The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_012808	Methylorubrum extorquens AM1, complete sequence	5511322	867357	937864	5511322	tRNA,transposase	Mycobacterium_phage(27.27%)	54	NA	NA
WP_003598172.1|867357_868683_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	24.0	7.6e-06
WP_012752224.1|869158_869500_-	DUF1467 family protein	NA	NA	NA	NA	NA
WP_003598176.1|869565_869970_-	methylmalonyl-CoA epimerase	NA	NA	NA	NA	NA
WP_003598177.1|870120_871794_-	ribonuclease J	NA	NA	NA	NA	NA
WP_003598178.1|871813_872653_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_003598179.1|872672_874112_-	NADH-quinone oxidoreductase subunit NuoN	NA	NA	NA	NA	NA
WP_003598180.1|874108_875692_-	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_003598181.1|875691_877803_-	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_003598182.1|877861_878167_-	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_003598184.1|878172_878793_-	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_003598186.1|879002_879491_-	NADH-quinone oxidoreductase subunit NuoI	NA	NA	NA	NA	NA
WP_003598188.1|879575_880598_-	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_003598190.1|880610_882677_-	NADH-quinone oxidoreductase subunit G	NA	NA	NA	NA	NA
WP_003598192.1|882711_884013_-	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_003598194.1|884023_885262_-	NADH-quinone oxidoreductase subunit NuoE	NA	NA	NA	NA	NA
WP_003598196.1|885280_886471_-	NADH-quinone oxidoreductase subunit D	NA	NA	NA	NA	NA
WP_003598198.1|886482_887142_-	NADH-quinone oxidoreductase subunit C	NA	NA	NA	NA	NA
WP_003598199.1|887153_887741_-	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_003598200.1|887793_888159_-	NADH-quinone oxidoreductase subunit A	NA	NA	NA	NA	NA
WP_003598202.1|888990_889479_+	CAP domain-containing protein	NA	NA	NA	NA	NA
WP_012752226.1|889524_889971_-	pseudoazurin	NA	NA	NA	NA	NA
WP_003598206.1|890266_893740_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_173390180.1|893876_894353_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_003598208.1|894357_894858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003598210.1|894868_895993_+	mitochondrial fission ELM1 family protein	NA	NA	NA	NA	NA
WP_003598212.1|896143_897118_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.2	8.8e-68
WP_003598214.1|897458_898349_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003598216.1|898465_898921_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_012752228.1|898939_899410_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_003598219.1|899420_900788_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_003598221.1|900872_901547_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_003598222.1|901612_902233_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003598226.1|902280_902760_+	DUF4188 domain-containing protein	NA	NA	NA	NA	NA
WP_003598227.1|902859_903519_-	DUF2155 domain-containing protein	NA	NA	NA	NA	NA
WP_012752230.1|903698_904115_-	NADH:ubiquinone oxidoreductase subunit NDUFA12	NA	NA	NA	NA	NA
WP_012752231.1|904634_908366_+	vitamin B12-dependent ribonucleotide reductase	NA	A0A1X9SGV9	Bradyrhizobium_phage	56.2	0.0e+00
WP_080577072.1|908637_909762_+	cyclic nucleotide-binding domain-containing protein	NA	A0A218MLZ2	uncultured_virus	38.7	2.5e-13
WP_009867550.1|910161_911430_-|transposase	IS256-like element ISMex3 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.7	2.5e-91
WP_190273131.1|913054_913225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085985461.1|913884_914995_+|transposase	IS3-like element ISMex1 family transposase	transposase	S5WIU1	Leptospira_phage	40.3	3.4e-47
WP_012752237.1|916759_917812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003605493.1|917847_918981_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_003605492.1|919383_919743_-	DUF1476 family protein	NA	NA	NA	NA	NA
WP_003603602.1|919984_920215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009867550.1|920501_921770_-|transposase	IS256-like element ISMex3 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.7	2.5e-91
WP_043765884.1|921984_922482_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_003603598.1|922853_924338_-	DUF2252 domain-containing protein	NA	NA	NA	NA	NA
WP_003603596.1|924805_925645_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_085985459.1|927313_928425_-|transposase	IS3-like element ISMex1 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	6.8e-48
WP_003596089.1|929076_930285_-|transposase	IS256-like element ISMex14 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	48.5	4.9e-92
WP_003603591.1|930824_932843_-	glycosyltransferase	NA	M1IME2	Acanthocystis_turfacea_Chlorella_virus	36.1	1.8e-35
WP_043765886.1|932824_934060_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003605095.1|935838_936204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009867550.1|936595_937864_+|transposase	IS256-like element ISMex3 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.7	2.5e-91
>prophage 2
NC_012808	Methylorubrum extorquens AM1, complete sequence	5511322	1112451	1147232	5511322	integrase,transposase	Leptospira_phage(33.33%)	28	1127861:1127920	1155492:1156694
WP_085985459.1|1112451_1113563_-|transposase	IS3-like element ISMex1 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	6.8e-48
WP_012752308.1|1114319_1115348_-	urea transporter	NA	NA	NA	NA	NA
WP_012752309.1|1115363_1116299_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_012252936.1|1116303_1116951_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_012752310.1|1116971_1117652_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_012752311.1|1117693_1118347_-	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_012752312.1|1118370_1118754_-	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_043766716.1|1118763_1119147_-	CrcB family protein	NA	NA	NA	NA	NA
WP_012752314.1|1119208_1120927_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_082222786.1|1120963_1121374_-	urease subunit beta	NA	NA	NA	NA	NA
WP_012752316.1|1121398_1121701_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_012752317.1|1122340_1124455_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012752318.1|1124451_1125183_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_012752319.1|1126012_1126366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012752320.1|1126410_1127316_+	PHB depolymerase family esterase	NA	NA	NA	NA	NA
WP_043766719.1|1127370_1127865_+	transglutaminase	NA	NA	NA	NA	NA
1127861:1127920	attL	ACTGACCTTGCCCCCTGGCCTGCCCTCATTCTGAAGCTAGGGTCCGTCGAGCAGGAGACG	NA	NA	NA	NA
WP_085985459.1|1127924_1129035_+|transposase	IS3-like element ISMex1 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	6.8e-48
WP_158022426.1|1129072_1129324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085985463.1|1129748_1130710_-|transposase	IS630-like element ISMex21 family transposase	transposase	A0A1V0SCG6	Indivirus	24.4	7.2e-14
WP_158022354.1|1131506_1135025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158022355.1|1135021_1135489_+	response regulator	NA	NA	NA	NA	NA
WP_012752323.1|1135481_1136708_+	response regulator	NA	NA	NA	NA	NA
WP_012752324.1|1136991_1137555_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	42.2	3.6e-29
WP_043765794.1|1137812_1139156_+|transposase	IS1380-like element ISMex4 family transposase	transposase	NA	NA	NA	NA
WP_012752325.1|1140024_1140447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158022356.1|1141933_1144348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082222788.1|1144625_1145642_-|integrase	site-specific integrase	integrase	A0A0A1I5U0	Burkholderia_phage	36.1	7.8e-51
WP_009867550.1|1145963_1147232_-|transposase	IS256-like element ISMex3 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.7	2.5e-91
1155492:1156694	attR	ACTGACCTTGCCCCCTGGCCTGCCCTCATTCTGAAGCTAGGGTCCGTCGAGCAGGAGACGGACGATGAAGAAGAGCCGGTTTAGCGAAGAGCAGATCATCGGCATCCTGAAGGAGCAGCAGGCTGGGCTGCCGGTGGCTGAGATCTGTCGCCGCCACGGCATCAGCGACGCGACGTTCTACACGTGGCGCTCGCGCTTCGGCGGCATGGAGGTCTCGGACGCGCGGCGTCTGAAGGCGCTCGATGAGGAGAACCGCAAGCTCAAGAAGCTCCTGGCCGAGGCGATGCTCGACGTGGCCACGCTGCGTGAGGCGCTGGGAAAAAACTTCTGACGCCCGGCGCACGGAGAACGGCCGTGAGCTGGGCCATCGAGGAGAAAGGTTATTCGCAGCGTCGTGCCTGCGGGCTGATCGGCCTTGAGCCGAAGACGTACCGCTACGCCTCGACCCGTGGTGACGACGCGGCTGTGCGGGTGCGCCTGCGCGGCCTGGCCGGCGAGCGCCGCCGGTTCGGCTACCGGCGCCTGCTCATCCTACTGCGGCGGGAGGGCCTCGCTCTCAACCACAAGAAGCTCTTCCGGCTCTACCGAGAGGAGCGGCTGTCGGTGCGCAAGCGCGGAGGTCGCAAGCGAGCACTTGGCACGCGAGCGCCCGCCGCGGTGCCGCAGGAGCCGAACCAGCGCTGGAGCCTCGACTTCGTCTCCGACACGCTCGACGACGGGCGGCGCTTCCGCATCCTCGTCGTGGTCGATGACTGCACGCGGGAGTGCCTGGCGCTGGTGGTCGACACGTCGCTGTCCGGGCGGCGGGTCACGCGTGAACTCGACCGGATCATCAAGGGCCGGGGCAAGCCGCTGATGATCGTCTCGGACAACGGCACCGAGCTGACCTCGCACGCCATCCTGCGCTGGCAGGAGGAGCGTGCGGTCGAGTGGCATTACATCGCGCCCGGCAAGCCGCAGCAGAACGGTTTTGTCGAGAGCTTGAACGGGCGCTTGCGCGACGAGTGCCTGAACGAGCATCTGTTCCGGAGCCTGCCGGCGGCCCGGACCATCATCGAGGCGTGGCGGGTCGACTATAACACCTGCCGCCCCCACACGAGCCTCGGCGGGCTCACCCCGAACGCGTTTGCAACCCGGTCCCGACAGGACCAGAACCAGAACGGACTCTGGTTATGAACGGGGGCAAACAGGGGGCAAGGTCAC	NA	NA	NA	NA
>prophage 3
NC_012808	Methylorubrum extorquens AM1, complete sequence	5511322	1360528	1373067	5511322	head,protease,tail	Paracoccus_phage(37.5%)	15	NA	NA
WP_012752449.1|1360528_1361092_-	lysozyme	NA	W6E9Q2	Rhizobium_phage	41.4	3.1e-25
WP_003607221.1|1361211_1362294_-	DUF2793 domain-containing protein	NA	A0A0K1LM04	Rhodobacter_phage	39.6	7.6e-36
WP_012752450.1|1362318_1366227_-	glycoside hydrolase TIM-barrel-like domain-containing protein	NA	A0A0B5A7K5	Paracoccus_phage	33.2	1.5e-171
WP_003606565.1|1366279_1366744_-	C40 family peptidase	NA	A0A1V0DYB6	Dinoroseobacter_phage	46.1	6.5e-29
WP_003606566.1|1366751_1367645_-	DUF2163 domain-containing protein	NA	A0A0B5A5B8	Paracoccus_phage	42.4	3.6e-60
WP_003606567.1|1367654_1368296_-	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	50.0	3.7e-46
WP_012752451.1|1368307_1368934_-|tail	phage tail tape measure protein	tail	G9JXH3	Shigella_phage	66.7	5.6e-07
WP_012752452.1|1368930_1369164_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_043765964.1|1369160_1369487_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_003607717.1|1369489_1369900_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_003607719.1|1369928_1370348_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_012752454.1|1370344_1370686_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_012752455.1|1370707_1371283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012752456.1|1371315_1372071_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_003606880.1|1372218_1373067_+|protease	trypsin-like serine protease	protease	I6WTR7	Cotesia_sesamiae_Mombasa_bracovirus	23.4	2.9e-06
>prophage 4
NC_012808	Methylorubrum extorquens AM1, complete sequence	5511322	1958437	1995805	5511322	integrase,transposase	Leptospira_phage(22.22%)	32	1992129:1992144	1998718:1998733
WP_085985459.1|1958437_1959549_-|transposase	IS3-like element ISMex1 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	6.8e-48
WP_043766049.1|1959682_1960516_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	42.3	4.4e-52
WP_043766051.1|1960959_1961766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043766056.1|1961823_1962267_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_043766059.1|1962273_1962549_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_043766062.1|1962653_1963088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043766064.1|1963092_1963674_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.7	4.2e-41
