The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_012668	Vibrio cholerae MJ-1236 chromosome 1, complete sequence	3149584	50762	58025	3149584		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_001279365.1|50762_51650_+	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	41.1	4.1e-56
WP_001894770.1|51917_54506_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.0	2.2e-33
WP_000116737.1|54598_55606_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.2	6.0e-35
WP_000177568.1|55679_56615_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	34.7	7.8e-05
WP_000002982.1|56614_57241_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.1	2.0e-36
WP_001883363.1|57233_58025_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.6	8.4e-69
>prophage 2
NC_012668	Vibrio cholerae MJ-1236 chromosome 1, complete sequence	3149584	1165272	1171889	3149584		Staphylococcus_phage(66.67%)	7	NA	NA
WP_000210573.1|1165272_1166406_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.4e-64
WP_001890340.1|1166414_1167668_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	49.5	5.0e-100
WP_000543544.1|1167767_1168217_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001131994.1|1168242_1169346_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.1	1.3e-43
WP_000493874.1|1169350_1170004_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.2	1.2e-31
WP_001122865.1|1170044_1171154_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.8	6.7e-64
WP_000864130.1|1171418_1171889_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.7	6.8e-34
>prophage 3
NC_012668	Vibrio cholerae MJ-1236 chromosome 1, complete sequence	3149584	1226688	1292654	3149584	integrase,tail,head,portal,capsid,terminase,tRNA	Vibrio_phage(91.3%)	71	1260229:1260252	1293338:1293361
WP_000216841.1|1226688_1228113_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000731531.1|1228408_1229374_+	OmpA family protein	NA	NA	NA	NA	NA
WP_001017843.1|1229462_1230161_-	Fe3+-citrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000279435.1|1230580_1232644_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_000064348.1|1232947_1233763_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_001923521.1|1234020_1241262_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	22.9	2.9e-30
WP_000739493.1|1241391_1242525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000759070.1|1242685_1243321_+	membrane protein	NA	NA	NA	NA	NA
WP_001881911.1|1243328_1243766_+	flagellar assembly lipoprotein FlgP	NA	NA	NA	NA	NA
WP_001881909.1|1243875_1244307_-	molecular chaperone	NA	NA	NA	NA	NA
WP_000907265.1|1244404_1244728_-	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
WP_001881906.1|1244858_1245626_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_000145786.1|1245682_1246609_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.6	1.4e-35
WP_000125387.1|1246619_1247447_+	chemotaxis protein methyltransferase 1	NA	NA	NA	NA	NA
WP_001007981.1|1247666_1248062_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_000051920.1|1248066_1248483_+	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_000929365.1|1248500_1249208_+	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_000122825.1|1249236_1250541_+	flagellar hook protein FlgE	NA	NA	NA	NA	NA
WP_000373284.1|1250723_1251473_+	flagellar basal-body rod protein FlgF	NA	NA	NA	NA	NA
