The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_013008	Escherichia coli O157:H7 str. TW14359, complete sequence	5528136	215654	279930	5528136	transposase,plate,tRNA	uncultured_Caudovirales_phage(25.0%)	52	NA	NA
WP_000176537.1|215654_216950_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|217002_217263_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|217249_217450_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185286.1|217615_218161_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635546.1|218157_218568_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239181.1|218581_219292_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001302206.1|219491_220316_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260720.1|220368_222087_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094000.1|222197_222905_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202328.1|222901_223306_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874227.1|223423_224239_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294606.1|224278_224932_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|224924_225956_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|226143_226719_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997018.1|232478_233282_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_000648586.1|233278_234193_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|234433_235234_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211693.1|235311_236082_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644686.1|236129_237488_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|237559_238315_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001301721.1|238348_239071_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|239067_239535_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301976.1|239599_240331_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_001086136.1|240868_241669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302684.1|242146_242596_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000964776.1|242598_243195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001452678.1|243304_243496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284958.1|243516_243996_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087743.1|243961_245371_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_001303798.1|245381_248816_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240517.1|248952_250365_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088854.1|250369_251113_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614375.1|251109_253887_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.7	4.7e-82
WP_000343292.1|253895_254657_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246434.1|254661_255993_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080153.1|255995_256520_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113707.1|256516_257797_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348794.1|257821_258904_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|258867_260718_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000599596.1|260721_261135_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056994.1|261225_262617_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|262667_262892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037399.1|262926_263427_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|264123_264642_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103125.1|264851_266993_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_000509129.1|267068_271301_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000995683.1|271440_272157_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_001451375.1|273915_274467_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000420853.1|275212_276349_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000247943.1|278313_278577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795385.1|278491_278677_-	protein YncO	NA	NA	NA	NA	NA
WP_000027427.1|278757_279930_+|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_013008	Escherichia coli O157:H7 str. TW14359, complete sequence	5528136	298716	316461	5528136	tail,transposase	Escherichia_phage(41.18%)	18	NA	NA
WP_000749881.1|298716_299772_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|300059_301163_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893282.1|301174_302428_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001303805.1|303497_303743_-	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_162829202.1|304069_305283_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000708831.1|305308_305692_-	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.2	4.4e-07
WP_001274756.1|305819_306533_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000437875.1|306633_306834_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251069.1|306952_307246_+	lambda phage CII family protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000788819.1|308197_308509_+	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_001096963.1|308508_309303_+|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	92.9	2.8e-80
WP_000805544.1|309302_309896_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_000344820.1|309867_310311_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_001115553.1|310331_310742_-|tail	tail fiber protein	tail	A0A0F7LBW5	Escherichia_phage	97.6	2.2e-65
WP_000904979.1|310771_311326_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_000355475.1|311383_312157_-	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000246059.1|312979_313723_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162829240.1|315247_316461_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.4e-168
>prophage 3
NC_013008	Escherichia coli O157:H7 str. TW14359, complete sequence	5528136	896149	934250	5528136	portal,holin,lysis,protease,integrase,tail,terminase	Enterobacteria_phage(48.84%)	50	885591:885605	917885:917899
885591:885605	attL	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_000533643.1|896149_897220_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
WP_001303849.1|897197_897416_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|897455_897623_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000120056.1|897865_898468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|898678_898900_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000188862.1|898998_899214_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	98.6	2.9e-32
WP_000548536.1|899290_899482_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|899454_899637_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|899633_900314_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_001254218.1|901011_901194_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567001.1|901190_901361_+	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001108055.1|901353_901974_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_001028854.1|901970_902636_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_000750155.1|902847_903807_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|904144_904267_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|904281_904971_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|905154_905898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|905983_906142_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_012578864.1|906222_906621_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_001303850.1|906763_906979_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000075107.1|906978_907476_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000092302.1|907472_907940_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_001139679.1|907927_908080_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000349509.1|908754_909246_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_000934137.1|909245_911348_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_001072975.1|911344_911557_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_010904538.1|911484_912609_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_127446149.1|912730_913066_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_001136597.1|913010_915038_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_001097050.1|915124_915448_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|915440_915716_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677094.1|915727_916306_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001079422.1|916302_916704_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000211123.1|916714_917458_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001300035.1|917518_917905_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
917885:917899	attR	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_001161009.1|917913_918243_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000371994.1|918214_921280_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447253.1|921279_921609_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152360.1|921618_922317_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000194779.1|922322_923066_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090841.1|923002_923611_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000515426.1|923671_927085_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_001233141.1|927155_927755_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000741889.1|927814_929131_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	95.6	1.2e-70
WP_001024022.1|929132_929402_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000950813.1|929578_930559_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_115801843.1|930592_931612_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_072127173.1|932108_932270_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_000951025.1|932439_933321_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	89.8	1.1e-146
WP_001247925.1|933551_934250_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
>prophage 4
NC_013008	Escherichia coli O157:H7 str. TW14359, complete sequence	5528136	1150958	1220796	5528136	portal,holin,protease,capsid,tail,transposase,head	Escherichia_phage(23.81%)	75	NA	NA
WP_000156526.1|1150958_1152719_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1152904_1153357_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1153431_1154472_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1154828_1155338_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839159.1|1155556_1156186_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1156148_1158311_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261230.1|1158320_1158767_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001301436.1|1158889_1160944_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
WP_000424181.1|1160975_1161434_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1161529_1162192_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1162364_1162778_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1162822_1163140_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|1163197_1164388_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|1164482_1164761_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1164757_1165087_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375128.1|1165177_1165837_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
WP_000273151.1|1167228_1167471_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034474.1|1167538_1170010_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_001098307.1|1170103_1170295_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1170291_1170480_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133046.1|1171053_1171239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394511.1|1171425_1171815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1171956_1172112_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|1172389_1172677_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|1172676_1172868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|1172895_1173297_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|1173405_1173678_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|1173661_1174087_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|1174293_1174749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001475117.1|1174827_1175925_+	hypothetical protein	NA	V5URT9	Shigella_phage	69.6	8.8e-133
