The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_014034	Rhodobacter capsulatus SB 1003, complete sequence	3738958	980420	1093535	3738958	head,holin,transposase,capsid,portal,integrase,tail,protease,terminase	Rhodobacter_phage(69.74%)	118	1038025:1038044	1070594:1070613
WP_023911097.1|980420_981467_-|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	33.2	2.1e-19
WP_013066638.1|981478_982495_-|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_013066639.1|982585_983512_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_013066640.1|983628_984213_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_013066641.1|984209_985661_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_013066642.1|985744_987400_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.0	6.5e-55
WP_013066643.1|987453_988089_+	thermonuclease family protein	NA	NA	NA	NA	NA
WP_013066644.1|988163_988718_+	DUF1003 domain-containing protein	NA	NA	NA	NA	NA
WP_013066645.1|988793_989033_+	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_013066646.1|989092_990490_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_013066647.1|990599_991160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013066648.1|991153_992338_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_013066649.1|992623_992974_-	DMT family protein	NA	NA	NA	NA	NA
WP_013066650.1|993150_994683_+	acyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
WP_013066651.1|994693_995233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013066653.1|995660_996059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013066654.1|996387_996597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013066655.1|996750_998736_+	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_013066656.1|998826_1000956_+	methylmalonyl-CoA mutase	NA	NA	NA	NA	NA
WP_013066657.1|1001078_1001564_-	bacterioferritin	NA	NA	NA	NA	NA
WP_013066658.1|1001585_1001828_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_080514577.1|1001826_1002693_+	phosphatidylserine decarboxylase	NA	A0A1V0SDU9	Indivirus	38.8	1.4e-11
WP_013066660.1|1002694_1003432_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_131618281.1|1009753_1010872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013066661.1|1011160_1011400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013066662.1|1011423_1012062_-	N-acetylmuramoyl-L-alanine amidase	NA	F8TVB6	EBPR_siphovirus	56.0	2.9e-59
WP_013066663.1|1012293_1014177_-	DUF2793 domain-containing protein	NA	A0A0K1LM54	Rhodobacter_phage	31.0	2.2e-30
WP_013066664.1|1014190_1018162_-|tail	glycoside hydrolase/phage tail family protein	tail	A0A0B5A7K5	Paracoccus_phage	39.9	6.9e-252
WP_013066665.1|1018167_1018623_-	peptidase	NA	F4YXU4	Roseobacter_phage	43.7	6.0e-27
WP_013066666.1|1018615_1019521_-	DUF2163 domain-containing protein	NA	A0A1V0DY93	Dinoroseobacter_phage	43.8	3.3e-61
WP_013066667.1|1019517_1019817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013066668.1|1019813_1020440_-	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	56.8	1.0e-61
WP_013066669.1|1020440_1022537_-|tail	phage tail length tape measure family protein	tail	A0A0B5A0F2	Paracoccus_phage	29.1	6.2e-18
WP_181443899.1|1022533_1022677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013066671.1|1022805_1023213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013066672.1|1023224_1024169_-	hypothetical protein	NA	G8DH51	Emiliania_huxleyi_virus	51.1	7.7e-85
WP_013066673.1|1024193_1024634_-	hypothetical protein	NA	G8DH50	Emiliania_huxleyi_virus	50.4	2.4e-28
WP_013066674.1|1024687_1025884_-	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_013066675.1|1026001_1026643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013066676.1|1026639_1026954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013066677.1|1026955_1027294_-	DUF2190 family protein	NA	A0A2I7QRW1	Vibrio_phage	37.6	7.4e-06
WP_013066678.1|1027320_1029339_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2I7QRU0	Vibrio_phage	30.4	7.4e-69
