The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_012759	Escherichia coli BW2952, complete sequence	4578159	456593	487616	4578159	transposase,tRNA,integrase,protease,lysis	Enterobacteria_phage(56.52%)	39	466738:466784	488040:488086
WP_000912385.1|456593_457979_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|458014_458536_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|458643_458856_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|458857_459724_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|460194_460737_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|460956_461649_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|461679_464283_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|464261_465302_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|465312_465828_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|465830_466463_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
466738:466784	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|466797_467961_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|468080_468344_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|468666_468762_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_085947771.1|468824_469986_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001070439.1|470297_470630_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|470677_470827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|470884_472411_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|472875_473427_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|473436_474234_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|474350_474452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|474448_474904_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|474903_475074_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|475066_475357_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|475353_475716_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|475712_475853_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|475938_476322_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|476719_477736_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000737282.1|477740_478808_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_000839596.1|479380_479596_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|479595_480093_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|480309_480492_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|480582_480876_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|481166_481577_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|481862_482069_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|482233_482428_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|482816_483362_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_026089880.1|484134_484761_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000386784.1|485663_486413_+	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_001201845.1|486662_487616_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
488040:488086	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 2
NC_012759	Escherichia coli BW2952, complete sequence	4578159	1284948	1326976	4578159	tRNA,transposase,integrase,lysis,tail	Escherichia_phage(45.16%)	45	1289656:1289674	1317680:1317698
WP_010723085.1|1284948_1285965_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000605090.1|1286237_1286495_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_001262123.1|1286544_1287495_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000611911.1|1287646_1288399_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
1289656:1289674	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000945011.1|1289803_1290319_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
WP_000062973.1|1290329_1291856_-	p-aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_001156451.1|1291892_1293338_-	p-aminobenzoyl-glutamate hydrolase subunit AbgB	NA	NA	NA	NA	NA
WP_000444929.1|1293337_1294648_-	p-aminobenzoyl-glutamate hydrolase subunit AbgA	NA	NA	NA	NA	NA
WP_000885458.1|1294823_1295732_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046829.1|1296061_1296625_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628058.1|1296645_1297878_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1298132_1299116_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|1299593_1300967_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|1301095_1302031_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|1302082_1303318_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1303319_1303535_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1303613_1303823_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1303815_1304010_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1304066_1304876_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|1304868_1307469_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|1307570_1307846_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1307920_1308091_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|1308090_1308312_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|1308753_1309242_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1309238_1309394_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|1309847_1310324_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|1310447_1310744_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|1310766_1311189_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|1311201_1312059_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|1312065_1312812_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|1312834_1313395_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|1313482_1313668_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|1313864_1315322_+	Trk system potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001350510.1|1315459_1315723_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|1315703_1316063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001755909.1|1316170_1316371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019448.1|1317828_1318809_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
1317680:1317698	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