WP_082222825.1|1964401_1964632_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_012752685.1|1964660_1965320_-	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_158022369.1|1965979_1968391_+	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	32.9	2.7e-65
WP_082222826.1|1968557_1970324_+	DUF3141 domain-containing protein	NA	NA	NA	NA	NA
WP_012752688.1|1970327_1971539_+	acetate/propionate family kinase	NA	NA	NA	NA	NA
WP_012752689.1|1971535_1972654_+	bifunctional enoyl-CoA hydratase/phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_012752690.1|1972780_1973269_+	TetR/AcrR family transcriptional regulator C-terminal ligand-binding domain-containing protein	NA	NA	NA	NA	NA
WP_085985459.1|1973337_1974449_-|transposase	IS3-like element ISMex1 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	6.8e-48
WP_043766018.1|1975882_1976836_-|transposase	IS481-like element ISMex2 family transposase	transposase	NA	NA	NA	NA
WP_043766068.1|1976919_1977204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043766072.1|1977706_1978438_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	32.5	1.1e-33
WP_043766075.1|1978437_1979937_-|transposase	IS21-like element ISMex39 family transposase	transposase	NA	NA	NA	NA
WP_043766079.1|1980106_1981660_+|transposase	ISL3-like element ISMex26 family transposase	transposase	NA	NA	NA	NA
WP_050772659.1|1981714_1982629_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_012752691.1|1982639_1983428_+	copper resistance protein B	NA	NA	NA	NA	NA
WP_082222827.1|1983736_1984033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012752695.1|1985648_1987067_+	copper oxidase	NA	NA	NA	NA	NA
WP_012752696.1|1987922_1988213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043766087.1|1989090_1989426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012752698.1|1989425_1990091_-	ParA family protein	NA	M4HZI5	Mycobacterium_phage	34.3	1.5e-13
WP_012752700.1|1991223_1992111_-	DNA adenine methylase	NA	A0A0K1LM14	Caulobacter_phage	48.0	1.1e-61
WP_012752701.1|1992107_1992740_-	hypothetical protein	NA	NA	NA	NA	NA
1992129:1992144	attL	GCCGTCGAACAGGCGC	NA	NA	NA	NA
WP_043766091.1|1993489_1993702_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_012752703.1|1993698_1993866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012752705.1|1994482_1995805_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A291AUQ3	Sinorhizobium_phage	31.4	1.9e-41
1998718:1998733	attR	GCGCCTGTTCGACGGC	NA	NA	NA	NA
>prophage 5
NC_012808	Methylorubrum extorquens AM1, complete sequence	5511322	3336249	3343517	5511322	tRNA	Cronobacter_phage(16.67%)	8	NA	NA
WP_012753209.1|3336249_3337521_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	37.7	7.2e-54
WP_003599307.1|3337661_3338795_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_003599306.1|3338804_3339428_+	DUF3578 domain-containing protein	NA	NA	NA	NA	NA
WP_080577052.1|3339421_3339712_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	44.0	3.7e-14
WP_003599302.1|3339711_3340014_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	60.2	8.3e-25
WP_003599300.1|3340135_3341236_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.4	1.4e-77
WP_003599298.1|3341364_3342444_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	36.5	1.2e-57
WP_043707076.1|3342587_3343517_-	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	32.7	2.5e-35
>prophage 6
NC_012808	Methylorubrum extorquens AM1, complete sequence	5511322	3894364	3915582	5511322	integrase,transposase	Leptospira_phage(33.33%)	21	3887560:3887575	3898479:3898494
3887560:3887575	attL	GACGCCGAAGCGGCCG	NA	NA	NA	NA
WP_043766330.1|3894364_3895627_-|integrase	tyrosine-type recombinase/integrase	integrase	B4UTU2	Rhizobium_phage	36.6	5.7e-59
WP_043766333.1|3895898_3896459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012753352.1|3896458_3896707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012753353.1|3896706_3897573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050772671.1|3897750_3898767_-	hypothetical protein	NA	NA	NA	NA	NA
3898479:3898494	attR	CGGCCGCTTCGGCGTC	NA	NA	NA	NA
WP_012753356.1|3898903_3899116_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012753357.1|3899112_3899592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043766932.1|3900606_3901479_+	DNA adenine methylase	NA	R4JMC6	Burkholderia_phage	43.8	1.2e-52
WP_158022385.1|3902093_3902237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085985459.1|3902684_3903795_+|transposase	IS3-like element ISMex1 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	6.8e-48
WP_076611539.1|3904188_3905539_+|transposase	IS3-like element ISMex16 family transposase	transposase	NA	NA	NA	NA
WP_012753360.1|3906550_3907027_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_015823806.1|3907122_3908364_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_012753362.1|3908418_3908862_+	PAS sensor domain-containing protein	NA	NA	NA	NA	NA
WP_012753363.1|3908879_3909674_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_015823807.1|3909886_3910579_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043766018.1|3910836_3911790_-|transposase	IS481-like element ISMex2 family transposase	transposase	NA	NA	NA	NA
WP_158022386.1|3911873_3912065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043766344.1|3912129_3912996_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	46.7	1.3e-51
WP_080577080.1|3912992_3914384_-|transposase	IS21-like element ISMex13 family transposase	transposase	U5N3F9	Enterobacteria_phage	34.1	1.1e-44
WP_085985459.1|3914471_3915582_+|transposase	IS3-like element ISMex1 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	6.8e-48
>prophage 7
NC_012808	Methylorubrum extorquens AM1, complete sequence	5511322	4056895	4067665	5511322	integrase	Ralstonia_phage(10.0%)	19	4046626:4046640	4066207:4066221
4046626:4046640	attL	GGTCGCCGCGCCGCC	NA	NA	NA	NA
WP_043766946.1|4056895_4058113_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	45.1	2.0e-85
WP_043766949.1|4058034_4058259_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012753456.1|4058326_4058632_-	hypothetical protein	NA	A0A222YZB4	Escherichia_phage	51.1	5.1e-06
WP_158022392.1|4058624_4058966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015857135.1|4058955_4059381_-	hypothetical protein	NA	A0A076G7T6	Mycobacterium_phage	39.2	1.6e-13
WP_043766366.1|4059435_4059672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015857137.1|4059722_4059983_-	hypothetical protein	NA	F8TUU1	EBPR_podovirus	50.6	9.0e-12
WP_015857138.1|4059987_4060539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015857139.1|4060535_4060892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158022393.1|4060895_4061648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050772673.1|4061649_4062792_-	hypothetical protein	NA	Q8W6F5	Sinorhizobium_phage	37.2	4.5e-23
WP_158022394.1|4062829_4063366_-	HNH endonuclease	NA	A0A2H4IZP3	uncultured_Caudovirales_phage	36.8	1.9e-08
WP_015857143.1|4063362_4063746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015857144.1|4063745_4064156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015857145.1|4064155_4064542_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_015857146.1|4064534_4065335_-	HNH endonuclease	NA	H2BCW0	Synechococcus_phage	38.8	3.2e-23
WP_015857147.1|4065335_4065746_-	recombination protein NinB	NA	I6R0N7	Salmonella_phage	48.1	1.1e-24
WP_015857149.1|4066437_4067175_-	hypothetical protein	NA	B0VK86	Azospirillum_phage	35.2	7.2e-30
4066207:4066221	attR	GGTCGCCGCGCCGCC	NA	NA	NA	NA
WP_043766369.1|4067164_4067665_-	HNH endonuclease	NA	M1HZB1	Paramecium_bursaria_Chlorella_virus	36.6	1.5e-10
>prophage 8
NC_012808	Methylorubrum extorquens AM1, complete sequence	5511322	4075076	4133149	5511322	transposase,tail,terminase	Escherichia_phage(18.18%)	62	NA	NA
WP_043766380.1|4075076_4076417_+	DNA cytosine methyltransferase	NA	Q6V7R9	Burkholderia_virus	38.9	7.9e-59
WP_015857169.1|4076413_4076728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043766383.1|4076801_4077149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158022397.1|4077148_4077880_+	hypothetical protein	NA	Q94MV0	Myxococcus_phage	43.4	1.2e-16
WP_082222812.1|4077876_4080186_+	DEAD/DEAH box helicase family protein	NA	A0A2I7RTF8	Vibrio_phage	39.5	9.7e-73
WP_015857173.1|4080166_4081105_+	toprim domain-containing protein	NA	A0A0H5AWB1	Pseudomonas_phage	36.0	1.2e-45
WP_158022398.1|4081134_4081446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050772709.1|4081497_4081899_+	hypothetical protein	NA	A4JWM9	Burkholderia_virus	61.2	1.5e-34
WP_043766395.1|4081942_4082698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015857177.1|4083179_4083548_+	DUF3307 domain-containing protein	NA	A0A159B6H1	Gordonia_phage	56.7	2.5e-31
WP_015857178.1|4083544_4083787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015857179.1|4083814_4084096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015857180.1|4084100_4084394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015857181.1|4084400_4085669_+|terminase	PBSX family phage terminase large subunit	terminase	L7TP33	Pseudomonas_virus	44.7	2.8e-98
WP_015857182.1|4085672_4086149_+	HNH endonuclease	NA	J9SSY0	Escherichia_phage	40.8	1.4e-29
WP_015857183.1|4086188_4086461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015857184.1|4086460_4088662_+	hypothetical protein	NA	I3PUX6	Vibrio_phage	35.7	6.6e-95
WP_015857185.1|4088710_4089550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015857186.1|4089775_4090996_+	hypothetical protein	NA	A0A0E3M0Y6	Rhodoferax_phage	33.9	1.3e-47
WP_015857187.1|4091661_4092132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015857188.1|4092138_4092495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158022399.1|4092652_4093453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015857190.1|4093455_4093998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015857191.1|4093997_4095428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158022400.1|4096209_4097688_+	hypothetical protein	NA	A0A0E3JSB2	Rhodoferax_phage	37.3	3.8e-78
WP_015857194.1|4097687_4098014_+	hypothetical protein	NA	U6C692	Ralstonia_phage	40.0	1.2e-08
WP_015857195.1|4098010_4098463_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015857196.1|4098464_4099169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015857197.1|4099168_4100536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015857198.1|4100525_4103180_+	cell wall hydrolase	NA	L7TKC0	Rhizobium_phage	32.2	1.8e-14
WP_043766403.1|4103161_4103347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015857200.1|4103546_4104896_+|tail	phage tail protein	tail	A0A1W6JT73	Escherichia_phage	43.6	8.6e-21
WP_158022401.1|4104904_4106341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015857201.1|4106406_4107018_+	lysozyme	NA	E5E3Z4	Acinetobacter_phage	44.4	7.1e-15
WP_050772678.1|4108919_4109285_+|transposase	IS200/IS605-like element ISMex20 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	52.5	7.2e-23