WP_001182097.1|1251492_1252281_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_000729679.1|1252295_1253081_+	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_001225051.1|1253171_1254257_+	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_000609516.1|1254267_1255206_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M9Y4	Brevibacillus_phage	31.9	9.5e-11
WP_000135483.1|1255385_1257260_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_000934642.1|1257272_1258466_+	flagellar hook-associated protein FlgL	NA	NA	NA	NA	NA
WP_001938933.1|1258563_1258725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000154827.1|1258873_1260013_+	flagellin	NA	NA	NA	NA	NA
1260229:1260252	attL	GAAAAGGGGCTTTTCTTTTTTCTG	NA	NA	NA	NA
WP_000116333.1|1260461_1261499_-|integrase	site-specific integrase	integrase	U3PIJ4	Vibrio_phage	100.0	1.5e-198
WP_000985033.1|1261498_1261912_-	hypothetical protein	NA	U3PDE6	Vibrio_phage	100.0	8.9e-70
WP_000132153.1|1261911_1262817_-	NAD-dependent DNA ligase	NA	U3PB51	Vibrio_phage	100.0	1.3e-161
WP_001881894.1|1262842_1263490_-	phage repressor protein CI	NA	A0A166YHA0	Vibrio_phage	100.0	1.1e-119
WP_000959026.1|1263635_1263848_+	hypothetical protein	NA	U3PFJ1	Vibrio_phage	100.0	6.4e-32
WP_000253093.1|1263958_1264498_+	hypothetical protein	NA	U3PIJ8	Vibrio_phage	100.0	5.5e-96
WP_001272765.1|1264510_1264945_+	hypothetical protein	NA	U3PDF0	Vibrio_phage	100.0	2.8e-74
WP_001031152.1|1265026_1265560_+	hypothetical protein	NA	U3PB56	Vibrio_phage	100.0	3.9e-86
WP_000997540.1|1265556_1265967_+	hypothetical protein	NA	U3PCE8	Vibrio_phage	100.0	1.8e-75
WP_001881891.1|1265968_1266214_+	hypothetical protein	NA	U3PFJ5	Vibrio_phage	100.0	2.4e-46
WP_001198814.1|1266216_1266444_+	hypothetical protein	NA	U3PIK2	Vibrio_phage	100.0	3.2e-37
WP_000099608.1|1266440_1267058_+	DNA methyltransferase	NA	U3PDF3	Vibrio_phage	100.0	1.2e-118
WP_000629095.1|1267054_1267165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000613058.1|1267161_1267746_+	hypothetical protein	NA	U3PB60	Vibrio_phage	100.0	3.2e-105
WP_001909657.1|1267742_1270328_+	replication endonuclease	NA	A0A166YHE2	Vibrio_phage	99.9	0.0e+00
WP_000756239.1|1270337_1270874_+	DUF262 domain-containing protein	NA	U3PFK3	Vibrio_phage	100.0	4.1e-99
WP_001140408.1|1270947_1271286_-	helix-turn-helix transcriptional regulator	NA	U3PIK7	Vibrio_phage	100.0	2.8e-53
WP_001292395.1|1271523_1271769_+	hypothetical protein	NA	U3PDF9	Vibrio_phage	100.0	1.5e-37
WP_001263191.1|1271769_1272021_-	ogr/Delta-like zinc finger family protein	NA	U3PB63	Vibrio_phage	100.0	1.9e-43
WP_000729650.1|1272091_1272307_-	hypothetical protein	NA	U3PCF7	Vibrio_phage	100.0	3.1e-34
WP_001999948.1|1272290_1273337_-|portal	phage portal protein	portal	U3PFK6	Vibrio_phage	100.0	5.7e-206
WP_000331803.1|1273333_1275151_-|terminase	terminase ATPase subunit family protein	terminase	U3PIL1	Vibrio_phage	100.0	0.0e+00
WP_001127095.1|1275324_1276224_+|capsid	GPO family capsid scaffolding protein	capsid	A0A160DHM4	Vibrio_phage	100.0	4.0e-123
WP_000078361.1|1276260_1277271_+|capsid	phage major capsid protein, P2 family	capsid	U3PB67	Vibrio_phage	100.0	7.0e-193
WP_000059165.1|1277286_1278003_+|terminase	terminase endonuclease subunit	terminase	U3PCG2	Vibrio_phage	100.0	1.3e-132
WP_000493401.1|1278109_1278571_+|head	head completion/stabilization protein	head	U3PFL1	Vibrio_phage	100.0	1.5e-78
WP_000122189.1|1278567_1279056_+	hypothetical protein	NA	U3PIL4	Vibrio_phage	100.0	1.6e-89
WP_000461677.1|1279042_1279702_+	phage virion morphogenesis protein	NA	U3PDG7	Vibrio_phage	100.0	9.1e-117
WP_000312540.1|1279703_1280813_+	DUF2586 family protein	NA	U3PB71	Vibrio_phage	100.0	1.5e-209