WP_000279097.1|1319131_1322494_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_001698950.1|1322493_1323069_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086527.1|1323166_1323757_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|1324073_1324307_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|1324375_1324489_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001157926.1|1324828_1325002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300461.1|1325267_1325702_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|1325842_1326976_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 3
NC_012759	Escherichia coli BW2952, complete sequence	4578159	1519535	1538746	4578159	lysis,tail	Enterobacteria_phage(40.91%)	34	NA	NA
WP_000527743.1|1519535_1520996_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_120795384.1|1522972_1523086_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1523154_1523388_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|1523704_1524295_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|1524392_1524968_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|1524967_1525930_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|1525880_1526450_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|1526838_1527072_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1527129_1527540_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1527691_1527865_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1528036_1528192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1528270_1528336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|1528338_1528527_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1528537_1528750_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1529112_1529610_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1529606_1530140_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1530136_1530448_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1530452_1530668_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1531421_1531637_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1531937_1532150_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1532204_1532294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001047135.1|1532571_1533324_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|1533337_1534387_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|1534388_1534667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1534733_1534985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1535201_1535357_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1535428_1535716_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1535715_1535955_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1535979_1536285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1536487_1536820_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|1537256_1537406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1537702_1537933_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1538016_1538424_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1538590_1538746_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
>prophage 4
NC_012759	Escherichia coli BW2952, complete sequence	4578159	1997732	2006403	4578159		Escherichia_phage(28.57%)	8	NA	NA
WP_000272486.1|1997732_1998836_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
WP_001393538.1|1998843_2000091_-	O16 family O-antigen flippase	NA	NA	NA	NA	NA
WP_001100981.1|2000087_2000645_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
WP_000783975.1|2000644_2001526_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
WP_001023610.1|2001583_2002483_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.5e-29
WP_000699460.1|2002482_2003568_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
WP_000183060.1|2003940_2004834_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001116026.1|2005008_2006403_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 5
NC_012759	Escherichia coli BW2952, complete sequence	4578159	2349127	2360337	4578159	integrase,tail	Enterobacteria_phage(53.33%)	16	2347102:2347118	2364012:2364028
2347102:2347118	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|2349127_2350060_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|2350371_2351529_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|2351681_2352044_+	bactoprenol glucosyl transferase	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000703651.1|2352040_2352961_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_001030215.1|2352957_2354289_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|2354323_2354605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|2354903_2355344_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|2355370_2355889_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|2355938_2356214_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|2356213_2356708_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000135673.1|2357430_2357793_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|2357858_2358683_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|2358810_2359347_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|2359337_2359700_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|2359699_2360005_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|2360136_2360337_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
2364012:2364028	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 6
NC_012759	Escherichia coli BW2952, complete sequence	4578159	2740926	2748065	4578159		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|2740926_2743488_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|2743593_2744250_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001300386.1|2744300_2745068_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000848004.1|2745263_2746172_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|2746168_2747335_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278994.1|2747426_2748065_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 7
NC_012759	Escherichia coli BW2952, complete sequence	4578159	4132297	4199574	4578159	holin,terminase,capsid,portal,tRNA,protease,lysis,head,tail	Enterobacteria_phage(69.35%)	76	NA	NA
WP_000337186.1|4132297_4132525_+	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	66.7	4.8e-17
WP_000763367.1|4134742_4134964_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_000548551.1|4135355_4135547_-	DUF1382 family protein	NA	A0A0K2FJ42	Enterobacteria_phage	100.0	2.8e-26
WP_000149542.1|4135519_4135702_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	100.0	1.6e-28
WP_000186853.1|4135698_4136379_-	YqaJ viral recombinase family protein	NA	A0A0K2FIU4	Escherichia_phage	100.0	2.7e-132