WP_003596282.1|4109281_4109482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003596281.1|4109483_4109786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003596280.1|4109785_4110223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015857202.1|4110346_4110823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162094038.1|4110837_4111083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158022402.1|4111208_4111688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158022403.1|4111757_4112804_-	hypothetical protein	NA	A0A0M4S6X1	Salmonella_phage	38.6	3.1e-50
WP_015857206.1|4112973_4113240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158022404.1|4113477_4113711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015857208.1|4113754_4113997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015857209.1|4113993_4114212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015857211.1|4114471_4114711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043766421.1|4114714_4115380_-	serine/threonine protein phosphatase	NA	B4UTT5	Rhizobium_phage	42.0	3.4e-47
WP_015857213.1|4115631_4116069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158022405.1|4116302_4116851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158022406.1|4117235_4117400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043766426.1|4117509_4118604_+|transposase	IS5-like element ISMex35 family transposase	transposase	NA	NA	NA	NA
WP_043766429.1|4118672_4118912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043766432.1|4119062_4121051_-	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_015857218.1|4121037_4121544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158022407.1|4122387_4125990_-	glycoside hydrolase family 99-like domain-containing protein	NA	A0A1V0SDW6	Indivirus	26.0	1.0e-15
WP_015857219.1|4126027_4126894_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	55.9	1.2e-92
WP_015857220.1|4126909_4127800_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_015857221.1|4127802_4128861_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	49.0	4.1e-87
WP_015857222.1|4128994_4129546_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A1D8EQH2	Escherichia_phage	41.6	2.3e-28
WP_043766436.1|4130268_4131603_+|transposase	IS1182-like element ISMex36 family transposase	transposase	NA	NA	NA	NA
WP_043765794.1|4131805_4133149_+|transposase	IS1380-like element ISMex4 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NC_012808	Methylorubrum extorquens AM1, complete sequence	5511322	4140943	4194086	5511322	holin,tRNA,integrase,transposase	Mycobacterium_phage(37.5%)	47	4141350:4141368	4203568:4203586
WP_085985459.1|4140943_4142054_+|transposase	IS3-like element ISMex1 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	6.8e-48
4141350:4141368	attL	GGTGCGCCTGCGCGGCCTG	NA	NA	NA	NA
WP_158022410.1|4142078_4142426_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_043766446.1|4142695_4142980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043765794.1|4143450_4144794_+|transposase	IS1380-like element ISMex4 family transposase	transposase	NA	NA	NA	NA
WP_015857232.1|4145303_4145492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015857233.1|4145543_4145729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009867550.1|4145812_4147081_-|transposase	IS256-like element ISMex3 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.7	2.5e-91
WP_009867550.1|4147855_4149124_+|transposase	IS256-like element ISMex3 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.7	2.5e-91
WP_043766449.1|4149900_4151169_+|transposase	IS256-like element ISMex3 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.4	4.8e-90
WP_015857237.1|4151332_4152220_-	YsnF/AvaK domain-containing protein	NA	NA	NA	NA	NA
WP_050772681.1|4152216_4152699_-	YsnF/AvaK domain-containing protein	NA	NA	NA	NA	NA
WP_158022411.1|4152695_4153664_-	PhnA-like protein	NA	NA	NA	NA	NA
WP_015857242.1|4154634_4154883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015857243.1|4156055_4156289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012453265.1|4157832_4158108_-	DUF2312 domain-containing protein	NA	M4QRM3	Loktanella_phage	46.4	2.8e-11
WP_015857246.1|4158297_4159122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158022412.1|4159361_4160213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015857248.1|4160310_4160547_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_015857249.1|4161003_4162152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043766460.1|4162206_4163397_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	46.9	1.3e-81
WP_003600567.1|4163859_4164042_+	DUF3606 domain-containing protein	NA	NA	NA	NA	NA
WP_003604120.1|4164284_4164500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003604122.1|4164824_4165352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003604123.1|4165397_4165619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003604125.1|4165842_4166058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015857251.1|4166181_4168017_-	allophanate hydrolase	NA	NA	NA	NA	NA
WP_015857252.1|4168328_4171856_-	urea carboxylase	NA	NA	NA	NA	NA
WP_003605461.1|4171860_4172481_-	urea carboxylase-associated family protein	NA	NA	NA	NA	NA
WP_015857253.1|4172495_4173302_-	DUF1989 domain-containing protein	NA	NA	NA	NA	NA
WP_003605458.1|4173466_4173838_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003605456.1|4173850_4175224_-	type III glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_003605454.1|4175225_4176026_-	creatininase family protein	NA	NA	NA	NA	NA
WP_003605453.1|4176022_4176964_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	42.4	1.2e-34
WP_015857254.1|4176960_4178022_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015857255.1|4178032_4179043_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003606108.1|4180044_4181373_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	33.0	2.7e-27
WP_015823926.1|4181288_4182140_+	proline/glycine betaine ABC transporter permease	NA	NA	NA	NA	NA
WP_003606104.1|4182325_4183162_+	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_043766463.1|4183242_4184592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003606583.1|4184768_4185800_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_003606582.1|4186236_4187490_+	sarcosine oxidase subunit beta family protein	NA	NA	NA	NA	NA
WP_003606581.1|4187509_4187842_+	sarcosine oxidase subunit delta	NA	NA	NA	NA	NA
WP_043766465.1|4187843_4190831_+	sarcosine oxidase subunit alpha family protein	NA	NA	NA	NA	NA
WP_015857260.1|4190823_4191414_+	sarcosine oxidase subunit gamma	NA	NA	NA	NA	NA
WP_003607062.1|4191556_4192918_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_003607061.1|4193348_4193570_+	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_003607059.1|4193576_4194086_-|tRNA	prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
4203568:4203586	attR	CAGGCCGCGCAGGCGCACC	NA	NA	NA	NA
>prophage 10
NC_012808	Methylorubrum extorquens AM1, complete sequence	5511322	4233188	4263019	5511322	transposase	Mycobacterium_phage(50.0%)	28	NA	NA
WP_043766018.1|4233188_4234142_-|transposase	IS481-like element ISMex2 family transposase	transposase	NA	NA	NA	NA
WP_003606292.1|4234265_4235438_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_003606293.1|4235566_4236223_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003606294.1|4236573_4237788_+	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
WP_012254978.1|4238222_4238540_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_015857274.1|4238639_4239029_-	response regulator	NA	NA	NA	NA	NA
WP_003604305.1|4239308_4240094_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_003604308.1|4240245_4241037_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_003604310.1|4241065_4242112_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_003604312.1|4242306_4242597_-	YggT family protein	NA	NA	NA	NA	NA
WP_009867550.1|4243232_4244501_+|transposase	IS256-like element ISMex3 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.7	2.5e-91
WP_003597829.1|4244541_4245039_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_131473053.1|4245828_4246095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003597826.1|4246323_4246524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003597825.1|4246547_4246880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085985459.1|4247243_4248355_-|transposase	IS3-like element ISMex1 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	6.8e-48
WP_015857281.1|4248774_4250226_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_043766483.1|4250580_4252377_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_015857283.1|4252773_4253082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043766095.1|4253711_4254665_-|transposase	IS481-like element ISMex2 family transposase	transposase	NA	NA	NA	NA
WP_043766486.1|4255912_4256977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015857285.1|4257022_4258126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085985459.1|4258325_4259436_+|transposase	IS3-like element ISMex1 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	6.8e-48
WP_082222814.1|4259431_4260067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_193373938.1|4260419_4260737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015857287.1|4260809_4261070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015857288.1|4261193_4261640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009867550.1|4261750_4263019_+|transposase	IS256-like element ISMex3 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.7	2.5e-91
>prophage 11
NC_012808	Methylorubrum extorquens AM1, complete sequence	5511322	4874343	4905894	5511322	integrase,transposase,protease	Leptospira_phage(57.14%)	44	4862311:4862328	4908254:4908271
4862311:4862328	attL	GCGTCTCGGCGATGGTGG	NA	NA	NA	NA
WP_015857471.1|4874343_4875513_-|integrase	phage integrase	integrase	NA	NA	NA	NA
WP_015857473.1|4875968_4876187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015857474.1|4876619_4876967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158022415.1|4877065_4877260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015857475.1|4877331_4877706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015857476.1|4877702_4878119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158022416.1|4878115_4878562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015857478.1|4878561_4879551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158022417.1|4879550_4880531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085985459.1|4881206_4882317_+|transposase	IS3-like element ISMex1 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	6.8e-48
WP_015857481.1|4882379_4882847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162094039.1|4883228_4883897_-	phage antirepressor KilAC domain-containing protein	NA	A0A2H4JDP7	uncultured_Caudovirales_phage	42.1	4.1e-32
WP_085985459.1|4883979_4885091_-|transposase	IS3-like element ISMex1 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	6.8e-48