WP_013066679.1|1029431_1029989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013066680.1|1029997_1031521_-|portal	phage portal protein	portal	B7SYD6	Stenotrophomonas_phage	39.3	4.0e-83
WP_013066681.1|1031517_1031727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050759960.1|1031726_1033652_-|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	56.4	7.3e-199
WP_013066683.1|1033695_1034304_-	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	47.5	4.4e-33
WP_013066684.1|1034395_1034617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013066685.1|1034628_1035546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131618282.1|1035579_1035882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013066686.1|1035950_1036655_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_013066687.1|1036651_1037626_-	DNA methyltransferase	NA	A0A1P8VV91	Erythrobacter_phage	31.5	9.8e-59
WP_013066688.1|1037618_1038395_-	ParB N-terminal domain-containing protein	NA	K4HZA5	Acidithiobacillus_phage	69.4	2.3e-47
1038025:1038044	attL	TCGTCAAAGCCGATCAGGTC	NA	NA	NA	NA
WP_013066689.1|1038655_1039177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013066690.1|1039206_1040172_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_131618283.1|1040168_1040363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013066692.1|1040376_1040631_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013066693.1|1040945_1041536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013066694.1|1041678_1042908_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A221SAN4	Ralstonia_phage	33.1	4.6e-37
WP_031320977.1|1043105_1046486_+	type I restriction-modification system endonuclease	NA	A0A2P1MXB6	Escherichia_phage	22.8	6.7e-06
WP_013066696.1|1046485_1047955_+	N-6 DNA methylase	NA	A0A2H4UVB0	Bodo_saltans_virus	27.6	4.1e-16
WP_013066697.1|1047951_1048878_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_013066698.1|1048874_1050500_+	restriction endonuclease subunit S	NA	B3GAM1	uncultured_virus	23.8	1.5e-11
WP_013066699.1|1050499_1052152_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_013066700.1|1052148_1053003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013066702.1|1053809_1054994_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.0	1.3e-20
WP_013066703.1|1055081_1056062_-	hypothetical protein	NA	G8GWG3	Rhodobacter_phage	100.0	7.0e-174
WP_013066704.1|1056061_1056328_-	hypothetical protein	NA	G8GWG2	Rhodobacter_phage	100.0	8.6e-34
WP_013066705.1|1056358_1057690_-	hypothetical protein	NA	G8GWG1	Rhodobacter_phage	100.0	5.0e-255
WP_013066706.1|1057716_1061145_-|tail	tail protein	tail	G8GWG0	Rhodobacter_phage	100.0	0.0e+00
WP_013066707.1|1061141_1061582_-	C40 family peptidase	NA	G8GWF9	Rhodobacter_phage	100.0	3.0e-84
WP_013066708.1|1061584_1062112_-	hypothetical protein	NA	G8GWF8	Rhodobacter_phage	100.0	2.8e-92
WP_013066709.1|1062108_1062531_-	hypothetical protein	NA	G8GWF7	Rhodobacter_phage	100.0	3.7e-63
WP_013066710.1|1062527_1065611_-|tail	phage tail length tape measure family protein	tail	G8GWF6	Rhodobacter_phage	100.0	0.0e+00
WP_013066711.1|1065612_1065828_-	DUF1799 domain-containing protein	NA	G8GWF5	Rhodobacter_phage	98.6	4.8e-35
WP_013066712.1|1065961_1066339_-	hypothetical protein	NA	G8GWF4	Rhodobacter_phage	100.0	8.9e-69
WP_013066713.1|1066471_1067398_-	hypothetical protein	NA	G8GWF3	Rhodobacter_phage	100.0	2.0e-170
WP_013066714.1|1067400_1067598_-	hypothetical protein	NA	G8GWF2	Rhodobacter_phage	100.0	8.9e-28
WP_013066715.1|1067600_1068032_-	hypothetical protein	NA	G8GWF1	Rhodobacter_phage	100.0	1.0e-76
WP_013066716.1|1068031_1068457_-	DUF1320 domain-containing protein	NA	G8GWF0	Rhodobacter_phage	100.0	4.4e-72
WP_013066717.1|1068456_1068747_-	hypothetical protein	NA	G8GWE9	Rhodobacter_phage	100.0	3.0e-48
WP_013066718.1|1068817_1069306_-	hypothetical protein	NA	G8GWE8	Rhodobacter_phage	100.0	4.0e-53
WP_013066719.1|1069370_1070324_-|capsid	major capsid protein	capsid	G8GWE7	Rhodobacter_phage	100.0	2.6e-181
