The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_011757	Methylorubrum extorquens CM4, complete sequence	5777908	43740	112536	5777908	integrase,transposase	Feldmannia_species_virus(11.11%)	56	101519:101538	116628:116647
WP_012605221.1|43740_45246_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_012605222.1|45543_47052_-	phospholipase D	NA	NA	NA	NA	NA
WP_012605223.1|47936_50369_+	PAS domain S-box protein	NA	B5LWA6	Feldmannia_species_virus	32.0	3.0e-08
WP_012605224.1|51178_51424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012605225.1|51542_52610_-	M42 family metallopeptidase	NA	NA	NA	NA	NA
WP_009867550.1|53375_54644_-|transposase	IS256-like element ISMex3 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.7	2.5e-91
WP_012605228.1|56765_57083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012605229.1|57563_57809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012605231.1|59437_59674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012605232.1|59670_60825_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012605233.1|61093_61807_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_012605234.1|61806_62067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012605235.1|62360_64874_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_012605236.1|65142_65886_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_012605237.1|65961_66474_+	DUF3280 domain-containing protein	NA	NA	NA	NA	NA
WP_012605238.1|66522_66729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012605239.1|67353_67593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012605241.1|68104_68266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041928818.1|68835_69102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012605243.1|70656_70860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012605244.1|70991_71453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012605246.1|73188_73758_+|integrase	site-specific integrase	integrase	K4JX14	Caulobacter_virus	34.7	1.4e-20
WP_012605247.1|73799_74081_-	DUF2312 domain-containing protein	NA	A0A0F6R615	Sinorhizobium_phage	50.6	2.1e-14
WP_012605248.1|74138_75338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012605249.1|75405_75591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012605250.1|75595_76063_+	hypothetical protein	NA	A0A067XQB2	Caulobacter_phage	52.0	1.2e-41
WP_012605252.1|76823_77417_+	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	41.2	4.4e-22
WP_193373763.1|77440_77689_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_012605254.1|77827_78730_-	restriction endonuclease	NA	A0A1B1IUE7	uncultured_Mediterranean_phage	32.6	8.6e-09
WP_012605255.1|79023_80214_-	DUF3644 domain-containing protein	NA	NA	NA	NA	NA
WP_012605256.1|80613_81936_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_012605257.1|82274_83273_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012605258.1|83581_83803_+	WGxxGxxG-CTERM domain-containing protein	NA	NA	NA	NA	NA
WP_012605259.1|84325_85264_-	homocysteine S-methyltransferase family protein	NA	NA	NA	NA	NA
WP_012605260.1|85732_86107_-	response regulator	NA	NA	NA	NA	NA
WP_012605261.1|86873_87816_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	21.7	6.2e-10
WP_041928827.1|87836_88502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_193373769.1|88686_89010_-	phasin family protein	NA	NA	NA	NA	NA
WP_012605264.1|89404_89905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012605265.1|90421_91237_+	universal stress protein	NA	NA	NA	NA	NA
WP_012605267.1|91561_91825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012605268.1|92144_92657_+	DUF3280 domain-containing protein	NA	NA	NA	NA	NA
WP_012605239.1|93536_93776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012605240.1|93794_94088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012605241.1|94287_94449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012605270.1|95018_95285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012605271.1|96286_96439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012605273.1|97280_104309_-	heme peroxidase	NA	NA	NA	NA	NA
101519:101538	attL	CGACGCGCTCGATCAGCTTG	NA	NA	NA	NA
WP_041928836.1|104802_105057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012605275.1|105053_105320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041928841.1|106210_106447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012605276.1|106595_108290_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	29.5	2.8e-05
WP_012605277.1|108483_108855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012605278.1|109024_110029_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_158020048.1|110041_111037_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012605280.1|111213_112536_-|integrase	integrase	integrase	NA	NA	NA	NA
116628:116647	attR	CGACGCGCTCGATCAGCTTG	NA	NA	NA	NA
>prophage 2
NC_011757	Methylorubrum extorquens CM4, complete sequence	5777908	240256	267836	5777908	head,portal,capsid,terminase,integrase	uncultured_Caudovirales_phage(22.22%)	42	234962:234977	267243:267258
234962:234977	attL	GTGAACTACTTCACCG	NA	NA	NA	NA
WP_012605388.1|240256_241786_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012605389.1|242064_243291_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	46.2	9.6e-88