WP_158022418.1|4885174_4885402_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_082222817.1|4885492_4886029_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_015857483.1|4886254_4886473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158022419.1|4886558_4886897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158022420.1|4886991_4887336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043767041.1|4887486_4888203_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015857485.1|4888279_4888516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043766556.1|4888703_4888949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015857486.1|4889055_4889322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043766558.1|4889334_4889565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015857488.1|4889563_4889788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158022421.1|4889972_4890380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015857491.1|4890503_4890776_+	DUF837 domain-containing protein	NA	NA	NA	NA	NA
WP_015857492.1|4890768_4891047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015857493.1|4891133_4891481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043766561.1|4891482_4891755_+	hypothetical protein	NA	A0A173G9J5	Propionibacterium_phage	37.0	3.1e-07
WP_085985459.1|4891778_4892890_-|transposase	IS3-like element ISMex1 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	6.8e-48
WP_043766564.1|4893353_4893653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015857495.1|4893874_4894534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085985459.1|4895499_4896610_+|transposase	IS3-like element ISMex1 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	6.8e-48
WP_043767043.1|4896721_4896910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015857496.1|4896906_4897389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158022422.1|4898216_4898408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015857501.1|4898404_4898575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015857502.1|4900059_4900446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015857503.1|4900875_4901139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003600131.1|4901693_4902704_+	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	42.7	1.6e-64
WP_015857505.1|4902732_4903686_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003607233.1|4903859_4904117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003607231.1|4904148_4904901_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_043766569.1|4904970_4905894_-|protease	AprI/Inh family metalloprotease inhibitor	protease	NA	NA	NA	NA
4908254:4908271	attR	GCGTCTCGGCGATGGTGG	NA	NA	NA	NA
>prophage 1
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	0	16652	1261460		Agrobacterium_phage(33.33%)	9	NA	NA
WP_131473057.1|953_2375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003598529.1|2553_3141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003598530.1|3161_3551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003598531.1|3819_4809_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012753525.1|4949_5534_+	DUF3280 domain-containing protein	NA	NA	NA	NA	NA
WP_131473058.1|5629_6088_-	helix-turn-helix transcriptional regulator	NA	A0A223W054	Agrobacterium_phage	36.8	8.5e-13
WP_003598534.1|7675_8416_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003598535.1|8471_15308_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	29.2	3.9e-29
WP_003598536.1|15359_16652_+	NAD(P)-binding domain-containing protein	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	27.0	2.6e-11
>prophage 2
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	31060	34526	1261460	transposase	Mollivirus(33.33%)	3	NA	NA
WP_003598550.1|31060_32884_+	cytochrome P450	NA	A0A0M4JJK6	Mollivirus	23.2	4.6e-17
WP_082222836.1|32926_33154_-	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	55.1	9.0e-08
WP_076611539.1|33175_34526_+|transposase	IS3-like element ISMex16 family transposase	transposase	Q6J1X2	Lactobacillus_phage	25.5	2.6e-09
>prophage 3
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	37875	38805	1261460		Pseudomonas_phage(100.0%)	1	NA	NA
WP_003602968.1|37875_38805_+	transglycosylase SLT domain-containing protein	NA	A0A1Y0T0A2	Pseudomonas_phage	30.2	4.4e-16
>prophage 4
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	66012	67449	1261460		Pseudomonas_phage(100.0%)	1	NA	NA
WP_012753557.1|66012_67449_-	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	38.2	4.0e-61
>prophage 5
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	70821	72173	1261460	transposase	Lactobacillus_phage(100.0%)	1	NA	NA
WP_076611539.1|70821_72173_-|transposase	IS3-like element ISMex16 family transposase	transposase	Q6J1X2	Lactobacillus_phage	25.5	2.6e-09
>prophage 6
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	84550	85450	1261460		Klosneuvirus(100.0%)	1	NA	NA
WP_012753572.1|84550_85450_-	HRDC domain-containing protein	NA	A0A1V0SJN9	Klosneuvirus	35.6	7.2e-08
>prophage 7
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	89377	96792	1261460		Leptospira_phage(50.0%)	6	NA	NA
WP_012753575.1|89377_92524_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VL66	Leptospira_phage	19.9	1.0e-24
WP_003600349.1|92557_92923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012753576.1|92945_93416_+	DUF305 domain-containing protein	NA	NA	NA	NA	NA
WP_003600351.1|93607_93940_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_003600352.1|93963_94197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012753577.1|94362_96792_+	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	36.8	1.0e-80
>prophage 8
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	112566	115731	1261460		Leptospira_phage(100.0%)	1	NA	NA
WP_003599845.1|112566_115731_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.4	1.4e-50
>prophage 9
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	122258	122630	1261460		uncultured_virus(100.0%)	1	NA	NA
WP_003599860.1|122258_122630_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	38.6	2.8e-06
>prophage 10
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	133023	144257	1261460		uncultured_Caudovirales_phage(50.0%)	13	NA	NA
WP_012605982.1|133023_133380_+	DUF2958 domain-containing protein	NA	A0A1W6DX76	Sphingobium_phage	61.5	5.3e-31
WP_012605983.1|133376_134168_+	hydroxypyruvate reductase	NA	NA	NA	NA	NA
WP_012753597.1|134207_135620_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_012605985.1|136070_136283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012605986.1|136330_137077_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	65.7	1.3e-82
WP_003599807.1|137127_137487_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012605987.1|137479_138007_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	43.9	2.0e-26
WP_012605988.1|138006_138432_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	63.7	6.0e-45
WP_012605990.1|139497_140673_+	MFS transporter	NA	NA	NA	NA	NA
WP_003600291.1|140860_141133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043767489.1|141263_143048_+	S8 family serine peptidase	NA	A0A127AWU5	Bacillus_phage	33.8	9.9e-17
WP_155773804.1|143067_143208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012605994.1|143576_144257_-	sigma-70 family RNA polymerase sigma factor	NA	A0A076YQ50	Rhizobium_phage	28.7	1.7e-09
>prophage 11
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	148423	267349	1261460	transposase	Leptospira_phage(18.52%)	101	NA	NA
WP_076611187.1|148423_149228_+|transposase	IS5-like element ISMex32 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	32.8	6.0e-22
WP_012753603.1|150285_151521_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_012605998.1|152377_152956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012753604.1|152928_153327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606000.1|154236_154971_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.8	2.5e-27
WP_012606001.1|154967_156302_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.7	3.8e-05
WP_003596692.1|156398_156653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606002.1|157215_157407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003596689.1|157751_158123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606003.1|158247_159612_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012606004.1|159623_162872_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	24.1	1.3e-62
WP_003596683.1|162877_163432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606005.1|163477_164395_+	cation transporter	NA	NA	NA	NA	NA
WP_012606006.1|164407_164578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003596676.1|164900_165155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003596674.1|165393_165534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003596672.1|165530_167075_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_012606007.1|167277_168018_-	Abi family protein	NA	NA	NA	NA	NA
WP_012606256.1|169763_171041_+|transposase	IS110-like element ISMex12 family transposase	transposase	A0A1S7J231	Thermus_phage	35.4	2.6e-11
WP_003598644.1|172874_173165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003598646.1|173161_173716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131473059.1|174195_174621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003598647.1|174617_174971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049832675.1|175085_176009_-|transposase	IS110-like element ISMex31 family transposase	transposase	NA	NA	NA	NA
WP_085985055.1|177150_178111_+|transposase	IS630-like element ISMex30 family transposase	transposase	A0A2P0VP61	Tetraselmis_virus	23.4	2.3e-07
WP_003598652.1|178279_178447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041357443.1|178521_178734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080515519.1|179042_179270_-	cytochrome C biogenesis protein	NA	NA	NA	NA	NA
WP_003598654.1|179371_180445_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_012753610.1|180533_181055_-	signal peptidase II	NA	NA	NA	NA	NA
WP_003598656.1|181051_183247_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	38.7	3.2e-118
WP_003598658.1|183347_183749_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003598660.1|184425_186846_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	32.6	3.6e-70
WP_003598662.1|186913_187396_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	44.0	3.9e-08
WP_003598663.1|187450_187783_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_003598665.1|187962_188361_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	45.9	1.4e-08
WP_003598666.1|188387_188753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003598668.1|188772_191922_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VL66	Leptospira_phage	20.0	1.9e-23
WP_003598670.1|191935_193675_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012753612.1|193760_194240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003598673.1|194331_194544_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_003598674.1|194924_195665_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_003598675.1|195678_196155_-	metal-binding protein	NA	NA	NA	NA	NA
WP_003598676.1|196174_199348_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.7	1.9e-42
WP_085985476.1|199754_200937_+|transposase	IS3-like element ISMex5 family transposase	transposase	S5WIU1	Leptospira_phage	32.4	7.3e-32
WP_003598681.1|202054_202276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173390153.1|202541_202901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003598686.1|203662_204094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009867550.1|206317_207586_-|transposase	IS256-like element ISMex3 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.7	2.5e-91
