580.1|3470474_3471380_-	hypothetical protein	NA	A8ASN4	Listeria_phage	39.5	9.4e-40
WP_078983288.1|3471473_3471707_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012704308.1|3471747_3471957_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003360073.1|3472148_3472559_+	helix-turn-helix domain-containing protein	NA	A0A0A7RUJ5	Clostridium_phage	56.2	1.0e-09
WP_012705276.1|3472860_3473010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012704213.1|3474077_3475565_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	38.1	2.1e-65