WP_000788745.1|1175931_1176678_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	3.1e-113
WP_000450992.1|1176699_1177470_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_001151233.1|1177485_1177899_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|1178250_1179024_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000813263.1|1179628_1179784_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_001341388.1|1179951_1180230_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265172.1|1180231_1181281_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001217436.1|1181293_1181665_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090264.1|1181654_1182026_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_000265265.1|1182177_1182996_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000261909.1|1183616_1184330_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874392.1|1185097_1186948_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_162829202.1|1187123_1188336_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001303878.1|1188541_1188856_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|1189383_1189569_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|1189790_1189904_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|1190124_1190658_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|1190817_1191090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411791.1|1191345_1191552_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000235421.1|1192302_1192578_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_001171554.1|1192653_1193034_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1193030_1193378_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1193427_1194966_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000259002.1|1197142_1197349_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|1197345_1198938_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|1198927_1200433_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|1200469_1200817_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|1200874_1201141_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|1201122_1201863_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|1201876_1202308_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|1202334_1202748_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082463.1|1202728_1205308_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000847274.1|1205304_1205634_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_001151105.1|1205633_1206332_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194801.1|1206342_1207086_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_050546863.1|1207031_1207664_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000649829.1|1207854_1208382_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_000515111.1|1208515_1211989_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	95.5	0.0e+00
WP_001230444.1|1212056_1212656_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000268962.1|1212719_1214033_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001023352.1|1214034_1214304_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_001301613.1|1216577_1217696_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|1217692_1219486_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|1219504_1220212_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|1220208_1220796_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 5
NC_013008	Escherichia coli O157:H7 str. TW14359, complete sequence	5528136	1482523	1599089	5528136	portal,holin,lysis,capsid,protease,integrase,tail,terminase,transposase,head,tRNA	Enterobacteria_phage(36.63%)	145	1534326:1534340	1560578:1560592
WP_000952736.1|1482523_1483345_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000759316.1|1483500_1484547_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|1484543_1485338_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074985.1|1485504_1486623_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000003742.1|1486591_1486861_-	excisionase	NA	NA	NA	NA	NA
WP_077699040.1|1486922_1487312_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000559928.1|1487444_1487960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|1488074_1488227_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948454.1|1488542_1489019_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|1489143_1489467_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693915.1|1489450_1489876_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262323.1|1489944_1490982_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_072143019.1|1490893_1491436_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_000451012.1|1491469_1492186_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072140318.1|1492218_1492500_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_001310212.1|1492496_1492799_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_001017965.1|1492788_1493106_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_000156547.1|1493059_1493377_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_000515959.1|1493363_1493801_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_001014296.1|1493802_1493994_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000207955.1|1493996_1494584_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001278450.1|1494699_1494804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|1494992_1495205_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001341388.1|1495372_1495651_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265168.1|1495652_1496702_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001213059.1|1498392_1498575_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|1498612_1498882_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284518.1|1498957_1499173_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731241.1|1499177_1499522_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|1499572_1500106_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|1500376_1500946_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1500945_1501092_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|1501319_1501526_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|1501590_1501815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|1502171_1502312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302295.1|1502441_1502627_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000279786.1|1502668_1503034_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|1503323_1503887_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001301491.1|1503883_1505545_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|1505608_1507546_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|1507590_1507812_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_001301962.1|1507757_1510259_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	98.8	0.0e+00
WP_000126019.1|1510338_1510665_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1510674_1511025_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|1511021_1511468_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1511464_1511809_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|1511874_1512591_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|1512605_1512980_+|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453698.1|1513075_1513285_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212850.1|1513337_1516580_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.7	0.0e+00
WP_000807950.1|1516572_1516914_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_001152182.1|1516913_1517612_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000170104.1|1517628_1517883_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|1517992_1518103_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|1518405_1519284_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967271.1|1519337_1520075_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_071526731.1|1520020_1520257_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|1520269_1520359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|1520378_1522727_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|1523317_1526719_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001303921.1|1529027_1529303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|1529363_1530725_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799385.1|1531088_1531952_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1531935_1533072_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|1533321_1534548_+	peptidase T	NA	NA	NA	NA	NA
1534326:1534340	attL	CGCCCAGCAGGCGAT	NA	NA	NA	NA
WP_001301987.1|1534596_1535718_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000085256.1|1535966_1537196_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_000953272.1|1537560_1537749_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000226782.1|1538553_1538751_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|1538743_1538956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|1538945_1539410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204985.1|1539402_1539636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|1539641_1539941_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833628.1|1539937_1541338_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	5.6e-116
WP_000192401.1|1541538_1541790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126695.1|1541786_1542197_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|1542207_1542480_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|1542606_1542831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796968.1|1543082_1543289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907465.1|1543288_1544344_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
WP_000380883.1|1544356_1544692_+|head	head decoration protein	head	NA	NA	NA	NA
WP_000224603.1|1544704_1545118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|1545323_1545866_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|1546121_1546403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|1547003_1548464_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|1548463_1549135_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1549303_1550674_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|1550677_1551319_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|1551354_1552461_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1552514_1552976_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|1552985_1553639_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|1553810_1555061_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|1555174_1556317_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088655.1|1556306_1556543_-	excisionase	NA	NA	NA	NA	NA
WP_000788869.1|1557467_1558169_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|1558165_1558468_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|1558535_1558868_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|1558932_1559055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053040.1|1561136_1561592_+	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
1560578:1560592	attR	CGCCCAGCAGGCGAT	NA	NA	NA	NA