WP_043767519.1|208155_209199_+|transposase	IS110-like element ISMex9 family transposase	transposase	A0A1S7J231	Thermus_phage	36.3	7.9e-06
WP_012753615.1|211130_211493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085985476.1|211886_213070_-|transposase	IS3-like element ISMex5 family transposase	transposase	S5WIU1	Leptospira_phage	32.4	7.3e-32
WP_082222865.1|213163_213619_+	DUF2380 domain-containing protein	NA	NA	NA	NA	NA
WP_043767525.1|213775_214126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082222842.1|214157_214379_-	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_012753618.1|214296_215403_-	RecQ family ATP-dependent DNA helicase	NA	K7YHB4	Megavirus	39.1	6.7e-56
WP_003598388.1|215497_215635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043767528.1|215631_216582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012753620.1|217435_217948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012753621.1|218117_218522_-	dihydrofolate reductase	NA	A0A076YIY6	Rhizobium_phage	41.9	4.7e-23
WP_043767544.1|218574_221055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012753623.1|221173_222301_-|transposase	transposase	transposase	A0A7E5	Microcystis_virus	32.1	8.2e-17
WP_012753624.1|222613_223081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012753625.1|223329_224076_+	DCL family protein	NA	NA	NA	NA	NA
WP_158022446.1|224195_224624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012753629.1|224613_224988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012753630.1|224984_225845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162094044.1|226030_227050_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_012753632.1|227238_227544_+	helix-turn-helix transcriptional regulator	NA	A0A0K1LLP9	Caulobacter_phage	45.5	1.6e-07
WP_012753633.1|227540_228887_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_012753634.1|228984_229635_-	transglutaminase-like cysteine peptidase	NA	NA	NA	NA	NA
WP_012753635.1|229724_230231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012753636.1|230288_230606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012753637.1|230685_231033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012753638.1|231029_231302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003596419.1|231709_231970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012753639.1|232280_232691_+	hypothetical protein	NA	B4UTT1	Rhizobium_phage	73.6	3.6e-47
WP_012753641.1|232971_233328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158022447.1|235159_236812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082222843.1|236829_239886_+	RHS domain-containing protein	NA	NA	NA	NA	NA
WP_050772715.1|239888_240101_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_012778812.1|240727_241738_+|transposase	IS110-like element ISMex29 family transposase	transposase	A0A1S7J231	Thermus_phage	29.0	9.9e-14
WP_162094041.1|244411_244654_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080577080.1|246194_247586_+|transposase	IS21-like element ISMex13 family transposase	transposase	U5N3F9	Enterobacteria_phage	34.1	1.1e-44
WP_043766344.1|247582_248449_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	46.7	1.3e-51
WP_043767556.1|250538_250778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158022449.1|251089_251578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012753645.1|251574_252237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043767558.1|252233_253316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043767561.1|253306_253957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158022450.1|254338_254824_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_012753650.1|254820_256056_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_012753651.1|256075_257830_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_012753652.1|258171_260253_+	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	30.5	3.4e-16
WP_158022452.1|260246_260909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012753653.1|260993_261482_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_158022453.1|261526_262105_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_050772717.1|262101_262464_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_009867550.1|263190_264459_+|transposase	IS256-like element ISMex3 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.7	2.5e-91
WP_012753654.1|265091_265790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085985477.1|265870_267349_+	AAA family ATPase	NA	G3MAX6	Bacillus_virus	34.7	2.1e-41
>prophage 12
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	270519	271116	1261460		Erythrobacter_phage(100.0%)	1	NA	NA
WP_012753660.1|270519_271116_+	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	44.2	2.2e-21
>prophage 13
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	275927	276617	1261460		Aeromonas_phage(100.0%)	1	NA	NA
WP_012753668.1|275927_276617_-	hypothetical protein	NA	A0A291LE90	Aeromonas_phage	29.7	3.5e-10
>prophage 14
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	289837	293290	1261460	transposase	Gordonia_phage(50.0%)	4	NA	NA
WP_003596478.1|289837_290578_-	hypothetical protein	NA	A0A166Y0E3	Gordonia_phage	59.9	1.4e-52
WP_003596480.1|290681_291173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043767593.1|291571_291976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043767595.1|292060_293290_+|transposase	transposase	transposase	I4AZI9	Saccharomonospora_phage	37.0	6.5e-60
>prophage 15
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	300929	301799	1261460		Lactococcus_phage(100.0%)	1	NA	NA
WP_043767602.1|300929_301799_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	39.1	1.8e-40
>prophage 16
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	305092	305902	1261460		Planktothrix_phage(100.0%)	1	NA	NA
WP_012753701.1|305092_305902_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	1.4e-23
>prophage 17
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	309857	313291	1261460		uncultured_Caudovirales_phage(100.0%)	5	NA	NA
WP_012753707.1|309857_310571_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	64.5	9.6e-80
WP_043767958.1|310654_311014_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012753709.1|311006_311534_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	43.2	3.4e-26
WP_043767611.1|311533_311959_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	66.4	1.3e-47
WP_012753711.1|311995_313291_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	61.2	8.8e-140
>prophage 18
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	318988	319858	1261460		Lactococcus_phage(100.0%)	1	NA	NA
WP_043767602.1|318988_319858_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	39.1	1.8e-40
>prophage 19
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	327810	330121	1261460	transposase	Escherichia_phage(100.0%)	2	NA	NA
WP_043767620.1|327810_328605_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	34.1	1.3e-29
WP_158022498.1|328594_330121_-|transposase	IS21-like element ISMex27 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	25.0	2.5e-16
>prophage 20
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	337641	341476	1261460		Rhizobium_phage(66.67%)	3	NA	NA
WP_012753728.1|337641_338475_-	serine/threonine protein phosphatase	NA	V9QL63	Rhizobium_phage	38.7	2.4e-34
WP_012753729.1|338532_339315_-	serine/threonine protein phosphatase	NA	V9QL63	Rhizobium_phage	34.3	3.1e-23
WP_012753730.1|339475_341476_+	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	25.2	1.0e-41
>prophage 21
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	349380	349989	1261460		Cedratvirus(100.0%)	1	NA	NA
WP_012753742.1|349380_349989_+	alpha/beta hydrolase	NA	A0A285PWG0	Cedratvirus	31.8	9.8e-09
>prophage 22
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	363038	371715	1261460		Enterobacteria_phage(33.33%)	5	NA	NA
WP_012753748.1|363038_363902_+	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	32.6	3.9e-27
WP_003596938.1|363895_364156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043767632.1|364372_365116_+	response regulator	NA	NA	NA	NA	NA
WP_012753750.1|365129_368801_+	PAS-domain containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	30.3	7.7e-40
WP_012753751.1|368802_371715_+	response regulator	NA	A0A1V0SGX0	Hokovirus	34.0	1.4e-55
>prophage 23
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	392255	393353	1261460		Burkholderia_phage(100.0%)	1	NA	NA
WP_003596909.1|392255_393353_+	acyltransferase	NA	A9YX16	Burkholderia_phage	32.5	3.6e-33
>prophage 24
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	402976	403870	1261460		Mycobacterium_phage(100.0%)	1	NA	NA
WP_012753776.1|402976_403870_-	hypothetical protein	NA	A0A0B5A0F7	Mycobacterium_phage	25.9	8.8e-06
>prophage 25
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	420164	421064	1261460		Clostridium_phage(100.0%)	1	NA	NA
WP_012753789.1|420164_421064_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A090D850	Clostridium_phage	33.8	3.6e-07
>prophage 26
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	426329	427441	1261460	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_085985459.1|426329_427441_-|transposase	IS3-like element ISMex1 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	6.8e-48
>prophage 27
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	446102	452348	1261460		Pseudomonas_phage(33.33%)	5	NA	NA
WP_012753810.1|446102_450044_+	TraM recognition domain-containing protein	NA	F8SJ76	Pseudomonas_phage	38.8	5.2e-66
WP_003606808.1|450047_450761_+	hypothetical protein	NA	A0A0A8ILE3	Aurantimonas_phage	29.3	3.5e-05
WP_012753811.1|450899_451175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012753812.1|451194_451818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003606811.1|451874_452348_-	macro domain-containing protein	NA	A0A088C3J1	Shewanella_sp._phage	28.8	1.0e-05
>prophage 28
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	462998	466660	1261460		Bacillus_phage(100.0%)	2	NA	NA
WP_043767655.1|462998_464861_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.5	1.9e-55
WP_012753820.1|464866_466660_-	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	28.2	4.6e-54
>prophage 29
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	469841	473095	1261460		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_012753822.1|469841_470414_-	3'-5' exonuclease	NA	A0A2H4J7C9	uncultured_Caudovirales_phage	38.6	4.4e-19
WP_012753823.1|470500_473095_-	AAA family ATPase	NA	A0A1P8DII4	Virus_Rctr197k	31.8	5.1e-30
>prophage 30
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	476545	476815	1261460		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_012753828.1|476545_476815_-	DUF2312 domain-containing protein	NA	Q8W6H2	Sinorhizobium_phage	71.1	1.3e-21
>prophage 31
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	485143	487446	1261460		Ochrobactrum_phage(100.0%)	2	NA	NA
WP_003602323.1|485143_486169_-	plasmid partitioning protein RepB	NA	A0A240F4U0	Ochrobactrum_phage	35.5	3.2e-36
WP_003602321.1|486168_487446_-	plasmid partitioning protein RepA	NA	A0A240F4U1	Ochrobactrum_phage	50.0	2.6e-104
>prophage 32