WP_013066720.1|1070334_1070679_-	DUF2190 family protein	NA	G8GWE6	Rhodobacter_phage	100.0	5.3e-52
1070594:1070613	attR	TCGTCAAAGCCGATCAGGTC	NA	NA	NA	NA
WP_013066721.1|1070691_1071804_-	hypothetical protein	NA	G8GWE4	Rhodobacter_phage	100.0	8.8e-189
WP_013066722.1|1072071_1072626_-	phage virion morphogenesis protein	NA	G8GWE3	Rhodobacter_phage	100.0	4.6e-98
WP_013066723.1|1072718_1074200_-|head	head morphogenesis protein	head	G8GWE2	Rhodobacter_phage	100.0	4.9e-296
WP_013066724.1|1074295_1075672_-	DUF935 family protein	NA	G8GWE1	Rhodobacter_phage	99.8	2.8e-261
WP_013066725.1|1075668_1075893_-	hypothetical protein	NA	G8GWE0	Rhodobacter_phage	100.0	2.6e-39
WP_016042342.1|1075889_1076228_-	hypothetical protein	NA	G8GWD9	Rhodobacter_phage	100.0	2.7e-64
WP_016042341.1|1076227_1076377_-	hypothetical protein	NA	G8GWD8	Rhodobacter_phage	100.0	2.3e-20
WP_013066727.1|1076376_1078035_-|terminase	phage terminase large subunit	terminase	G8GWD7	Rhodobacter_phage	99.8	3.0e-312
WP_013066728.1|1078031_1078535_-	DUF1804 family protein	NA	G8GWD6	Rhodobacter_phage	100.0	1.2e-84
WP_013066729.1|1078521_1078788_-	hemolysin XhlA family protein	NA	G8GWD5	Rhodobacter_phage	100.0	2.5e-41
WP_013066730.1|1078784_1079297_-	hypothetical protein	NA	G8GWD4	Rhodobacter_phage	100.0	2.2e-86
WP_013066731.1|1079296_1080226_-	lysozyme	NA	G8GWD3	Rhodobacter_phage	100.0	3.7e-172
WP_013066732.1|1080297_1080666_-	helix-turn-helix domain-containing protein	NA	G8GWD2	Rhodobacter_phage	100.0	1.1e-63
WP_013066733.1|1080714_1081392_-	DUF2786 domain-containing protein	NA	G8GWD1	Rhodobacter_phage	100.0	9.9e-119
WP_013066735.1|1081495_1081942_-	regulatory protein GemA	NA	G8GWC9	Rhodobacter_phage	100.0	6.0e-80
WP_013066736.1|1081938_1082154_-	hypothetical protein	NA	G8GWC8	Rhodobacter_phage	100.0	1.1e-34
WP_013066737.1|1082150_1083035_-	hypothetical protein	NA	G8GWC7	Rhodobacter_phage	100.0	3.7e-158
WP_013066738.1|1083111_1083387_-	HU family DNA-binding protein	NA	G8GWC6	Rhodobacter_phage	100.0	2.3e-42
WP_016042339.1|1083479_1083713_-	hypothetical protein	NA	G8GWC5	Rhodobacter_phage	100.0	3.3e-37
WP_013066740.1|1083712_1084255_-	host-nuclease inhibitor Gam family protein	NA	G8GWC4	Rhodobacter_phage	100.0	3.8e-89
WP_013066741.1|1084241_1084607_-	hypothetical protein	NA	G8GWC3	Rhodobacter_phage	100.0	2.6e-65
WP_013066742.1|1084597_1085185_-	hypothetical protein	NA	G8GWC2	Rhodobacter_phage	100.0	1.1e-100
WP_013066743.1|1085184_1085958_-	ATP-binding protein	NA	G8GWC1	Rhodobacter_phage	100.0	3.9e-143
WP_044033673.1|1085990_1088279_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	G8GWC0	Rhodobacter_phage	99.9	0.0e+00
WP_013066745.1|1088287_1088755_-	hypothetical protein	NA	G8GWB9	Rhodobacter_phage	100.0	3.3e-81
WP_013066746.1|1088756_1089608_-	ParB N-terminal domain-containing protein	NA	G8GWB8	Rhodobacter_phage	100.0	1.8e-154
WP_013066747.1|1089617_1089809_-	hypothetical protein	NA	G8GWB7	Rhodobacter_phage	100.0	4.4e-24
WP_013066748.1|1089808_1090099_-	hypothetical protein	NA	G8GWB6	Rhodobacter_phage	100.0	7.6e-52
WP_013066751.1|1090344_1090662_-	hypothetical protein	NA	G8GWB3	Rhodobacter_phage	100.0	2.7e-50
WP_013066752.1|1090658_1090952_-	helix-turn-helix domain-containing protein	NA	G8GWB2	Rhodobacter_phage	100.0	4.0e-48
WP_016042336.1|1091096_1091813_+	helix-turn-helix domain-containing protein	NA	G8GWB1	Rhodobacter_phage	100.0	5.0e-137
WP_013066754.1|1091974_1092355_+	hypothetical protein	NA	G8GWB0	Rhodobacter_phage	100.0	8.4e-67
WP_013066755.1|1092366_1092843_+	hypothetical protein	NA	G8GWA9	Rhodobacter_phage	100.0	2.4e-87
WP_013066756.1|1092845_1093535_+	hypothetical protein	NA	G8GWA8	Rhodobacter_phage	100.0	2.0e-135
>prophage 2
NC_014034	Rhodobacter capsulatus SB 1003, complete sequence	3738958	1519773	1527630	3738958		Emiliania_huxleyi_virus(50.0%)	9	NA	NA
WP_013067131.1|1519773_1520343_-	lysozyme	NA	F8TV87	EBPR_siphovirus	51.4	3.1e-41