WP_000224907.1|1561591_1561762_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|1561754_1562045_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|1562041_1562404_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|1562400_1562541_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|1562537_1563227_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|1563548_1563854_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|1563840_1564317_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|1564533_1564716_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|1564806_1565100_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|1565391_1565802_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|1566087_1566294_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|1566458_1566653_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|1567041_1567587_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001027365.1|1567561_1569487_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|1569483_1569690_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|1569686_1571288_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|1571268_1572588_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|1572597_1572930_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|1572985_1574011_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|1574052_1574451_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|1574462_1574816_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000975100.1|1574827_1575406_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683105.1|1575402_1575798_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|1575805_1576546_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|1576561_1576984_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|1576965_1577400_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|1577392_1579942_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000847331.1|1579938_1580268_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|1580267_1580966_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|1580971_1581715_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|1581651_1582284_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|1582344_1585743_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230336.1|1585809_1586409_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000279120.1|1586473_1589389_+|tail	phage tail protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_000885630.1|1589388_1589970_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000488340.1|1590089_1590980_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|1590998_1591505_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|1591541_1592042_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|1592120_1592303_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|1592800_1593469_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937476.1|1593525_1593774_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171540.1|1593849_1594230_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|1594226_1594574_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998042.1|1594623_1596162_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_001226373.1|1596464_1597949_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|1598135_1599089_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
>prophage 6
NC_013008	Escherichia coli O157:H7 str. TW14359, complete sequence	5528136	1678018	1797078	5528136	portal,holin,lysis,capsid,protease,integrase,tail,terminase,transposase,head	Enterobacteria_phage(33.01%)	141	1684242:1684300	1741733:1741791
WP_000113674.1|1678018_1679149_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1679126_1679375_-	excisionase	NA	NA	NA	NA	NA
WP_000048551.1|1679439_1681911_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_001090196.1|1682003_1682195_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1682191_1682380_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000920491.1|1682938_1683172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|1683149_1683557_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|1683579_1683798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|1683870_1684170_-	hypothetical protein	NA	NA	NA	NA	NA
1684242:1684300	attL	TTCCCCTTAACGCCGGGTAGCGGAACTGTTTGCTGAGAACACCGTGCGGTGTCTTGATG	NA	NA	NA	NA
WP_000787428.1|1684433_1684841_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|1684917_1685145_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705621.1|1685128_1685680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|1685651_1686692_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|1686603_1687146_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000774808.1|1687332_1687914_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001505071.1|1687910_1688075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|1688773_1689532_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961820.1|1689810_1690023_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001217394.1|1690243_1690501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|1690570_1690849_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|1690850_1691897_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|1691909_1692269_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|1692277_1692808_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|1693049_1693247_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935548.1|1693397_1694456_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_001415558.1|1695195_1695354_+	DUF1737 domain-containing protein	NA	Q5MBW4	Stx1-converting_phage	100.0	3.5e-11
WP_000284517.1|1696222_1696438_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731259.1|1696442_1696787_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|1696837_1697371_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|1697641_1698211_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1698210_1698357_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001082601.1|1698364_1698832_+|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	92.2	1.1e-71
WP_001302717.1|1699295_1699610_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|1699691_1699916_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|1700302_1700848_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027185.1|1700822_1702748_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.0	0.0e+00
WP_000198153.1|1702744_1702951_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|1702947_1704549_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|1704529_1705849_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|1705858_1706191_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|1706246_1707272_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|1707313_1707712_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|1707723_1708077_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|1708091_1708625_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|1708621_1709017_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|1709024_1709777_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|1709790_1710213_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000438877.1|1710239_1710548_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	99.0	1.5e-53
WP_000918257.1|1710591_1713237_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	98.6	0.0e+00
WP_000847298.1|1713233_1713563_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|1713562_1714261_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_122989782.1|1714960_1715590_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	96.6	2.7e-102
WP_000514948.1|1715830_1718686_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	72.8	0.0e+00
WP_001228334.1|1718753_1719353_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.0	1.0e-106
WP_000216534.1|1719504_1720809_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	3.9e-79
WP_001023474.1|1720810_1721080_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|1722106_1723432_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_106409364.1|1725029_1725152_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|1725258_1726170_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|1726235_1726805_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000998048.1|1727770_1729309_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1729358_1729706_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|1729702_1730083_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001303943.1|1730422_1730701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|1731128_1731275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|1731411_1732059_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|1732242_1732833_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_000113671.1|1736290_1737421_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.1	1.7e-102
WP_000113189.1|1737398_1737647_-	excisionase	NA	NA	NA	NA	NA
WP_000102168.1|1737711_1740156_-	exonuclease	NA	V5UQJ3	Shigella_phage	58.3	8.4e-176
WP_000092782.1|1740248_1740437_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|1740433_1740622_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001302137.1|1741019_1741184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171938.1|1741187_1741406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|1741565_1741721_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001003379.1|1741910_1742318_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
1741733:1741791	attR	TTCCCCTTAACGCCGGGTAGCGGAACTGTTTGCTGAGAACACCGTGCGGTGTCTTGATG	NA	NA	NA	NA
WP_000476986.1|1742395_1742623_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705378.1|1742606_1743158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020570.1|1743129_1744170_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.7	1.8e-90
WP_157837342.1|1744081_1744624_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.4	2.9e-84
WP_000537576.1|1744658_1745429_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	65.6	7.2e-81
WP_001118161.1|1745444_1745840_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_001302146.1|1745896_1746253_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	3.7e-56
WP_000063625.1|1746301_1746514_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_000137941.1|1746549_1746921_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
WP_000610377.1|1746917_1747280_+	DUF551 domain-containing protein	NA	A0A0P0ZCX1	Stx2-converting_phage	97.5	2.8e-67
WP_001278450.1|1747395_1747500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|1747688_1747901_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001217394.1|1748121_1748379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012779355.1|1748448_1748727_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	4.8e-11
WP_001265156.1|1748728_1749778_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.9e-108
WP_000904171.1|1749790_1750165_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	4.2e-34
WP_000762902.1|1750161_1750983_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
WP_000917735.1|1751209_1751407_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000483509.1|1751557_1752616_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	2.6e-206
WP_000142977.1|1753210_1755157_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	99.1	0.0e+00
WP_000143458.1|1755291_1755471_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1755511_1755757_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072901.1|1755834_1756050_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001015159.1|1756053_1756611_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	80.0	2.6e-48
WP_001092902.1|1756647_1757181_+	lysozyme	NA	G9L6J6	Escherichia_phage	96.6	2.1e-100
WP_012816791.1|1757699_1757885_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000373407.1|1758359_1758836_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_001077628.1|1758832_1760956_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.7	0.0e+00
WP_000102415.1|1760952_1761165_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974554.1|1761164_1762667_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	99.8	3.1e-290
WP_001114424.1|1762611_1764636_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|1764723_1765050_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1765042_1765324_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974960.1|1765326_1765950_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	99.5	2.5e-100
WP_000682716.1|1765962_1766361_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1766368_1767121_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479062.1|1767134_1767557_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000532073.1|1767583_1767892_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000918238.1|1767935_1770581_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	94.4	0.0e+00
WP_000847298.1|1770577_1770907_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001302134.1|1770906_1771605_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	98.3	5.2e-131
WP_000194802.1|1771615_1772359_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	2.4e-150
WP_123178851.1|1772304_1772934_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.1	1.7e-101
WP_000514959.1|1773174_1776651_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.6	0.0e+00
WP_001230435.1|1776718_1777318_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	8.2e-109
WP_000279019.1|1777382_1778696_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.3	3.9e-79
WP_001023417.1|1778697_1778967_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	98.9	2.4e-44
WP_000692020.1|1780099_1780690_+	protein kinase	NA	NA	NA	NA	NA