WP_012605390.1|243212_243455_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012605391.1|243570_243789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012605392.1|244014_244194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158020049.1|244226_244448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080515594.1|244425_245277_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2H4J418	uncultured_Caudovirales_phage	42.1	3.0e-56
WP_012605395.1|245321_245717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012605396.1|245710_246061_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012605397.1|246064_246496_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_012605398.1|246492_246702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012605399.1|246698_246995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012605400.1|246996_247278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012605401.1|247284_247803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012605402.1|247869_248310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080515505.1|248746_249547_-	helix-turn-helix domain-containing protein	NA	R9TRS6	Rhizobium_phage	24.6	2.1e-06
WP_012605404.1|249527_249776_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012605405.1|249783_249933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012605406.1|249971_250244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012605407.1|250429_250678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012605408.1|250899_251322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041928859.1|251396_251972_+	RusA family crossover junction endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_012605410.1|251968_252175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012605411.1|252171_252399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158020050.1|252395_253358_+	hypothetical protein	NA	M4QM11	Sulfitobacter_phage	43.8	1.2e-19
WP_049832661.1|253257_253950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012605413.1|253946_254333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012605414.1|254500_254962_+	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	49.6	4.8e-24
WP_012605415.1|255069_255783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012605416.1|255987_258288_-	response regulator	NA	NA	NA	NA	NA
WP_012605417.1|258517_258781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012605418.1|258868_259117_+	WGxxGxxG-CTERM domain-containing protein	NA	NA	NA	NA	NA
WP_012605419.1|259251_259470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012605421.1|260014_260167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012605422.1|260292_260931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012605423.1|260875_262954_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	40.3	4.9e-116
WP_012605424.1|262957_263212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158020051.1|263205_264834_+|portal	phage portal protein	portal	Q75QM9	Wolbachia_phage	44.4	3.2e-107
WP_012605426.1|264830_265730_+	S49 family peptidase	NA	A0A219YB02	Aeromonas_phage	39.5	5.5e-40
WP_012605427.1|265809_266394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012605428.1|266396_266777_+|head	head decoration protein	head	NA	NA	NA	NA
WP_012605429.1|266780_267836_+|capsid	major capsid protein	capsid	Q9JMM2	Wolbachia_phage	45.1	6.6e-77
267243:267258	attR	GTGAACTACTTCACCG	NA	NA	NA	NA
>prophage 3
NC_011757	Methylorubrum extorquens CM4, complete sequence	5777908	1069324	1127204	5777908	transposase	Leptospira_phage(25.0%)	51	NA	NA
WP_003596034.1|1069324_1070974_-|transposase	ISL3-like element ISMex10 family transposase	transposase	NA	NA	NA	NA
WP_085985480.1|1071108_1072291_+|transposase	IS3-like element ISMex5 family transposase	transposase	S5WIU1	Leptospira_phage	32.4	7.3e-32
WP_012605994.1|1072448_1073129_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0F6TH34	Sinorhizobium_phage	38.7	1.9e-13
WP_012605995.1|1073609_1075199_-	Fic family protein	NA	NA	NA	NA	NA
WP_012753600.1|1075643_1076126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012605996.1|1076427_1076736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012753603.1|1078293_1079529_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_012605998.1|1080385_1080964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012753604.1|1080936_1081335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606000.1|1082244_1082979_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.8	2.5e-27
WP_012606001.1|1082975_1084310_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	33.7	4.5e-06
WP_003596692.1|1084406_1084661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606002.1|1085223_1085415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131473048.1|1085443_1085740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003596689.1|1085759_1086131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606003.1|1086255_1087620_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012606004.1|1087631_1090880_+	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
WP_003596683.1|1090885_1091440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606005.1|1091485_1092403_+	cation transporter	NA	A0A1V0SED0	Indivirus	39.3	6.7e-09
WP_012606006.1|1092415_1092586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003596676.1|1092908_1093163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003596674.1|1093401_1093542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003596672.1|1093538_1095083_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_012606007.1|1095285_1096026_-	Abi family protein	NA	NA	NA	NA	NA