WP_013067133.1|1520471_1520822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013067134.1|1520818_1521445_-	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	55.8	3.5e-62
WP_013067135.1|1521454_1523896_-	hypothetical protein	NA	A0A0K1LLC2	Rhodobacter_phage	42.9	3.3e-15
WP_031321105.1|1523888_1524080_-	hypothetical protein	NA	G8DH53	Emiliania_huxleyi_virus	61.9	4.2e-06
WP_013067137.1|1524557_1525454_-	hypothetical protein	NA	G8DH51	Emiliania_huxleyi_virus	54.5	1.2e-87
WP_013067138.1|1525478_1525901_-	hypothetical protein	NA	G8DH50	Emiliania_huxleyi_virus	52.9	1.1e-35
WP_013067139.1|1526031_1526985_+	serine/threonine protein kinase	NA	W5S4J6	Pithovirus	26.4	7.9e-13
WP_013067140.1|1527006_1527630_-	hypothetical protein	NA	G8DH49	Emiliania_huxleyi_virus	50.7	1.4e-50
>prophage 3
NC_014034	Rhodobacter capsulatus SB 1003, complete sequence	3738958	1762772	1835558	3738958	head,capsid,portal,tRNA,tail,protease	Roseobacter_phage(18.75%)	71	NA	NA
WP_050759972.1|1762772_1764083_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_013067355.1|1764176_1764350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013067356.1|1764471_1766874_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_013067357.1|1766934_1767510_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_013067358.1|1767614_1768076_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_013067359.1|1768078_1768873_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_080514600.1|1768946_1769672_+	UDP-2,3-diacylglucosamine diphosphatase LpxI	NA	NA	NA	NA	NA
WP_013067361.1|1769668_1770820_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_013067362.1|1770807_1771545_-	5-oxoprolinase subunit PxpA	NA	NA	NA	NA	NA
WP_013067363.1|1771541_1772555_-	biotin-dependent carboxyltransferase family protein	NA	NA	NA	NA	NA
WP_013067364.1|1772551_1773271_-	carboxyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_013067365.1|1773267_1774152_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_013067366.1|1774155_1776579_-	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_013067367.1|1776599_1780028_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_013067368.1|1780203_1783095_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_037091514.1|1783091_1783964_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013067370.1|1783993_1784677_-	cytochrome c-550 PedF	NA	NA	NA	NA	NA
WP_013067371.1|1784877_1785858_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013067372.1|1785866_1786685_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_013067373.1|1786681_1787275_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_013067374.1|1787501_1788293_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_115503947.1|1788289_1789090_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.3	8.1e-11
WP_013067376.1|1789028_1789454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013067377.1|1789462_1790425_-	YVTN family beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_013067378.1|1790421_1791591_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013067379.1|1791708_1792251_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_013067380.1|1792364_1792751_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_013067381.1|1793108_1794878_+	PQQ-dependent methanol/ethanol family dehydrogenase	NA	A0A0B5IX34	Pandoravirus	23.4	2.2e-16
WP_013067382.1|1795034_1795754_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_013067383.1|1795800_1796970_+	FIST C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_013067384.1|1796976_1799214_+	PAS-domain containing protein	NA	A0A2K9L0Z8	Tupanvirus	28.6	1.7e-10
WP_044033654.1|1799203_1800340_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_013067386.1|1800466_1800745_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_013067387.1|1800840_1801554_+	response regulator transcription factor	NA	F4YXP8	Roseobacter_phage	49.5	1.4e-17
WP_044033685.1|1801620_1803741_+	NAD-dependent DNA ligase LigA	NA	A0A289ZTZ3	Serratia_phage	40.4	9.8e-96