WP_000251936.1|1781067_1781238_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_001079499.1|1781727_1782234_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|1782279_1782780_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1782865_1783045_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|1783425_1784232_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|1784231_1785425_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983857.1|1785436_1786798_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000763520.1|1786798_1788394_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194604.1|1788393_1789956_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1790047_1790092_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|1790229_1791111_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1791107_1791728_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|1791755_1793339_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|1793551_1794424_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|1794463_1795054_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|1795050_1795809_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|1796028_1797078_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 7
NC_013008	Escherichia coli O157:H7 str. TW14359, complete sequence	5528136	2068686	2152387	5528136	portal,holin,capsid,tail,terminase,transposase,head	Stx2-converting_phage(42.22%)	97	NA	NA
WP_000214712.1|2068686_2068890_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|2068925_2070386_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_001120551.1|2071889_2072132_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001143804.1|2072293_2072935_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001303500.1|2073016_2073646_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|2073718_2074294_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023407.1|2074407_2074677_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000268848.1|2074678_2075992_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.2	1.4e-81
WP_001230508.1|2076056_2076656_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_050439450.1|2081143_2081776_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194720.1|2081721_2082465_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_001179510.1|2082475_2083174_-|tail	phage minor tail protein L	tail	A0A0P0ZD89	Stx2-converting_phage	97.8	7.6e-130
WP_000807954.1|2083173_2083515_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212925.1|2083507_2086750_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.6	0.0e+00
WP_001453698.1|2086801_2087011_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2087106_2087481_-|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2087486_2088203_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2088261_2088606_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2088602_2089049_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|2089045_2089396_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126026.1|2089405_2089732_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	99.1	4.5e-53
WP_001063023.1|2091772_2091994_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000731239.1|2092537_2092945_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	97.2	1.3e-52
WP_024180155.1|2092949_2093165_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000023184.1|2093603_2095454_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001302123.1|2095931_2096363_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|2096813_2097527_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|2097662_2097860_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|2098084_2098639_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|2098701_2099007_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|2099019_2100069_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2100070_2100343_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2100464_2100809_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2100928_2101141_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2101374_2101932_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2101933_2102152_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|2102279_2102591_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|2102583_2102811_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2102807_2103089_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|2103121_2103838_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000139447.1|2103871_2104333_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_001262402.1|2104325_2105369_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000693878.1|2105437_2105863_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|2105846_2106089_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|2106480_2106819_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|2107111_2107264_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|2107275_2107914_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2107914_2108124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2108688_2108877_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2108873_2109062_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102123.1|2109154_2110399_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_001120551.1|2111109_2111352_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001171540.1|2112314_2112695_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|2112691_2113039_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2113088_2114627_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001121225.1|2115209_2115860_-	type III secretion system effector NleG7	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001131642.1|2116570_2117146_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001023362.1|2117259_2117529_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_000268860.1|2117530_2118754_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001230508.1|2118818_2119418_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_001179509.1|2123151_2123589_-|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	100.0	5.0e-63
WP_000807954.1|2123588_2123930_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212817.1|2123922_2127165_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.5	0.0e+00
WP_001453746.1|2127212_2127422_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|2127517_2127892_-|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|2127906_2128623_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|2128688_2129033_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2129029_2129476_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|2129472_2129823_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2129832_2130159_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_000267295.1|2130161_2132741_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_001063099.1|2132686_2132908_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|2132952_2134890_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301438.1|2134953_2136615_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000958416.1|2136611_2137175_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279796.1|2137466_2137832_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000095736.1|2137873_2138101_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2138525_2138711_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539789.1|2138968_2139085_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	3.4e-11
WP_001056806.1|2139084_2139654_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2139924_2140458_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2140508_2140853_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_024180155.1|2140857_2141073_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000023202.1|2141512_2143363_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_001303509.1|2143841_2144270_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_001059381.1|2144907_2145597_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001217455.1|2145593_2145953_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001265161.1|2145965_2147015_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_012779366.1|2147016_2147295_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|2147462_2147675_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|2147863_2147968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206793.1|2148083_2148668_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001118159.1|2148724_2149120_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000788938.1|2149930_2150671_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_000095669.1|2150677_2151640_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000693943.1|2151662_2152088_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|2152084_2152387_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
>prophage 8
NC_013008	Escherichia coli O157:H7 str. TW14359, complete sequence	5528136	2467266	2519490	5528136	tail,integrase,transposase,tRNA	Enterobacteria_phage(60.0%)	59	2460490:2460505	2519780:2519795
2460490:2460505	attL	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
WP_001025318.1|2467266_2469000_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
WP_001302043.1|2469176_2469665_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259575.1|2469784_2470177_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067016.1|2470176_2472255_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278932.1|2472247_2473396_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983602.1|2473597_2474242_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|2474252_2474642_-	chemotaxis response regulator CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036370.1|2474656_2475706_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204340.1|2475708_2476569_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483251.1|2476587_2478189_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
WP_001302081.1|2478234_2479896_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
WP_000147302.1|2480038_2480542_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001322280.1|2480562_2482527_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|2482531_2483458_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906325.1|2483454_2484342_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|2484468_2485047_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001302091.1|2485049_2485400_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122432.1|2486179_2486608_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_000089029.1|2486614_2488039_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001302045.1|2488013_2488814_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001302082.1|2488980_2489967_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187819.1|2489981_2491496_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548680.1|2491565_2492555_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179461.1|2493351_2493855_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000084172.1|2493934_2494186_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|2494300_2494387_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237873.1|2494648_2494972_+	YecR-like lipofamily protein	NA	NA	NA	NA	NA
WP_000917208.1|2495142_2495640_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|2495676_2495916_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797566.1|2496107_2497319_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|2497380_2498046_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_001300279.1|2498402_2499404_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865208.1|2499409_2499757_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290345.1|2499786_2500437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2500452_2500857_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_001673482.1|2500946_2501084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|2501155_2501359_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|2501380_2501731_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159449.1|2501741_2502020_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000514287.1|2502031_2502274_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000021655.1|2502270_2502384_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991913.1|2502476_2502893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|2502916_2503120_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|2503116_2503383_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104305.1|2503379_2503679_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_001310314.1|2503690_2504308_+	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000599379.1|2504304_2504670_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000123463.1|2504676_2507499_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