WP_000063627.1|1280812_1281271_+	DUF2597 family protein	NA	U3PCG7	Vibrio_phage	100.0	1.3e-82
WP_000382491.1|1281285_1281495_+	TraR/DksA family transcriptional regulator	NA	U3PFL5	Vibrio_phage	100.0	2.0e-33
WP_001077689.1|1281491_1281719_+	hypothetical protein	NA	U3PIL8	Vibrio_phage	100.0	2.1e-36
WP_000705022.1|1281705_1282293_+	lysozyme	NA	U3PDH1	Vibrio_phage	100.0	2.5e-110
WP_000990572.1|1282267_1282609_+	hypothetical protein	NA	U3PB75	Vibrio_phage	100.0	1.1e-52
WP_000165786.1|1282816_1283098_+	hypothetical protein	NA	A9ZT39	Vibrio_virus	100.0	5.1e-45
WP_000343647.1|1283294_1285112_+|tail	phage tail tape measure protein	tail	U3PFL8	Vibrio_phage	100.0	0.0e+00
WP_001113003.1|1285101_1285434_+	DUF2590 family protein	NA	U3PIM1	Vibrio_phage	100.0	1.7e-55
WP_000044509.1|1285430_1286630_+	hypothetical protein	NA	U3PDH5	Vibrio_phage	100.0	1.0e-222
WP_000005870.1|1286626_1287286_+	hypothetical protein	NA	U3PB79	Vibrio_phage	100.0	8.2e-126
WP_000083759.1|1287282_1289145_+|tail	phage tail protein	tail	Q8HA58	Vibrio_phage	100.0	0.0e+00
WP_000369865.1|1289144_1289669_+	hypothetical protein	NA	U3PFM2	Vibrio_phage	100.0	1.1e-96
WP_000267787.1|1289671_1290565_+	hypothetical protein	NA	U3PIM3	Vibrio_phage	100.0	2.8e-161
WP_000457681.1|1290552_1291026_+	hypothetical protein	NA	U3PDI0	Vibrio_phage	100.0	6.6e-77
WP_000779002.1|1291022_1292654_+	hypothetical protein	NA	U3PB83	Vibrio_phage	100.0	0.0e+00
1293338:1293361	attR	GAAAAGGGGCTTTTCTTTTTTCTG	NA	NA	NA	NA
>prophage 4
NC_012668	Vibrio cholerae MJ-1236 chromosome 1, complete sequence	3149584	2855417	2862610	3149584		Anguillid_herpesvirus(16.67%)	9	NA	NA
WP_001162850.1|2855417_2855846_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	38.4	1.0e-20
WP_000107237.1|2856049_2857339_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	34.3	1.7e-34
WP_000872176.1|2857558_2857753_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124187.1|2857801_2858140_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196560.1|2858153_2860004_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.1	5.3e-106
WP_001105747.1|2860027_2860543_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000301571.1|2860591_2860915_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	50.5	3.0e-25
WP_000331703.1|2860975_2861359_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.2	5.4e-53
WP_000775253.1|2861395_2862610_-	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	30.5	1.1e-32
>prophage 1
NC_012667	Vibrio cholerae MJ-1236 chromosome 2, complete sequence	1086784	852232	858550	1086784		Vibrio_phage(77.78%)	9	NA	NA
WP_000593519.1|852232_852607_-	cholera enterotoxin binding subunit CtxB	NA	A0A142I6Y1	Vibrio_phage	100.0	5.9e-65
WP_001881225.1|852603_853380_-	cholera enterotoxin catalytic subunit CtxA	NA	A0A142I6Y0	Vibrio_phage	100.0	1.3e-151
WP_000021616.1|853478_854678_-	zonula occludens toxin ZOT	NA	A0A142I6Z1	Vibrio_phage	100.0	5.3e-240
WP_000979342.1|854674_854968_-	accessory cholera enterotoxin	NA	A0A0F6YNQ7	Vibrio_phage	100.0	3.7e-46
WP_001881237.1|854964_856248_-	hypothetical protein	NA	A0A142I701	Vibrio_phage	100.0	9.1e-222
WP_000493022.1|856258_856507_-	colonization factor	NA	A0A0N7F140	Vibrio_phage	100.0	8.8e-33
WP_001890610.1|856642_857026_-	hypothetical protein	NA	F1CC65	Vibrio_virus	100.0	4.8e-70
WP_000743997.1|857003_858083_-	hypothetical protein	NA	U5TQR3	Satellite_phage	100.0	2.2e-213
WP_000492997.1|858214_858550_+	helix-turn-helix transcriptional regulator	NA	A0A0N9HJE7	Vibrio_phage	100.0	4.7e-53