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	492946	493915	1261460		Erythrobacter_phage(100.0%)	1	NA	NA
WP_012753840.1|492946_493915_-	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	41.9	6.2e-05
>prophage 33
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	523471	540637	1261460		Bacillus_virus(33.33%)	14	NA	NA
WP_043767668.1|523471_524647_+	lytic transglycosylase domain-containing protein	NA	K4NWI2	Pseudomonas_phage	41.8	3.6e-23
WP_043767975.1|524933_525920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131473065.1|526155_526527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158022468.1|526541_527000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012753872.1|527090_528671_+	extensin family protein	NA	M4SNJ8	Pseudoalteromonas_phage	33.9	3.8e-12
WP_012753873.1|528675_529350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012753874.1|529464_531081_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_003599249.1|531160_533845_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	30.3	3.7e-84
WP_012753875.1|533884_534415_-	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_012753876.1|534558_535713_+	DNA cytosine methyltransferase	NA	A0A1P8DJM9	Virus_Rctr41k	32.9	2.4e-24
WP_012753877.1|535720_536566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114415986.1|536740_539206_-	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	47.0	4.7e-09
WP_012753879.1|539351_539807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012753880.1|539812_540637_-	J domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	22.5	7.1e-10
>prophage 34
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	544340	546554	1261460		Bacillus_phage(100.0%)	1	NA	NA
WP_043767976.1|544340_546554_+	ATP-dependent RecD-like DNA helicase	NA	A0A218KCE8	Bacillus_phage	29.9	1.9e-57
>prophage 35
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	553824	554586	1261460		Vibrio_phage(100.0%)	1	NA	NA
WP_012753891.1|553824_554586_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2I7RW72	Vibrio_phage	27.7	1.7e-05
>prophage 36
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	558329	559502	1261460		Yersinia_phage(100.0%)	1	NA	NA
WP_012753895.1|558329_559502_+	hypothetical protein	NA	G4KKC9	Yersinia_phage	37.5	6.7e-62
>prophage 37
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	564268	565081	1261460		Caulobacter_phage(100.0%)	1	NA	NA
WP_012753899.1|564268_565081_-	metallophosphoesterase	NA	K4K650	Caulobacter_phage	34.6	2.2e-40
>prophage 38
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	568674	569352	1261460		Streptococcus_phage(100.0%)	1	NA	NA
WP_012753905.1|568674_569352_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	40.7	2.3e-30
>prophage 39
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	586010	587219	1261460	transposase	Aeromonas_phage(100.0%)	1	NA	NA
WP_162094049.1|586010_587219_-|transposase	transposase	transposase	A0A1I9KF42	Aeromonas_phage	27.2	2.3e-17
>prophage 40
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	591212	591545	1261460		Ralstonia_phage(100.0%)	1	NA	NA
WP_012753927.1|591212_591545_+	hypothetical protein	NA	B2ZYH3	Ralstonia_phage	51.6	7.5e-19
>prophage 41
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	599629	602249	1261460		Cronobacter_phage(33.33%)	3	NA	NA
WP_012753939.1|599629_600958_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	43.4	2.5e-89
WP_012753940.1|600970_601405_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	40.0	8.3e-18
WP_012753941.1|601757_602249_+	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	45.3	2.6e-20
>prophage 42
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	606456	612552	1261460		Rhodococcus_phage(100.0%)	1	NA	NA
WP_012753949.1|606456_612552_+	putative Ig domain-containing protein	NA	G9FH37	Rhodococcus_phage	48.2	7.1e-06
>prophage 43
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	629202	630330	1261460	transposase	Microcystis_virus(100.0%)	1	NA	NA
WP_012753965.1|629202_630330_-|transposase	transposase	transposase	A0A7E5	Microcystis_virus	31.3	1.4e-16
>prophage 44
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	639881	643100	1261460		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_012753975.1|639881_643100_-	PAS domain S-box protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	34.5	1.6e-44
>prophage 45
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	646864	648216	1261460	transposase	Lactobacillus_phage(100.0%)	1	NA	NA
WP_076611865.1|646864_648216_-|transposase	IS3-like element ISMex37 family transposase	transposase	Q6J1X2	Lactobacillus_phage	29.1	4.3e-12
>prophage 46
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	652198	654504	1261460		Aeromonas_phage(50.0%)	3	NA	NA
WP_003599000.1|652198_652936_-	LuxR family transcriptional regulator	NA	A0A1I9KF49	Aeromonas_phage	28.6	2.4e-17
WP_003599002.1|653120_653687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003599004.1|653808_654504_-	response regulator transcription factor	NA	A0A0K0PVG9	Roseobacter_phage	50.0	2.1e-15
>prophage 47
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	674955	684862	1261460		Bradyrhizobium_phage(25.0%)	8	NA	NA
WP_012754009.1|674955_675702_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	3.7e-34
WP_012754010.1|675771_676164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003602949.1|676181_676859_+	RusA family crossover junction endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_012754011.1|676855_677359_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_012754012.1|677392_678070_-	hypothetical protein	NA	K4JRG5	Caulobacter_phage	35.9	6.0e-15
WP_012754013.1|678098_678557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012754014.1|678622_680746_-	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	26.7	2.7e-53
WP_012754015.1|680911_684862_+	DNA polymerase III subunit alpha	NA	A0A0K1Y8F0	Streptomyces_phage	33.8	1.9e-153
>prophage 48
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	695657	704538	1261460		Streptococcus_phage(33.33%)	5	NA	NA
WP_012754023.1|695657_698324_-	DNA topoisomerase 3	NA	A0A1X9I6W8	Streptococcus_phage	32.5	1.4e-35
WP_012754024.1|698385_699225_-	hypothetical protein	NA	Q4ZC36	Staphylococcus_virus	30.6	7.0e-05
WP_003604289.1|699396_699774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012754025.1|699793_700822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043767992.1|700863_704538_-	strawberry notch C-terminal domain-containing protein	NA	A0A0K0VLL6	Metopaulias_depressus_WSSV-like_virus	26.6	6.2e-05
>prophage 49
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	726619	734898	1261460	integrase	Mycobacterium_phage(50.0%)	9	729296:729311	737939:737954
WP_012754047.1|726619_726991_+	hypothetical protein	NA	A0A1V0ED00	Caulobacter_phage	31.5	3.5e-09
WP_050772725.1|726995_728447_+	DNA cytosine methyltransferase	NA	A0A2H4PAK4	Aphanizomenon_phage	32.7	2.3e-19
WP_012754049.1|728462_729263_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012754050.1|729275_729812_-	hypothetical protein	NA	NA	NA	NA	NA
729296:729311	attL	CGGCCGACCGCGCCGC	NA	NA	NA	NA
WP_012754051.1|729934_730735_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_193373953.1|731085_731754_+	DNA cytosine methyltransferase	NA	A0A076YHF8	Mycobacterium_phage	48.5	1.0e-11
WP_012754053.1|731955_733068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012754054.1|733239_733713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043767738.1|733926_734898_-|integrase	tyrosine-type recombinase/integrase	integrase	M4W8M4	Mycobacterium_phage	28.6	1.8e-12
737939:737954	attR	GCGGCGCGGTCGGCCG	NA	NA	NA	NA
>prophage 50
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	742491	754391	1261460		Corynebacterium_phage(25.0%)	7	NA	NA
WP_158022481.1|742491_750987_+	putative Ig domain-containing protein	NA	A0A1W6JQC9	Corynebacterium_phage	40.0	2.2e-05
WP_043767751.1|751272_751680_+	septal ring lytic transglycosylase RlpA family protein	NA	A0A0F6SJ38	Sinorhizobium_phage	56.0	8.3e-20
WP_012754067.1|751684_752083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012754068.1|752158_752611_+	DNA mismatch endonuclease Vsr	NA	I6NSG0	Burkholderia_phage	55.2	1.7e-34
WP_012754069.1|752670_752919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012754070.1|752997_753810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012754071.1|753806_754391_+	metallophosphoesterase	NA	A0A2H5BGP7	Vibrio_virus	38.2	1.3e-21
>prophage 51
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	806954	810495	1261460		Caulobacter_phage(33.33%)	4	NA	NA
WP_043768021.1|806954_807491_+	DUF262 domain-containing protein	NA	K4JUV4	Caulobacter_phage	53.4	1.7e-36
WP_012754120.1|807498_808488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012754121.1|808625_809852_+	DNA polymerase IV	NA	I6RSM4	Salmonella_phage	29.8	6.8e-17
WP_012754122.1|809973_810495_+	GIY-YIG nuclease family protein	NA	A0A0M4U442	Ralstonia_phage	34.1	9.7e-05
>prophage 52
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	820802	892007	1261460	transposase,protease,bacteriocin	Leptospira_phage(13.64%)	57	NA	NA
WP_012754133.1|820802_821786_+	ATP-binding protein	NA	A0A0U3CC34	Pseudomonas_phage	29.4	1.1e-14
WP_162094051.1|822040_823411_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_043767785.1|824385_825429_+|transposase	IS110-like element ISMex9 family transposase	transposase	A0A1S7J231	Thermus_phage	36.3	7.9e-06
WP_012754134.1|826041_826338_+	Twin-arginine translocation pathway signal precursor (fragment)	NA	NA	NA	NA	NA
WP_012754135.1|826371_827373_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_012754136.1|827435_828281_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	5.0e-51
WP_012754137.1|828417_828975_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.1	1.7e-15
WP_082222855.1|829043_829727_-	CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_003596034.1|829801_831451_+|transposase	ISL3-like element ISMex10 family transposase	transposase	NA	NA	NA	NA
WP_043766344.1|833478_834345_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	46.7	1.3e-51
WP_080577080.1|834341_835733_-|transposase	IS21-like element ISMex13 family transposase	transposase	U5N3F9	Enterobacteria_phage	34.1	1.1e-44
WP_085985478.1|836804_837903_+|transposase	IS3-like element ISMex11 family transposase	transposase	S5WIU1	Leptospira_phage	43.2	4.1e-53
WP_012754139.1|838466_839075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012754140.1|839183_840482_+	cytochrome c	NA	NA	NA	NA	NA
WP_012754141.1|840515_840977_+	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	38.5	8.5e-13
WP_158022503.1|840981_843282_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012754143.1|843567_844389_-|bacteriocin	bacteriocin family protein	bacteriocin	NA	NA	NA	NA
WP_012754144.1|844381_845458_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_193373954.1|845711_845966_-	DUF2171 domain-containing protein	NA	NA	NA	NA	NA
WP_012754146.1|846068_848684_-	ATP-dependent chaperone ClpB	NA	A0A2I7SAX5	Vibrio_phage	36.2	2.6e-122
WP_043767798.1|848877_849141_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012754148.1|849143_850046_-	J domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	29.3	5.0e-25
WP_043767800.1|850268_852173_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.2	3.1e-149