WP_000686523.1|2507575_2508535_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000211280.1|2508539_2508854_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_001310336.1|2509945_2510476_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000954203.1|2510519_2511092_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000979955.1|2511248_2511737_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000333495.1|2514539_2514695_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000665314.1|2514703_2515069_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290456.1|2515123_2515636_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000005444.1|2515635_2516820_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000132765.1|2516977_2517301_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_162829242.1|2518277_2519490_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	100.0	2.2e-169
2519780:2519795	attR	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
>prophage 9
NC_013008	Escherichia coli O157:H7 str. TW14359, complete sequence	5528136	2577280	2718900	5528136	portal,holin,lysis,capsid,protease,tail,integrase,terminase,transposase,head	Stx2-converting_phage(36.51%)	163	2600071:2600130	2721963:2721978
WP_001023407.1|2577280_2577550_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000268981.1|2577551_2578865_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	2.8e-77
WP_001230514.1|2578929_2579529_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_097454001.1|2583316_2583946_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.0	7.8e-110
WP_000194801.1|2583891_2584635_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_001151105.1|2584645_2585344_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847274.1|2585343_2585673_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_000082463.1|2585669_2588249_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000533402.1|2588229_2588643_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|2588669_2589101_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|2589114_2589855_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|2589836_2590103_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|2590160_2590508_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|2590544_2592050_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|2592039_2593632_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|2593628_2593835_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000235436.1|2595719_2596229_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001299328.1|2596623_2596848_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_001302690.1|2596929_2597244_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2597770_2597956_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001280929.1|2598183_2598315_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|2598327_2598510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992126.1|2598665_2599199_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_000731204.1|2599249_2599594_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_024165672.1|2599598_2599814_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
2600071:2600130	attL	TGAACCGCCCCGGAAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGACT	NA	NA	NA	NA
WP_162829202.1|2600124_2601337_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
2600071:2600130	attL	TGAACCGCCCCGGAAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGACT	NA	NA	NA	NA
WP_000023257.1|2601419_2603270_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_001303558.1|2603747_2604176_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_001059369.1|2604809_2605499_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000904141.1|2605495_2605855_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001265075.1|2605867_2606917_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_001310296.1|2606918_2607197_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_000902687.1|2607364_2607577_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|2607763_2607868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137954.1|2607977_2608541_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_000111243.1|2608667_2608979_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001414276.1|2608975_2609128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|2609160_2609517_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|2609513_2609738_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450610.1|2609759_2610458_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_072143023.1|2610492_2611035_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_001262409.1|2610946_2611984_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000693816.1|2612052_2612478_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|2612474_2612702_-	cell division protein	NA	NA	NA	NA	NA
WP_000444607.1|2612799_2613444_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|2613718_2613871_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449168.1|2614351_2614540_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199485.1|2614536_2614725_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034457.1|2614820_2617292_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000094838.1|2617350_2617554_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533601.1|2617553_2618633_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.2e-99
WP_001302302.1|2618824_2619622_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_134793145.1|2620111_2628094_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_000480501.1|2628355_2629408_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000378596.1|2629721_2631038_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|2631139_2632594_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532909.1|2632936_2633653_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_122989775.1|2634278_2635922_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_001011000.1|2636039_2636990_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011474.1|2637091_2638009_-	nitrogen assimilation transcriptional regulator NAC	NA	NA	NA	NA	NA
WP_000986334.1|2638465_2639401_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193830.1|2639462_2640542_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2640553_2641297_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973176.1|2641293_2641839_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001171540.1|2642200_2642581_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|2642577_2642925_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2642974_2644513_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_162829202.1|2645330_2646544_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000966626.1|2647273_2649421_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2646539:2647848	attR	AGTCATCCTGTTTACCTCTTTCTCAGGGAGTTTAGTCTCCAGGATTTCCGGGGCGGTTCAGATATATTCTGATATACTCCTTTTGCTAGACATAACCTTTCACCTGCTTGCAAAGCTTCTGTGTTCTGACATTGCCAAATTGTTGCAATTCTGTATCCAGCCTTCTTTCAGTCATAGCTTCGGGCCGCGATAAGACTCACTGATCTGACCCTGATTCCTCTTGCAGACTTTATAGACCAATTAAAATGCAGTTTCTGCAGGTCAACGTCTGACCATCATTGTCATCACTCTGGCCATTAGAGTAACCTTCTGCATTCATCCTTTTGTAAAAAGTTTATATTAGTATCAGCAATTAACCGGACCTGATACTGATATGAGTCTTACCGCATATACGGTCAATTTCAGCAATTAATTACATTATCCACGCCAAAGTATTTGTCATCACAATGATGGTACCTTCTTTCAGACACCATTTTTTCAACTCCGTTTTCCACGGACCGCACTCTTATGTCAAGAGTGCGGTCCGTGGATACAACCAGAGACCGACTGACACGAGTCAGAGGAAACGACGGATATGTTCAGTCGTAAAATATCTATCAAAAAACATGATTAAGGTCAAAAATGTTTGATATTTACAATTTATGAAGATGACAATAATTATAGATATATGAGAACATAAATGAAAATAATTATCATTACAGCAATCATTTGTACTTTGTATTAATGAGGGATGAAATGTTATATAATATACCTTGTCGAATTTATATCCTTTCCACTCTGTCATTATGCATTTCTGGGATAGTTTCTACTGCAACCGCAACTTCTTCAGAAACAAAAATCAGCAACGAAGAGACGCTCGTCGTGACCACGAATCGTTCGGCAAGCAACCTTTGGGAAAGCCCGGCGACTATACAGGTTATTGACCAACAAACATTGCAGAACTCCACCAATGCCTCCATAGCCGATAATTTGCAGGACATCCCCGGAGTAGAGATAACAGACAACTCCTTGGCAGGCCGTAAACAAATCCGCATTCGTGGCGAAGCATCCTCCCGTGTTTTAATTCTCATTGATGGTCAGGAGGTAACTTATCAGCGCGCCGGAGATAATTATGGTGTGGGACTGTTGATAGATGAGTCTGCGCTGGAGCGTGTTGAGGTAGTGAAAGGTCCATATTCCGTACTGTACGGTTCACAGGCAATTGGCGGTATTGTTAACTTCATCACCAAAAAGGGAGGTGACAAACTTGCATCTGGAGTTGTGAAAGCTGTTTATAATTCCGCAACAGCAGGCTGGGAAGAATCAATCGC	NA	NA	NA	NA
WP_061069249.1|2649702_2650557_+	hypothetical protein	NA	NA	NA	NA	NA
2646539:2647848	attR	AGTCATCCTGTTTACCTCTTTCTCAGGGAGTTTAGTCTCCAGGATTTCCGGGGCGGTTCAGATATATTCTGATATACTCCTTTTGCTAGACATAACCTTTCACCTGCTTGCAAAGCTTCTGTGTTCTGACATTGCCAAATTGTTGCAATTCTGTATCCAGCCTTCTTTCAGTCATAGCTTCGGGCCGCGATAAGACTCACTGATCTGACCCTGATTCCTCTTGCAGACTTTATAGACCAATTAAAATGCAGTTTCTGCAGGTCAACGTCTGACCATCATTGTCATCACTCTGGCCATTAGAGTAACCTTCTGCATTCATCCTTTTGTAAAAAGTTTATATTAGTATCAGCAATTAACCGGACCTGATACTGATATGAGTCTTACCGCATATACGGTCAATTTCAGCAATTAATTACATTATCCACGCCAAAGTATTTGTCATCACAATGATGGTACCTTCTTTCAGACACCATTTTTTCAACTCCGTTTTCCACGGACCGCACTCTTATGTCAAGAGTGCGGTCCGTGGATACAACCAGAGACCGACTGACACGAGTCAGAGGAAACGACGGATATGTTCAGTCGTAAAATATCTATCAAAAAACATGATTAAGGTCAAAAATGTTTGATATTTACAATTTATGAAGATGACAATAATTATAGATATATGAGAACATAAATGAAAATAATTATCATTACAGCAATCATTTGTACTTTGTATTAATGAGGGATGAAATGTTATATAATATACCTTGTCGAATTTATATCCTTTCCACTCTGTCATTATGCATTTCTGGGATAGTTTCTACTGCAACCGCAACTTCTTCAGAAACAAAAATCAGCAACGAAGAGACGCTCGTCGTGACCACGAATCGTTCGGCAAGCAACCTTTGGGAAAGCCCGGCGACTATACAGGTTATTGACCAACAAACATTGCAGAACTCCACCAATGCCTCCATAGCCGATAATTTGCAGGACATCCCCGGAGTAGAGATAACAGACAACTCCTTGGCAGGCCGTAAACAAATCCGCATTCGTGGCGAAGCATCCTCCCGTGTTTTAATTCTCATTGATGGTCAGGAGGTAACTTATCAGCGCGCCGGAGATAATTATGGTGTGGGACTGTTGATAGATGAGTCTGCGCTGGAGCGTGTTGAGGTAGTGAAAGGTCCATATTCCGTACTGTACGGTTCACAGGCAATTGGCGGTATTGTTAACTTCATCACCAAAAAGGGAGGTGACAAACTTGCATCTGGAGTTGTGAAAGCTGTTTATAATTCCGCAACAGCAGGCTGGGAAGAATCAATCGC	NA	NA	NA	NA
WP_000203545.1|2650553_2651459_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_000102660.1|2651455_2652526_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000775497.1|2652661_2653345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000846711.1|2653360_2653771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234544.1|2653991_2654813_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000860080.1|2654894_2655374_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	5.2e-13
WP_001186192.1|2655388_2655865_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|2655927_2656149_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001285587.1|2656222_2656591_+	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000988600.1|2657049_2657244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2657256_2657370_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001016346.1|2657858_2658041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450409.1|2658141_2658471_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_001202488.1|2658642_2659701_-	FUSC family protein	NA	NA	NA	NA	NA
WP_001105393.1|2659899_2660373_-	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001303036.1|2660491_2661658_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001121226.1|2662981_2663632_+	type III secretion system effector NleG7	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_000458686.1|2663855_2664731_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.7	3.2e-162
WP_001023455.1|2664871_2665141_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_000268851.1|2665142_2666456_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	99.1	2.0e-83
WP_001230514.1|2666520_2667120_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000514828.1|2667187_2670667_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.0	0.0e+00
WP_122994717.1|2670905_2671538_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	99.0	3.1e-106
WP_000967278.1|2671483_2672221_-|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	98.8	3.8e-148
WP_001414206.1|2672275_2673199_-	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	99.3	3.2e-176
WP_001154345.1|2673269_2673443_-	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001302649.1|2673550_2673871_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_000807954.1|2674613_2674955_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212919.1|2674947_2678190_-|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	95.6	0.0e+00