WP_000100844.1|4136375_4137161_-	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	100.0	1.4e-148
WP_000995451.1|4137166_4137463_-	host-nuclease inhibitor protein Gam	NA	C6ZCV5	Enterobacteria_phage	100.0	2.1e-49
WP_000372937.1|4137537_4137681_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|4137649_4137814_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000018329.1|4138157_4138973_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_000065374.1|4139136_4139505_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_000213975.1|4139687_4139888_-	antirestriction Ral family protein	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_000281856.1|4140154_4140637_+	superinfection exclusion B family protein	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_001564525.1|4140637_4140961_-	antitermination protein	NA	A0A0K2FII1	Escherichia_phage	100.0	4.5e-53
WP_001245922.1|4141425_4141860_-	protein rexB	NA	M1FPN8	Enterobacteria_phage	100.0	1.9e-70
WP_000788349.1|4141875_4142715_-	protein rexA	NA	M1FPD4	Enterobacteria_phage	100.0	3.7e-155
WP_000104863.1|4142827_4143541_-	LexA family transcriptional regulator	NA	M1FN96	Enterobacteria_phage	100.0	1.6e-127
WP_000437875.1|4143641_4143842_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251069.1|4143960_4144254_+	lambda phage CII family protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000185505.1|4144286_4145186_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
WP_000788910.1|4145182_4145884_+	hypothetical protein	NA	A0A0K2FIT1	Enterobacteria_phage	100.0	7.6e-130
WP_000145933.1|4145880_4146171_+	protein ren	NA	K7P7K7	Enterobacteria_phage	100.0	9.6e-47
WP_000736903.1|4146244_4146685_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000611491.1|4146681_4147554_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0K2FIH3	Escherichia_phage	100.0	9.3e-178
WP_000984218.1|4147550_4147724_+	hypothetical protein	NA	I6S1V2	Salmonella_phage	100.0	5.8e-31
WP_000113775.1|4147690_4147873_+	NinE family protein	NA	C6ZR57	Salmonella_phage	96.7	8.2e-28
WP_000566997.1|4147869_4148040_+	protein ninF	NA	Q716C4	Shigella_phage	100.0	3.2e-26
WP_001108044.1|4148032_4148644_+	recombination protein NinG	NA	K7P8B1	Enterobacteria_phage	100.0	3.5e-99
WP_000144614.1|4148640_4148847_+	phage NinH family protein	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_001271136.1|4148824_4149490_+	serine/threonine protein phosphatase	NA	K7P7V3	Enterobacteria_phage	100.0	1.7e-131
WP_001235459.1|4149486_4150110_+	antitermination protein	NA	K7P6X1	Enterobacteria_phage	100.0	3.0e-114
WP_000783735.1|4150786_4151110_+|holin	phage holin, lambda family	holin	A0A0K2FJ23	Enterobacteria_phage	100.0	1.3e-52
WP_000229403.1|4151093_4151570_+	glycoside hydrolase family protein	NA	A0A0K2FIS2	Enterobacteria_phage	100.0	4.4e-89
WP_012738274.1|4151786_4151969_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	100.0	1.7e-17
WP_000738492.1|4152059_4152353_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	100.0	4.0e-48
WP_000079503.1|4152642_4153053_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|4153338_4153545_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|4153709_4153904_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453580.1|4154292_4154838_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001027292.1|4154812_4156738_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
WP_000198149.1|4156734_4156941_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001359455.1|4156937_4158539_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	100.0	5.9e-312
WP_000123343.1|4158519_4159839_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	100.0	7.9e-237
WP_001297109.1|4159848_4160181_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_000063280.1|4160236_4161262_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_000158919.1|4161303_4161702_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	100.0	3.1e-64
WP_000752979.1|4161713_4162067_+|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000975070.1|4162078_4162657_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000683105.1|4162653_4163049_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001349920.1|4163056_4163797_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000479153.1|4163812_4164235_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459439.1|4164216_4164651_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_000840208.1|4164643_4167205_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	99.9	0.0e+00
WP_000847379.1|4167201_4167531_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152639.1|4167530_4168229_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000194780.1|4168234_4168978_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_071819354.1|4168996_4169548_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	99.5	1.9e-80
WP_000515494.1|4169608_4173007_+	host specificity protein J	NA	C6ZCZ5	Enterobacteria_phage	99.9	0.0e+00
WP_001246632.1|4173068_4173689_+	outer membrane beta-barrel protein Lom	NA	A0A1U8QHD6	Enterobacteria_phage	100.0	8.3e-112
WP_000291549.1|4174499_4175753_-	lactose permease	NA	NA	NA	NA	NA
WP_024181924.1|4175804_4178876_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	100.0	0.0e+00
WP_000209520.1|4179046_4180240_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001297290.1|4180398_4181943_-	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_000695387.1|4182096_4183287_-	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000179165.1|4183651_4184767_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
WP_000973663.1|4184838_4186179_+	maltoporin LamB	NA	NA	NA	NA	NA
WP_001326641.1|4186421_4187342_+	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_001326644.1|4189373_4189871_+	chorismate lyase	NA	NA	NA	NA	NA
WP_000455227.1|4189883_4190756_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000017354.1|4190910_4193334_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000002907.1|4193504_4193873_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000646078.1|4193982_4194591_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_001326646.1|4194663_4195989_+	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_001030593.1|4196104_4196314_+	CsbD family protein	NA	NA	NA	NA	NA
WP_001295691.1|4196355_4196871_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001298868.1|4198536_4199574_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