WP_082222856.1|852328_852985_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_085985476.1|855362_856546_-|transposase	IS3-like element ISMex5 family transposase	transposase	S5WIU1	Leptospira_phage	32.4	7.3e-32
WP_158022504.1|856560_857886_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_162094043.1|857957_858110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085985479.1|858175_859314_-|transposase	IS3-like element ISMex7 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	30.1	2.0e-18
WP_043768053.1|859901_860393_-	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_012754152.1|860507_860999_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_012754153.1|861019_861418_-	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	29.8	5.1e-06
WP_012754154.1|861432_861858_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_012754155.1|862060_862492_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012754156.1|862506_864339_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	A0A0P0CCN8	Ostreococcus_mediterraneus_virus	42.8	3.4e-105
WP_012754157.1|864401_867296_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.9	1.2e-123
WP_012754158.1|867373_868546_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_043767813.1|868542_869190_+	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_012754161.1|869401_870022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012754162.1|870023_870587_+	ETC complex I subunit	NA	NA	NA	NA	NA
WP_012754163.1|871470_872385_+	heat resistance protein YfdX1	NA	NA	NA	NA	NA
WP_012754164.1|872487_873375_+	heat resistance protein YfdX2	NA	NA	NA	NA	NA
WP_085985478.1|873526_874625_+|transposase	IS3-like element ISMex11 family transposase	transposase	S5WIU1	Leptospira_phage	43.2	4.1e-53
WP_012754165.1|875465_875867_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_012754166.1|876178_876475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012754167.1|876511_877135_-	AAA family ATPase	NA	A2I303	Vibrio_virus	37.6	1.3e-19
WP_012754168.1|877202_877508_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_012754169.1|877507_877774_-	CopG family ribbon-helix-helix protein	NA	NA	NA	NA	NA
WP_003596034.1|879428_881078_-|transposase	ISL3-like element ISMex10 family transposase	transposase	NA	NA	NA	NA
WP_009867550.1|881319_882588_-|transposase	IS256-like element ISMex3 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.7	2.5e-91
WP_158022486.1|883935_884388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012754171.1|884469_885309_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_012754172.1|885512_886682_-	glutathione-dependent formaldehyde dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.1	6.5e-09
WP_012754173.1|886694_887402_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_012754174.1|887991_888432_-	thioredoxin TrxC	NA	A0A023NHA9	Dinoroseobacter_phage	35.6	2.5e-14
WP_012754175.1|888781_889408_-	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_043767605.1|889641_891141_+|transposase	IS21-like element ISMex8 family transposase	transposase	NA	NA	NA	NA
WP_043767602.1|891137_892007_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	39.1	1.8e-40
>prophage 53
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	903148	908885	1261460		Bacillus_phage(50.0%)	4	NA	NA
WP_162094052.1|903148_905272_+	flap endonuclease	NA	U5PWU8	Bacillus_phage	30.9	1.5e-16
WP_158022489.1|905579_906128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012754186.1|906134_907220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012754187.1|907337_908885_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	42.6	2.6e-90
>prophage 54
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	913401	918139	1261460		Bacillus_phage(50.0%)	5	NA	NA
WP_012754196.1|913401_916275_+	DNA polymerase I	NA	B6V2J7	Bacillus_phage	34.2	1.2e-43
WP_003597064.1|916274_916529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012754197.1|916518_916773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012754198.1|916769_917363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012754199.1|917422_918139_+	DUF2786 domain-containing protein	NA	A0A219VHD3	Ochrobactrum_phage	28.4	1.2e-08
>prophage 55
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	922395	924081	1261460		Clostridioides_phage(50.0%)	3	NA	NA
WP_003597049.1|922395_923148_+	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	32.8	4.0e-12
WP_003597048.1|923210_923576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003597046.1|923634_924081_+	NUDIX hydrolase	NA	S5VM37	Pseudomonas_phage	31.9	1.2e-08
>prophage 56
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	928121	935235	1261460		Ectocarpus_siliculosus_virus(33.33%)	5	NA	NA
WP_003597039.1|928121_930260_+	hybrid sensor histidine kinase/response regulator	NA	Q8QKY1	Ectocarpus_siliculosus_virus	26.5	3.2e-06
WP_003597038.1|930256_932395_-	NAD-dependent DNA ligase LigA	NA	A0A1W6DX16	Sphingobium_phage	40.2	4.4e-120
WP_012754209.1|932507_933002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003597034.1|933191_934088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003597030.1|934200_935235_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	33.3	3.0e-05
>prophage 57
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	959724	972299	1261460	transposase	Leptospira_phage(40.0%)	8	NA	NA
WP_003597898.1|959724_962862_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.1	1.1e-55
WP_003597899.1|962980_963124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003597900.1|963245_963947_-	sigma-70 family RNA polymerase sigma factor	NA	A0A076YQ50	Rhizobium_phage	32.7	1.0e-09
WP_003596034.1|964054_965704_+|transposase	ISL3-like element ISMex10 family transposase	transposase	NA	NA	NA	NA
WP_085985480.1|965780_966963_+|transposase	IS3-like element ISMex5 family transposase	transposase	S5WIU1	Leptospira_phage	32.4	7.3e-32
WP_158022491.1|967022_967322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082222861.1|968010_970023_+	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	24.5	8.6e-09
WP_003602298.1|970109_972299_+	recombinase family protein	NA	A0A1B2LRQ3	Wolbachia_phage	28.1	3.1e-12
>prophage 58
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	975382	976081	1261460		Bacillus_virus(100.0%)	1	NA	NA
WP_003602290.1|975382_976081_+	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	27.9	3.0e-17
>prophage 59
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	989636	991529	1261460		Bacillus_virus(100.0%)	1	NA	NA
WP_012754224.1|989636_991529_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	35.9	3.9e-19
>prophage 60
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	995620	995944	1261460		Pseudomonas_phage(100.0%)	1	NA	NA
WP_003605653.1|995620_995944_+	hypothetical protein	NA	A0A0S0N7T5	Pseudomonas_phage	38.2	4.6e-05
>prophage 61
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	1001682	1008624	1261460	transposase	Bacillus_phage(25.0%)	5	NA	NA
WP_003606519.1|1001682_1002762_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.5	1.6e-17
WP_012754227.1|1003247_1004411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050772732.1|1004462_1004873_+	HNH endonuclease	NA	A0A223W0A5	Agrobacterium_phage	36.4	2.1e-10
WP_043766665.1|1004869_1005496_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	50.5	1.3e-35
WP_043765841.1|1005633_1008624_+|transposase	Tn3-like element ISMex22 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	35.3	1.7e-157
>prophage 62
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	1013880	1014990	1261460		Rhizobium_phage(100.0%)	1	NA	NA
WP_012754231.1|1013880_1014990_+	DNA phosphorothioation system sulfurtransferase DndC	NA	R9TRT5	Rhizobium_phage	27.6	3.6e-17
>prophage 63
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	1022462	1023290	1261460		Mycobacterium_phage(100.0%)	1	NA	NA
WP_012754238.1|1022462_1023290_+	hypothetical protein	NA	A0A0B5A3N8	Mycobacterium_phage	34.8	1.4e-05
>prophage 64
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	1027260	1029594	1261460		Clostridium_phage(100.0%)	1	NA	NA
WP_158022492.1|1027260_1029594_-	SEL1-like repeat protein	NA	A0A0A7RWA3	Clostridium_phage	37.9	1.3e-21
>prophage 65
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	1034626	1039990	1261460	transposase	Bacillus_phage(50.0%)	2	NA	NA
WP_012754247.1|1034626_1037977_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	39.4	2.0e-02
WP_043767861.1|1039060_1039990_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	29.9	4.1e-14
>prophage 66
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	1061229	1065067	1261460		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_012754270.1|1061229_1062510_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	39.9	2.3e-39
WP_012754271.1|1062534_1062798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158022506.1|1063858_1065067_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	61.7	1.0e-113
>prophage 67
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	1097525	1151823	1261460	transposase,integrase	uncultured_Mediterranean_phage(30.0%)	40	1092363:1092381	1162944:1162962
1092363:1092381	attL	GGCTGCGGATCCAGTCCGC	NA	NA	NA	NA
WP_012754319.1|1097525_1098107_-	metallophosphoesterase	NA	A0A0P0IYW4	Pseudomonas_phage	39.6	4.6e-24
WP_158022495.1|1098199_1099462_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_003596097.1|1100139_1105398_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	22.8	2.5e-55
WP_003596095.1|1105394_1108154_+	DEAD/DEAH box helicase	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	26.2	2.9e-31
WP_003596094.1|1108153_1112143_+	N-6 DNA methylase	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	23.5	2.2e-40
WP_003596092.1|1112139_1112946_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_085985459.1|1113076_1114187_+|transposase	IS3-like element ISMex1 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	6.8e-48
WP_003596089.1|1114502_1115711_+|transposase	IS256-like element ISMex14 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	48.5	4.9e-92
WP_003596081.1|1115698_1116364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085985481.1|1116455_1117567_-|transposase	IS3-like element ISMex1 family transposase	transposase	S5WIU1	Leptospira_phage	40.3	2.0e-47
WP_003596078.1|1117899_1119093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003596075.1|1120680_1120947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009867550.1|1122453_1123722_+|transposase	IS256-like element ISMex3 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.7	2.5e-91
WP_003596073.1|1124999_1125995_+	DMT family transporter	NA	NA	NA	NA	NA
WP_003596072.1|1126020_1127037_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003596071.1|1127151_1127469_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003596070.1|1127540_1128419_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003596069.1|1128508_1129255_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_003596067.1|1129680_1130253_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003596066.1|1130352_1130775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003596065.1|1130771_1131719_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003596064.1|1131772_1132627_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003596063.1|1132727_1133729_+	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003596062.1|1133818_1134928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003596061.1|1134940_1135378_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003596060.1|1135769_1136912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012754324.1|1137355_1137823_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003596058.1|1137854_1138760_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003596057.1|1138896_1139640_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003596055.1|1139653_1140007_+	VOC family protein	NA	NA	NA	NA	NA