WP_001453698.1|2678241_2678451_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2678546_2678921_-|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2678926_2679643_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2679701_2680046_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2680042_2680489_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007901.1|2680485_2680836_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|2680845_2681172_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001301679.1|2681251_2683753_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.2	0.0e+00
WP_001063099.1|2683698_2683920_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|2683964_2685902_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301438.1|2685965_2687627_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000958416.1|2687623_2688187_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279796.1|2688478_2688844_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000095736.1|2688885_2689113_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_001283921.1|2689575_2689833_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000839224.1|2689829_2690327_-	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_000092318.1|2690529_2690967_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000075132.1|2690963_2691461_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000284515.1|2691460_2691676_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_001290231.1|2691752_2692025_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|2692065_2692245_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000143109.1|2692381_2694319_-	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	99.2	0.0e+00
WP_001303568.1|2694562_2694886_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000738080.1|2695182_2695452_-	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_000649751.1|2695463_2696423_-	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000512807.1|2697072_2697561_-	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_001028858.1|2697551_2698223_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_001108004.1|2698219_2698825_-	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001004016.1|2698824_2699547_-	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_000849633.1|2699621_2700302_-	phage antirepressor Ant	NA	Q8HA19	Enterobacteria_phage	100.0	1.1e-128
WP_000208502.1|2700557_2701316_-	ORF6N domain-containing protein	NA	B6ETC2	Enterobacteria_phage	100.0	2.0e-115
WP_001254256.1|2701590_2701773_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153268.1|2701769_2702297_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001303571.1|2702293_2702740_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_001449504.1|2702696_2702933_-	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_000103678.1|2702943_2703159_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001000130.1|2703291_2703570_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_001248388.1|2703640_2705017_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_000539354.1|2705013_2705835_-	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_000166961.1|2705821_2705983_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000442612.1|2706015_2706312_-	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000067727.1|2706453_2706669_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|2706744_2707440_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001130059.1|2707941_2708463_+	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_000438343.1|2709031_2709214_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_000088203.1|2709191_2709464_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000394299.1|2709522_2709774_+	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000065362.1|2709956_2710325_+	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_001198861.1|2710397_2710562_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|2710530_2710674_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995486.1|2710748_2711045_+	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_001301718.1|2711050_2711836_+	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	99.6	2.4e-148
WP_162829202.1|2712130_2713344_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000682306.1|2713822_2714005_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000548544.1|2713977_2714169_+	DUF1382 family protein	NA	B6ETA2	Enterobacteria_phage	100.0	3.3e-27
WP_000188870.1|2714245_2714461_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000763383.1|2714559_2714781_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289930.1|2714777_2715725_+	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_001356547.1|2715726_2715903_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_000207903.1|2716236_2716593_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_000610373.1|2716589_2716940_+	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_001281188.1|2717127_2717472_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000132739.1|2717549_2717741_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001007946.1|2717721_2718900_-|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
2721963:2721978	attR	AAAAAGAATAAAAAAA	NA	NA	NA	NA
>prophage 10
NC_013008	Escherichia coli O157:H7 str. TW14359, complete sequence	5528136	2802123	2840190	5528136	portal,plate,holin,lysis,capsid,tail,integrase,terminase,head,tRNA	Escherichia_phage(62.22%)	50	2806423:2806450	2838383:2838410
WP_000675144.1|2802123_2803527_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
WP_000137884.1|2803523_2804246_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_001301848.1|2804436_2804769_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|2804916_2806278_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
2806423:2806450	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|2806551_2806770_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882933.1|2806851_2808015_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.4	1.7e-203
WP_000978913.1|2808014_2808494_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_000069957.1|2808508_2810956_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.3	0.0e+00
WP_001496926.1|2810948_2811068_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	1.4e-15
WP_001031303.1|2811100_2811376_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|2811432_2811951_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286706.1|2811963_2813154_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	6.9e-224
WP_000905094.1|2813213_2813807_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.5	2.1e-104
WP_001145592.1|2813837_2814248_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	98.4	5.9e-66
WP_001008233.1|2814268_2814712_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	4.9e-82
WP_001057694.1|2814683_2815286_-|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	91.0	1.5e-97
WP_000217052.1|2815285_2816605_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	68.5	1.2e-179
WP_001285352.1|2816601_2817213_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_001121479.1|2817205_2818114_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	7.5e-162
WP_000127154.1|2818118_2818466_-	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	99.1	6.5e-58
WP_001093728.1|2818462_2819098_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.9e-112
WP_001001810.1|2819164_2819617_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	97.3	2.2e-74
WP_000917144.1|2819609_2820077_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	2.5e-81
WP_001300730.1|2820039_2820213_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000040644.1|2820184_2820610_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	94.3	2.0e-64
WP_000736555.1|2820597_2821023_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	98.6	1.2e-61
WP_001144101.1|2821037_2821535_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|2821534_2821816_-|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846406.1|2821819_2822023_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000988633.1|2822022_2822532_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000203418.1|2822631_2823375_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.6	7.3e-123
WP_001248594.1|2823378_2824452_-|capsid	phage major capsid protein, P2 family	capsid	Q83VT1	Escherichia_phage	99.2	1.6e-200
WP_001085952.1|2824510_2825365_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_000156848.1|2825538_2827311_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.7	0.0e+00
WP_000038161.1|2827310_2828345_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000844437.1|2828662_2830630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302413.1|2830629_2831082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000063136.1|2831128_2832352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268574.1|2832441_2834724_-	replication endonuclease	NA	M1SV59	Escherichia_phage	91.3	0.0e+00
WP_000027664.1|2834713_2834989_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113265.1|2834985_2835210_-	TraR/DksA C4-type zinc finger protein	NA	S4TRY6	Salmonella_phage	98.6	3.2e-34
WP_001277898.1|2835212_2835512_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_000557698.1|2835511_2835736_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_000217670.1|2835799_2836300_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001005162.1|2836296_2836467_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_001081582.1|2836477_2836753_-	regulatory phage cox family protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000020919.1|2836874_2837174_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_000985260.1|2837289_2838303_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_001303579.1|2838567_2838885_-	hypothetical protein	NA	NA	NA	NA	NA
2838383:2838410	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807362.1|2839290_2840190_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 11
NC_013008	Escherichia coli O157:H7 str. TW14359, complete sequence	5528136	2865821	2942513	5528136	portal,holin,protease,tail,terminase,transposase,tRNA	Enterobacteria_phage(52.11%)	85	NA	NA
WP_001301615.1|2865821_2867855_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_162829202.1|2869507_2870720_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000356841.1|2876125_2879755_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636932.1|2879816_2880134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|2881374_2882463_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294377.1|2882473_2884003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528952.1|2884021_2884753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301655.1|2884745_2885882_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_001087225.1|2885878_2887882_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001295429.1|2888006_2888468_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2888509_2888980_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2889026_2889746_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001301761.1|2889742_2891428_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_001261937.1|2891942_2892191_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001023381.1|2892558_2892828_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	96.6	1.0e-42
WP_000268872.1|2892829_2894143_-|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	99.5	2.2e-77
WP_001228302.1|2894207_2894807_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	99.5	1.3e-109
WP_000514989.1|2894874_2898348_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_072147834.1|2898588_2899218_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_000194798.1|2899163_2899907_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_001301816.1|2899917_2900616_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000847298.1|2900615_2900945_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918269.1|2900941_2903587_-|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
WP_000438877.1|2903630_2903939_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	99.0	1.5e-53