WP_013067389.1|1803737_1805831_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_013067391.1|1806137_1807550_-	methyl-accepting chemotaxis sensory transducer	NA	A0A2H4J162	uncultured_Caudovirales_phage	46.4	8.2e-06
WP_013067392.1|1807612_1808041_-	iron-sulfur cluster assembly scaffold protein	NA	NA	NA	NA	NA
WP_013067393.1|1808098_1808461_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_080514601.1|1808776_1809307_+	Hint domain-containing protein	NA	NA	NA	NA	NA
WP_013067395.1|1809395_1810250_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_013067396.1|1810318_1810957_-	NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_013067397.1|1811126_1811465_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_013067398.1|1811546_1812956_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_013067399.1|1813173_1814103_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_013067400.1|1814183_1814921_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_013067402.1|1815124_1815358_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_013067403.1|1815424_1815973_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_013067404.1|1816064_1817327_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_037091459.1|1817326_1818496_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_013067406.1|1818688_1819012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031321187.1|1818962_1820309_+	DNA-packaging protein	NA	A0A0K1LMR9	Caulobacter_phage	37.3	2.1e-64
WP_013067408.1|1820494_1821685_+|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	39.9	1.9e-64
WP_031323538.1|1821694_1821922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013067410.1|1821932_1822487_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	54.2	3.6e-34
WP_037091462.1|1822554_1823715_+|capsid	phage major capsid protein	capsid	B0VK33	Azospirillum_phage	43.5	3.7e-65
WP_013067412.1|1823887_1824481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013067413.1|1824477_1824816_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_013067414.1|1824812_1825220_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_013067415.1|1825260_1825674_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_013067416.1|1825681_1826008_+	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_013067417.1|1826004_1826232_+|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_013067418.1|1826218_1826878_+|tail	phage tail tape measure protein	tail	D6PFD6	uncultured_phage	32.8	1.3e-11
WP_013067419.1|1826888_1827521_+	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	48.8	2.0e-57
WP_013067420.1|1827520_1828411_+	DUF2163 domain-containing protein	NA	A0A0K0PVK1	Roseobacter_phage	40.9	1.7e-54
WP_013067421.1|1828407_1828860_+	peptidase	NA	F4YXU4	Roseobacter_phage	49.3	3.3e-33
WP_013067422.1|1828860_1832775_+|tail	glycoside hydrolase/phage tail family protein	tail	A0A0B5A7K5	Paracoccus_phage	38.3	8.6e-215
WP_013067423.1|1832778_1833195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013067424.1|1833136_1833955_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_013067425.1|1833963_1834623_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_013067426.1|1834619_1835558_+	phosphatidate cytidylyltransferase	NA	A0A2K9L268	Tupanvirus	29.1	3.6e-10
>prophage 4
NC_014034	Rhodobacter capsulatus SB 1003, complete sequence	3738958	1839798	1848175	3738958	tRNA	uncultured_Mediterranean_phage(33.33%)	9	NA	NA
WP_013067431.1|1839798_1840683_-	fructose bisphosphate aldolase	NA	A0A0K0KVJ8	Prochlorococcus_phage	29.4	3.0e-06
WP_013067432.1|1840857_1842048_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_013067433.1|1842257_1842764_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	59.4	2.1e-44
WP_013067434.1|1842756_1843338_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	59.9	1.1e-41
WP_013067435.1|1843485_1844736_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	38.5	3.9e-68
WP_013067436.1|1844795_1845938_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_013067437.1|1846092_1846347_+	DUF2798 domain-containing protein	NA	NA	NA	NA	NA