WP_003596053.1|1141029_1141839_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	1.0e-21
WP_003596052.1|1141851_1142724_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003596050.1|1142727_1143561_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_003596049.1|1143569_1144589_+	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_003596048.1|1144616_1145486_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003596046.1|1145658_1146459_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_043706435.1|1146754_1147237_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003596044.1|1147812_1148850_+	transporter	NA	NA	NA	NA	NA
WP_003596043.1|1148903_1149350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085985482.1|1150639_1151823_-|transposase	IS3-like element ISMex5 family transposase	transposase	S5WIU1	Leptospira_phage	32.0	1.6e-31
1162944:1162962	attR	GCGGACTGGATCCGCAGCC	NA	NA	NA	NA
>prophage 68
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	1178820	1179507	1261460		Caulobacter_phage(100.0%)	1	NA	NA
WP_003595982.1|1178820_1179507_+	hypothetical protein	NA	K4JRZ2	Caulobacter_phage	35.8	1.9e-24
>prophage 69
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	1186945	1190708	1261460		Emiliania_huxleyi_virus(50.0%)	6	NA	NA
WP_003595967.1|1186945_1187614_-	ribonuclease HII	NA	D2TEQ2	Emiliania_huxleyi_virus	36.0	7.5e-18
WP_003595966.1|1187624_1187873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003595965.1|1187869_1188079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003595963.1|1188075_1189272_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_003595962.1|1189310_1189790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003595959.1|1189814_1190708_-	RNA ligase family protein	NA	U5PS25	Bacillus_phage	31.5	3.6e-07
>prophage 70
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	1197652	1198822	1261460		Ralstonia_phage(100.0%)	1	NA	NA
WP_003603642.1|1197652_1198822_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	38.0	3.5e-63
>prophage 71
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	1203405	1216419	1261460	transposase	Bacillus_phage(25.0%)	11	NA	NA
WP_003603637.1|1203405_1205121_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	24.1	1.3e-21
WP_003603635.1|1205120_1206416_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003603633.1|1206517_1208557_+	response regulator	NA	A0A1V0SGX0	Hokovirus	31.7	5.4e-43
WP_003603631.1|1208615_1209122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012754339.1|1209233_1210160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003605542.1|1210164_1210698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003605543.1|1210782_1211448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003605544.1|1211550_1213146_+	RNA polymerase sigma factor RpoD/SigA	NA	F4YCU2	Synechococcus_phage	40.5	4.8e-39
WP_012754340.1|1213204_1214818_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_003605548.1|1214844_1215225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003605550.1|1215291_1216419_-|transposase	transposase	transposase	A0A7E5	Microcystis_virus	36.2	1.7e-22
>prophage 72
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	1244469	1245477	1261460		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_003603519.1|1244469_1245477_+	hypothetical protein	NA	A0A1B1IPE0	uncultured_Mediterranean_phage	45.5	1.3e-74
>prophage 73
NC_012811	Methylorubrum extorquens AM1 megaplasmid, complete sequence	1261460	1251304	1255040	1261460		Orpheovirus(50.0%)	4	NA	NA
WP_003604198.1|1251304_1251934_+	hypothetical protein	NA	A0A2I2L698	Orpheovirus	34.6	7.5e-20
WP_003604200.1|1252100_1252607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003604201.1|1252927_1253350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003604202.1|1253420_1255040_+	AAA family ATPase	NA	E3T5P9	Cafeteria_roenbergensis_virus	27.1	9.3e-06
>prophage 1
NC_012807	Methylorubrum extorquens AM1 plasmid p1META1, complete sequence	44195	0	1719	44195		Enterobacteria_phage(100.0%)	1	NA	NA
WP_043766665.1|1092_1719_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	50.5	1.3e-35
>prophage 2
NC_012807	Methylorubrum extorquens AM1 plasmid p1META1, complete sequence	44195	5763	11975	44195		Mycobacterium_phage(20.0%)	7	NA	NA
WP_012751911.1|5763_6435_-	ParA family protein	NA	A0A142F1W4	Mycobacterium_phage	32.0	8.0e-12
WP_050772747.1|6771_8805_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.5	1.8e-38
WP_012751913.1|8862_9885_-	DUF1738 domain-containing protein	NA	A0A1V0EBY3	Caulobacter_phage	56.6	2.0e-70
WP_043768230.1|10363_10696_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_012751915.1|10732_11047_+	XRE family transcriptional regulator	NA	A0A0D5BHH6	Escherichia_phage	31.9	5.8e-05
WP_012751916.1|11105_11291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043768233.1|11390_11975_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	41.8	1.7e-29
>prophage 3
NC_012807	Methylorubrum extorquens AM1 plasmid p1META1, complete sequence	44195	16099	19393	44195		Leptospira_phage(100.0%)	1	NA	NA
WP_012751925.1|16099_19393_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.4	7.6e-55
>prophage 4
NC_012807	Methylorubrum extorquens AM1 plasmid p1META1, complete sequence	44195	27931	34105	44195	transposase	Enterobacteria_phage(50.0%)	5	NA	NA
WP_082222869.1|27931_29794_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.7	4.9e-91
WP_080577080.1|29805_31197_+|transposase	IS21-like element ISMex13 family transposase	transposase	U5N3F9	Enterobacteria_phage	34.1	1.1e-44
WP_043766344.1|31193_32060_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	46.7	1.3e-51
WP_043768270.1|32328_32907_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_076612078.1|32876_34105_-|transposase	IS3-like element ISMex33 family transposase	transposase	Q8W6R2	Burkholderia_virus	67.6	1.1e-104
>prophage 1
NC_012809	Methylorubrum extorquens AM1 plasmid p2META1, complete sequence	37858	0	1732	37858		Enterobacteria_phage(100.0%)	1	NA	NA
WP_043766665.1|1105_1732_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	50.5	1.3e-35
>prophage 2
NC_012809	Methylorubrum extorquens AM1 plasmid p2META1, complete sequence	37858	5131	20937	37858	transposase	Vibrio_phage(12.5%)	16	NA	NA
WP_043768327.1|5131_5785_-	ParA family protein	NA	D4HTX7	Vibrio_phage	29.6	3.0e-11
WP_043768329.1|6089_7046_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_012753464.1|7340_7667_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	43.8	5.4e-14
WP_043768332.1|7666_7984_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_012753466.1|8031_9714_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_043768335.1|9720_10161_-	hypothetical protein	NA	A0A097EYP5	Mycobacterium_phage	41.3	1.3e-15
WP_012753468.1|10165_10750_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	51.1	8.5e-42
WP_082222874.1|10998_11883_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043768345.1|13299_14052_-|transposase	IS6-like element ISMex25 family transposase	transposase	A0A0N9SKD3	Staphylococcus_phage	38.0	1.5e-30
WP_050772750.1|14048_14519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043768348.1|14950_15436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043768352.1|15624_16194_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	47.8	1.1e-33
WP_043768356.1|16351_19315_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	38.1	7.3e-182
WP_012753471.1|19595_19898_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_158022513.1|19922_20354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043768363.1|20376_20937_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	40.3	4.8e-26
>prophage 3
NC_012809	Methylorubrum extorquens AM1 plasmid p2META1, complete sequence	37858	27532	35793	37858	transposase	Saccharomonospora_phage(25.0%)	10	NA	NA
WP_043768368.1|27532_27964_-|transposase	IS200/IS605-like element ISMex34 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.7	4.0e-12
WP_043768370.1|28368_28686_+	integration host factor subunit beta	NA	A0A249Y2G7	Serratia_phage	40.0	1.0e-09
WP_043768371.1|29086_29419_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_012753486.1|29655_30360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012753487.1|30374_33269_-	Ti-type conjugative transfer relaxase TraA	NA	V5UQN3	Mycobacterium_phage	23.9	2.1e-08
WP_043768374.1|33503_33785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012753488.1|33781_34039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012753489.1|34048_34381_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_158022514.1|34337_34637_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_043768345.1|35040_35793_-|transposase	IS6-like element ISMex25 family transposase	transposase	A0A0N9SKD3	Staphylococcus_phage	38.0	1.5e-30
>prophage 1
NC_012810	Methylorubrum extorquens AM1 plasmid p3META1, complete sequence	24943	0	9746	24943		Mycobacterium_phage(33.33%)	11	NA	NA
WP_158022516.1|2063_3713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158022519.1|3681_4578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012753493.1|4567_5257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012753494.1|5358_5592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043768391.1|5596_6022_-	hypothetical protein	NA	G8I4T1	Mycobacterium_phage	36.8	2.5e-11
WP_012753496.1|6276_6924_+	ParA family protein	NA	B0ZSI1	Halomonas_phage	31.3	4.7e-09
WP_012753497.1|6923_7295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012753498.1|7341_7893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158022517.1|7959_8445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043768398.1|8495_8678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012753501.1|8978_9746_+	GntR family transcriptional regulator	NA	A0A0A8IK91	Aurantimonas_phage	33.0	2.2e-13
>prophage 2
NC_012810	Methylorubrum extorquens AM1 plasmid p3META1, complete sequence	24943	12782	13049	24943		Burkholderia_phage(100.0%)	1	NA	NA
WP_012753506.1|12782_13049_+	pyocin activator PrtN family protein	NA	I6NSR8	Burkholderia_phage	64.6	8.9e-23
>prophage 3
NC_012810	Methylorubrum extorquens AM1 plasmid p3META1, complete sequence	24943	19477	23444	24943	tail	Clostridium_phage(50.0%)	6	NA	NA
WP_082222876.1|19477_20158_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	48.8	1.4e-27
WP_012753519.1|20310_20586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043768404.1|20572_20797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012753521.1|20997_21303_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085985484.1|21299_22766_+|tail	phage tail length tape measure family protein	tail	NA	NA	NA	NA
WP_043766665.1|22817_23444_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	50.5	1.3e-35