WP_000479043.1|2903965_2904388_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|2904401_2905154_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|2905161_2905560_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|2905572_2906196_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|2906198_2906480_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|2906472_2906799_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114424.1|2906886_2908911_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000974564.1|2908855_2910358_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102414.1|2910357_2910570_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_001077625.1|2910566_2912690_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000348565.1|2912686_2913163_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001458485.1|2913195_2913468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012816791.1|2913679_2913865_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2914092_2914239_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2914238_2914808_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|2915078_2915612_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_000284506.1|2915616_2915832_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290230.1|2915909_2916155_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|2916195_2916375_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000142932.1|2916511_2918458_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_001356551.1|2919261_2919414_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204769.1|2919665_2920100_-	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_000971055.1|2920185_2920326_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|2920322_2920685_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774488.1|2920681_2920972_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_000224916.1|2920964_2921135_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_001054341.1|2921134_2921590_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	1.1e-60
WP_001303586.1|2921586_2921688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|2921804_2922602_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001302427.1|2922611_2923163_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000709082.1|2923627_2925154_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_032102575.1|2925211_2925319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070451.1|2925410_2925743_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|2925810_2926113_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_162829202.1|2926601_2927814_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000147876.1|2928120_2929140_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.4	4.0e-111
WP_001182899.1|2929136_2929676_-	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_001067457.1|2929745_2929976_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	69.3	3.8e-22
WP_000858974.1|2930080_2930770_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000380252.1|2930850_2931912_+	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_000866321.1|2931889_2932267_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000233576.1|2932747_2932954_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995439.1|2933029_2933326_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|2933331_2934117_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|2934113_2934791_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_001303590.1|2934790_2934973_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000548547.1|2934945_2935137_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_000188870.1|2935213_2935429_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000763383.1|2935527_2935749_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289954.1|2935745_2936693_+	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_001356547.1|2936694_2936871_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_000207903.1|2937204_2937561_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_000610375.1|2937557_2937920_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000457728.1|2938007_2938250_+	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000556581.1|2938253_2938388_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	97.7	1.4e-21
WP_001193437.1|2938406_2938661_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063648.1|2938694_2939981_+	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_027868261.1|2940001_2940703_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_001216963.1|2940762_2940870_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2940850_2941582_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569336.1|2941586_2942513_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 12
NC_013008	Escherichia coli O157:H7 str. TW14359, complete sequence	5528136	3157499	3256312	5528136	portal,holin,lysis,capsid,protease,tail,integrase,terminase,transposase,tRNA	Escherichia_phage(44.21%)	122	3179079:3179095	3253301:3253317
WP_001283590.1|3157499_3158312_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289184.1|3158311_3159325_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699109.1|3159390_3160527_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.8	3.1e-24
WP_000615802.1|3160625_3161621_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127753.1|3161617_3162796_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817183.1|3163070_3164291_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683769.1|3164449_3166456_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|3166576_3166855_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089225.1|3166888_3167437_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|3167436_3168246_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_001043834.1|3168245_3169070_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001297933.1|3169073_3170159_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001302029.1|3170193_3171126_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730817.1|3171291_3171843_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001301548.1|3172013_3172856_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000794741.1|3172857_3173379_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001301662.1|3173611_3173785_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000822672.1|3173781_3174252_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000675435.1|3174248_3174749_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000182852.1|3174759_3175518_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001112844.1|3175540_3178180_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000033336.1|3178261_3178825_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
3179079:3179095	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_001195817.1|3179470_3179956_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426146.1|3180158_3182303_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531969.1|3182302_3183613_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030901.1|3183792_3184077_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001301981.1|3184448_3185789_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000952959.1|3186153_3187185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|3187579_3188335_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|3188628_3189561_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000331680.1|3189782_3198158_-	hypothetical protein	NA	A0A0P0ZCC7	Stx2-converting_phage	100.0	0.0e+00
WP_000012445.1|3198226_3199492_-	hypothetical protein	NA	A0A0P0ZD72	Stx2-converting_phage	100.0	4.4e-229
WP_000540400.1|3199502_3199796_-	hypothetical protein	NA	A0A0P0ZDW9	Stx2-converting_phage	100.0	4.1e-13
WP_000455652.1|3199805_3200252_-	hypothetical protein	NA	V5UT82	Shigella_phage	100.0	1.1e-76
WP_000509483.1|3200254_3200911_-	hypothetical protein	NA	A0A0P0ZCM5	Stx2-converting_phage	100.0	5.1e-104
WP_000035557.1|3201005_3201407_-	hypothetical protein	NA	A0A088CC37	Shigella_phage	100.0	1.2e-71
WP_000078907.1|3201463_3201604_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000835361.1|3201834_3202569_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZH34	Escherichia_phage	100.0	9.7e-136
WP_001301884.1|3202659_3203277_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000455635.1|3203282_3203561_-	hypothetical protein	NA	A0A088CD71	Shigella_phage	100.0	1.1e-50
WP_000197192.1|3203575_3204844_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_001146323.1|3204840_3206466_-	hypothetical protein	NA	A0A0P0ZDC2	Stx2-converting_phage	100.0	0.0e+00
WP_001303606.1|3206760_3206949_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001024006.1|3207087_3207357_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_001301432.1|3207358_3209296_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZCY7	Stx2-converting_phage	100.0	1.1e-64
WP_000207923.1|3209292_3209943_-	hypothetical protein	NA	A0A2R2X2B3	Escherichia_phage	100.0	7.8e-121
WP_000829200.1|3209942_3210506_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_001290743.1|3210489_3210951_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_001140442.1|3211000_3211390_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_000214474.1|3211445_3212660_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000994870.1|3212683_3213100_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.6e-69
WP_162829202.1|3213230_3214443_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000787025.1|3215161_3217306_-|portal	portal protein	portal	A0A0P0ZBZ2	Stx2-converting_phage	100.0	0.0e+00
WP_000143988.1|3217305_3219012_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_001086069.1|3218992_3219799_-|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_001301714.1|3219854_3220058_-	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_000738505.1|3220207_3220501_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001082654.1|3220532_3220997_-|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000455406.1|3221004_3221154_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001056885.1|3221153_3221723_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_000087461.1|3221996_3222530_-	lysozyme	NA	V5USG4	Shigella_phage	100.0	7.9e-103
WP_000284506.1|3222534_3222750_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290212.1|3222826_3223099_-	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000143458.1|3223139_3223319_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000874499.1|3223453_3225391_-	SASA family carbohydrate esterase	NA	A0A1I9LJQ8	Stx_converting_phage	100.0	0.0e+00
WP_000738068.1|3225877_3226147_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|3226158_3227118_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001204880.1|3227899_3228334_-	antitermination protein	NA	G9L695	Escherichia_phage	100.0	2.8e-82
WP_000144764.1|3228326_3228521_-	phage NinH family protein	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001107963.1|3228517_3229123_-	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
WP_001292288.1|3229122_3229845_-	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCJ8	Stx2-converting_phage	100.0	5.4e-131
WP_001563210.1|3229837_3230047_-	protein ninF	NA	G9L691	Escherichia_phage	100.0	1.4e-31
WP_000924600.1|3230006_3230408_-	hypothetical protein	NA	G9L690	Escherichia_phage	100.0	1.4e-72
WP_000201603.1|3230482_3231157_-	phage antirepressor Ant	NA	G9L689	Escherichia_phage	100.0	1.6e-129
WP_001254258.1|3231413_3231608_-	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	2.9e-31
WP_000153301.1|3231604_3232132_-	phage N-6-adenine-methyltransferase	NA	A0A0N7KZD1	Stx2-converting_phage	100.0	7.3e-101
WP_000573864.1|3232128_3232731_-	HNH endonuclease	NA	G9L687	Escherichia_phage	100.0	1.7e-114
WP_001229012.1|3232723_3233140_-	recombination protein NinB	NA	G9L686	Escherichia_phage	100.0	3.9e-73
WP_000103680.1|3233313_3233529_-	hypothetical protein	NA	G9L684	Escherichia_phage	100.0	2.2e-32
WP_001000130.1|3233661_3233940_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000145935.1|3234010_3234301_-	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
WP_000788871.1|3234297_3234999_-	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	100.0	3.4e-130
WP_000185456.1|3234995_3235934_-	replication protein	NA	C1JJ53	Enterobacteria_phage	100.0	2.8e-172
WP_000438489.1|3235966_3236263_-	hypothetical protein	NA	A0A0N7KZD0	Stx2-converting_phage	100.0	5.2e-48
WP_001180318.1|3236401_3236629_-	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250473.1|3236707_3237415_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_000885202.1|3237475_3237817_+	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	100.0	5.1e-63