WP_013067438.1|1846347_1846776_-	cupin domain-containing protein	NA	A0A291ATU0	Pandoravirus	41.1	1.2e-24
WP_013067439.1|1846900_1848175_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	61.6	1.1e-147
>prophage 5
NC_014034	Rhodobacter capsulatus SB 1003, complete sequence	3738958	2124267	2157368	3738958	head,holin,capsid,portal,tRNA,tail,terminase	Rhodobacter_phage(13.33%)	42	NA	NA
WP_013067684.1|2124267_2125104_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_013067685.1|2125100_2126438_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_013067686.1|2126505_2126856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013067687.1|2126916_2127621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080514607.1|2127650_2130443_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	36.9	2.3e-92
WP_013067689.1|2130552_2131038_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_013067690.1|2131040_2131625_-	DedA family protein	NA	NA	NA	NA	NA
WP_013067691.1|2131764_2132673_+	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	32.7	9.5e-32
WP_013067692.1|2132981_2133188_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013067694.1|2133935_2134133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013067695.1|2134129_2134339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013067696.1|2134424_2134718_-	DUF2312 domain-containing protein	NA	A0A1X9HX62	Ruegeria_phage	54.8	1.3e-19
WP_013067697.1|2134787_2135006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013067698.1|2135216_2135831_-	BRCT domain-containing protein	NA	NA	NA	NA	NA
WP_148214849.1|2136297_2136780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013067700.1|2136776_2137223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013067701.1|2137219_2137549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050759977.1|2137815_2138325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013067703.1|2138498_2139080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013067704.1|2139076_2139988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013067705.1|2140110_2140485_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	40.5	2.5e-07
WP_013067706.1|2140607_2141048_+|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_013067707.1|2141031_2142705_+|terminase	phage terminase family protein	terminase	C7BGG7	Burkholderia_phage	36.5	1.1e-89
WP_115503960.1|2142782_2143982_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	26.6	3.7e-23
WP_013067709.1|2143985_2144897_+	S49 family peptidase	NA	A0A219YB02	Aeromonas_phage	26.0	4.2e-11
WP_023911500.1|2145029_2146376_+|capsid	phage major capsid protein	capsid	A4JX01	Burkholderia_virus	42.4	2.8e-64
WP_013067711.1|2146430_2146991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013067712.1|2146990_2147923_+|head,tail	head-tail adaptor protein	head,tail	I3UM03	Rhodobacter_phage	45.1	6.1e-10
WP_013067713.1|2147919_2148423_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_013067714.1|2148422_2148572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013067715.1|2148575_2148944_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_013067716.1|2148954_2149395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013067717.1|2149400_2149757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013067718.1|2149834_2150071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013067719.1|2150121_2153001_+	phage membrane protein	NA	A0A1Q1PW43	Pseudoalteromonas_phage	48.7	6.7e-47
WP_013067720.1|2152997_2153936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013067721.1|2153935_2154880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013067722.1|2154879_2155374_+	DUF4376 domain-containing protein	NA	A0A1S5R1J2	Pseudomonas_phage	47.3	1.6e-12
WP_013067723.1|2155435_2155756_+|holin	phage holin family protein	holin	I3UM16	Rhodobacter_phage	80.2	1.9e-40
WP_013067724.1|2155757_2156432_+	TIGR02594 family protein	NA	R9TRQ2	Rhizobium_phage	41.7	3.0e-35
WP_013067725.1|2156450_2156798_+	hypothetical protein	NA	A0A1B0T6I8	Thiobacimonas_phage	43.8	5.1e-10
WP_023911505.1|2156966_2157368_+	DNA adenine methylase	NA	A0A291AUP9	Sinorhizobium_phage	64.3	1.0e-30
>prophage 6
NC_014034	Rhodobacter capsulatus SB 1003, complete sequence	3738958	2499271	2508094	3738958	head,capsid,portal,integrase,tail	Erysipelothrix_phage(25.0%)	12	2499136:2499152	2516819:2516835
2499136:2499152	attL	TGGTCGGGGCGGCGAGA	NA	NA	NA	NA
WP_013068035.1|2499271_2501080_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_013068036.1|2501157_2502363_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	35.8	1.6e-55
WP_013068037.1|2502355_2502676_+	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_013068038.1|2502672_2504184_+|capsid	phage major capsid protein	capsid	A0A0U2BX10	Paracoccus_phage	34.7	1.7e-22
WP_013068039.1|2504187_2504826_+|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_013068040.1|2504828_2505173_+	HNH endonuclease	NA	M1PLL8	Streptococcus_phage	42.0	1.1e-17
WP_013068041.1|2505165_2505432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131618310.1|2505922_2506408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013068043.1|2506599_2506884_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0R6PKP1	Moraxella_phage	38.6	9.2e-10
WP_013068044.1|2506885_2507365_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_013068045.1|2507357_2507780_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_013068046.1|2507782_2508094_+|head	phage head closure protein	head	NA	NA	NA	NA
2516819:2516835	attR	TGGTCGGGGCGGCGAGA	NA	NA	NA	NA
>prophage 7
NC_014034	Rhodobacter capsulatus SB 1003, complete sequence	3738958	2917363	2925216	3738958		Acidithiobacillus_phage(66.67%)	9	NA	NA
WP_115503985.1|2917363_2917876_+	hypothetical protein	NA	K4HZ96	Acidithiobacillus_phage	41.7	3.5e-23
WP_013068437.1|2917976_2918834_+	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	47.8	1.6e-60
WP_013068438.1|2918855_2919641_+	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	37.8	1.4e-20
WP_013068439.1|2919723_2919954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031321475.1|2920094_2920322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013068440.1|2920332_2920542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013068441.1|2920538_2921339_+	hypothetical protein	NA	K4HZA0	Acidithiobacillus_phage	53.4	4.0e-66
WP_013068442.1|2921331_2922651_+	AAA family ATPase	NA	A0A0F6SJ43	Sinorhizobium_phage	37.9	5.2e-63
WP_013068443.1|2922660_2925216_+	toprim domain-containing protein	NA	A0A2D1GN57	Marinobacter_phage	40.7	1.8e-75
>prophage 8
NC_014034	Rhodobacter capsulatus SB 1003, complete sequence	3738958	3111015	3118797	3738958		Thiobacimonas_phage(33.33%)	13	NA	NA
WP_013068614.1|3111015_3111981_-	hypothetical protein	NA	G8CLB2	Synechococcus_phage	32.3	1.2e-37
WP_013068616.1|3112180_3112618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013068617.1|3112617_3113046_-	DUF1320 domain-containing protein	NA	A0A1B0T6F3	Thiobacimonas_phage	49.3	5.4e-30
WP_013068618.1|3113165_3113405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013068619.1|3113467_3114442_-	hypothetical protein	NA	A0A219VH83	Ochrobactrum_phage	51.7	2.8e-82
WP_013068620.1|3114465_3114849_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_013068621.1|3114845_3115946_-	hypothetical protein	NA	A0A1B0T6E7	Thiobacimonas_phage	39.6	1.5e-47
WP_013068622.1|3116051_3116507_-	phage virion morphogenesis protein	NA	M4ST99	Rhodobacter_phage	35.9	1.7e-21
WP_023911836.1|3116503_3116836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013068625.1|3116968_3117376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013068626.1|3117359_3117695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013068627.1|3117694_3117952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013068628.1|3118047_3118797_+	LexA family transcriptional regulator	NA	G8GWB1	Rhodobacter_phage	30.2	6.4e-18