WP_001221210.1|3237884_3238346_+	hypothetical protein	NA	A0A0P0ZD85	Stx2-converting_phage	100.0	1.7e-77
WP_000957426.1|3238339_3239386_+	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_000745484.1|3239388_3239553_+	hypothetical protein	NA	A0A0P0ZCU5	Stx2-converting_phage	100.0	3.0e-21
WP_000198444.1|3240041_3240425_+	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000167595.1|3240483_3240954_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000065487.1|3241104_3241473_+	DUF2528 family protein	NA	A0A0P0ZCC3	Stx2-converting_phage	100.0	4.5e-65
WP_001198861.1|3241545_3241710_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372940.1|3241678_3241843_+	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	100.0	1.9e-23
WP_000995464.1|3241897_3242194_+	host-nuclease inhibitor protein Gam	NA	A0A0P0ZCL3	Stx2-converting_phage	100.0	2.1e-49
WP_000100845.1|3242199_3242985_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000186866.1|3242981_3243662_+	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	100.0	2.1e-132
WP_000682315.1|3243658_3243841_+	DUF1317 domain-containing protein	NA	Q6H9Z1	Enterobacteria_phage	100.0	9.7e-29
WP_000548531.1|3243813_3244005_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000188870.1|3244081_3244297_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000774248.1|3244395_3244617_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	100.0	3.8e-35
WP_001289942.1|3244613_3245561_+	ead/Ea22-like family protein	NA	A0A0P0ZDS3	Stx2-converting_phage	100.0	2.1e-183
WP_001301469.1|3245562_3246069_+	hypothetical protein	NA	A0A0N7C063	Escherichia_phage	100.0	4.2e-90
WP_001301947.1|3246028_3246244_+	hypothetical protein	NA	A0A0N7C076	Escherichia_phage	100.0	7.9e-38
WP_001142590.1|3246245_3246464_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_000212746.1|3246465_3246753_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_000206751.1|3246756_3247374_+	DUF551 domain-containing protein	NA	A0A1I9LJM0	Stx_converting_phage	100.0	7.7e-118
WP_000376712.1|3247373_3247658_+	DUF4752 family protein	NA	A0A0N7KZC7	Stx2-converting_phage	100.0	4.5e-49
WP_000203836.1|3248013_3248637_+	phage antirepressor Ant	NA	A0A0P0ZAZ7	Stx2-converting_phage	100.0	1.7e-112
WP_000669287.1|3248679_3248847_+	hypothetical protein	NA	A0A0P0ZCR2	Stx2-converting_phage	100.0	2.9e-27
WP_000268107.1|3248846_3249077_+	hypothetical protein	NA	Q08J65	Stx2-converting_phage	100.0	1.9e-37
WP_000163444.1|3249073_3249700_+	adenine methylase	NA	A0A2R2Z304	Escherichia_phage	100.0	1.0e-122
WP_001291844.1|3249659_3249872_+	DUF1382 family protein	NA	A0A2R2X2A7	Escherichia_phage	100.0	7.1e-31
WP_000994803.1|3249907_3250285_+	DUF1627 domain-containing protein	NA	A0A2R2Z2X7	Escherichia_phage	100.0	2.0e-52
WP_000453637.1|3250363_3250546_+	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_001218308.1|3250529_3251699_-|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	100.0	1.7e-230
WP_000958700.1|3252130_3253288_+|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000257010.1|3253462_3254599_-	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
3253301:3253317	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000960724.1|3254608_3255289_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000403517.1|3255275_3255743_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000950857.1|3255742_3256312_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
>prophage 13
NC_013008	Escherichia coli O157:H7 str. TW14359, complete sequence	5528136	3533889	3548640	5528136	tail,holin,transposase	Enterobacteria_phage(35.71%)	18	NA	NA
WP_000162574.1|3533889_3534372_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|3535217_3535466_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001132157.1|3535967_3536558_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001144077.1|3536740_3537391_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001301665.1|3537469_3538528_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_000442132.1|3538657_3539080_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001023396.1|3539240_3539510_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_162829202.1|3539727_3540940_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000612591.1|3541441_3541789_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|3541785_3542166_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000731241.1|3542522_3542867_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284517.1|3542871_3543087_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143065.1|3543236_3545090_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000499458.1|3545497_3545665_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3545750_3546494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|3546746_3547370_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|3547366_3548032_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223948.1|3548028_3548640_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
>prophage 14
NC_013008	Escherichia coli O157:H7 str. TW14359, complete sequence	5528136	5135479	5150144	5528136	tail,integrase,tRNA	Enterobacteria_phage(43.75%)	19	5136760:5136775	5154289:5154304
WP_000956557.1|5135479_5136013_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_000654815.1|5136209_5136383_+	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_001093918.1|5136430_5136712_-	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5136760:5136775	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000829415.1|5137056_5137254_-	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_000145668.1|5137589_5137874_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_001242740.1|5137870_5138221_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000008211.1|5138211_5138748_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001230514.1|5140069_5140669_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000268945.1|5140733_5142047_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001023355.1|5142048_5142318_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_001118000.1|5142429_5143002_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_072140863.1|5143074_5143704_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001143816.1|5143785_5144427_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_001217541.1|5144587_5144836_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000332269.1|5144897_5145995_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_000543818.1|5146083_5147121_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891404.1|5147254_5147497_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235522.1|5147662_5148646_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918366.1|5148728_5150144_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
5154289:5154304	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
>prophage 15
NC_013008	Escherichia coli O157:H7 str. TW14359, complete sequence	5528136	5287024	5346035	5528136	protease,transposase	Pectobacterium_phage(12.5%)	60	NA	NA
WP_000312488.1|5287024_5288284_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|5288286_5289291_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|5289372_5289570_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|5289673_5290972_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177633.1|5291176_5291602_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076303.1|5291640_5294082_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001293282.1|5294262_5294994_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220128.1|5295120_5295522_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511966.1|5295540_5296239_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012572.1|5296289_5296949_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|5296966_5297365_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101670.1|5297374_5298013_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943960.1|5298015_5299179_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_001301849.1|5299262_5300888_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|5301004_5301280_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254630.1|5301428_5301758_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569696.1|5301939_5302689_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|5302685_5303441_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|5303548_5304613_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_001301921.1|5304967_5306365_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218362.1|5306380_5306686_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776517.1|5306695_5307160_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|5307173_5307824_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949515.1|5307833_5308688_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170812.1|5308687_5309374_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000492914.1|5309502_5309778_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|5310104_5310500_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|5310506_5310821_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|5310825_5311053_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|5311094_5311544_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001301745.1|5311614_5312409_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604943.1|5313031_5313463_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_000826431.1|5313470_5314679_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_001119481.1|5314813_5315452_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|5315669_5316290_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|5316598_5318011_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331454.1|5318055_5318718_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001301505.1|5318825_5319791_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560631.1|5319898_5320759_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000084622.1|5320847_5321228_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589487.1|5321345_5323289_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886884.1|5323478_5324219_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000937659.1|5324430_5325369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175287.1|5325431_5325986_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|5326310_5326517_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935036.1|5326595_5327939_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001301936.1|5328261_5328900_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|5329105_5330839_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060930.1|5330835_5334615_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|5334617_5334959_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223210.1|5335170_5335422_+	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_000239579.1|5335415_5335766_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055075.1|5335845_5336376_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265942.1|5336685_5337642_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_001301928.1|5339297_5340320_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596020.1|5340306_5341302_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853749.1|5341334_5342333_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_001219792.1|5342508_5343882_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|5344037_5344589_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|5344682_5346035_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 1
NC_013010	Escherichia coli O157:H7 str. TW14359 plasmid pO157, complete sequence	94601	29136	37002	94601	transposase,integrase	Macacine_betaherpesvirus(66.67%)	7	25960:25973	34392:34405
25960:25973	attL	TACAGTTCAAAAAG	NA	NA	NA	NA
WP_162829348.1|29136_30350_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_027868286.1|30403_30703_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|30703_31510_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_162829240.1|32232_33446_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.4e-168
WP_000852148.1|33521_34277_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	99.6	1.1e-142
WP_000772446.1|34864_36031_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
34392:34405	attR	CTTTTTGAACTGTA	NA	NA	NA	NA
WP_000817031.1|36030_37002_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