WP_085985476.1|1097274_1098458_-|transposase	IS3-like element ISMex5 family transposase	transposase	S5WIU1	Leptospira_phage	32.4	7.3e-32
WP_003598644.1|1099220_1099511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003598646.1|1099507_1100062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131473059.1|1100541_1100967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003598647.1|1100963_1101317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049832675.1|1101431_1102355_-|transposase	IS110-like element ISMex31 family transposase	transposase	NA	NA	NA	NA
WP_085985055.1|1103496_1104457_+|transposase	IS630-like element ISMex30 family transposase	transposase	A0A1V0SCG6	Indivirus	25.5	7.5e-11
WP_003598652.1|1104625_1104793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041357443.1|1104867_1105080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080515519.1|1105388_1105616_-	cytochrome C biogenesis protein	NA	NA	NA	NA	NA
WP_003598654.1|1105717_1106791_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_012753610.1|1106879_1107401_-	signal peptidase II	NA	NA	NA	NA	NA
WP_003598656.1|1107397_1109593_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	38.7	3.2e-118
WP_003598658.1|1109693_1110095_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003598660.1|1110771_1113192_-	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	33.1	2.9e-67
WP_003598662.1|1113259_1113742_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	44.0	3.9e-08
WP_003598663.1|1113796_1114129_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_003598665.1|1114308_1114707_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	50.7	6.9e-11
WP_003598666.1|1114733_1115099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003598668.1|1115118_1118268_-	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
WP_003598670.1|1118281_1120021_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012606013.1|1120106_1120577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003598673.1|1120668_1120881_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_003598674.1|1121261_1122002_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_003598675.1|1122015_1122492_-	metal-binding protein	NA	NA	NA	NA	NA
WP_003598676.1|1122511_1125685_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_085985478.1|1126105_1127204_+|transposase	IS3-like element ISMex11 family transposase	transposase	S5WIU1	Leptospira_phage	43.2	4.1e-53
>prophage 4
NC_011757	Methylorubrum extorquens CM4, complete sequence	5777908	1603190	1670447	5777908	head,tail,portal,protease,capsid,terminase	Burkholderia_virus(30.0%)	53	NA	NA
WP_015950238.1|1603190_1605308_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_085985904.1|1605849_1606110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015950239.1|1606329_1606728_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_015950240.1|1606761_1607508_-	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.4	4.9e-18
WP_012252984.1|1607627_1608542_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015950241.1|1608714_1609551_-	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_015950242.1|1609719_1610532_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	27.8	5.5e-07
WP_015950243.1|1610531_1610858_+	cytochrome c	NA	NA	NA	NA	NA
WP_015950244.1|1610933_1611686_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041928958.1|1612080_1613709_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_015950246.1|1613705_1615349_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_015950247.1|1615448_1617038_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_015950248.1|1617099_1618254_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_003606082.1|1618323_1618455_+	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_003606080.1|1618491_1619244_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	32.3	6.0e-24
WP_015950249.1|1619394_1620978_-	amidase	NA	NA	NA	NA	NA
WP_015950250.1|1621496_1623923_+	response regulator	NA	NA	NA	NA	NA
WP_003606498.1|1624055_1624868_+	cellulose biosynthesis protein BcsS	NA	NA	NA	NA	NA
WP_015950251.1|1625196_1627701_+	UDP-forming cellulose synthase catalytic subunit	NA	NA	NA	NA	NA
WP_015950252.1|1627697_1630340_+	cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB	NA	NA	NA	NA	NA
WP_015950253.1|1630339_1631629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041928959.1|1631613_1633677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015950255.1|1633673_1634687_+	cellulose biosynthesis protein BcsN	NA	NA	NA	NA	NA
WP_015950256.1|1642057_1642321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015950257.1|1642413_1642650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015950258.1|1642728_1643310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015950259.1|1643306_1643606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015950260.1|1643620_1644049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015950261.1|1644063_1644627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015950262.1|1644815_1645514_-	TIGR02594 family protein	NA	H6WBN0	Rhodobacter_phage	44.2	5.4e-43
WP_015950263.1|1645998_1649217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015950264.1|1649332_1649605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015950265.1|1649601_1649913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015950266.1|1649924_1653914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015950267.1|1654532_1654931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015950268.1|1654927_1655476_-	DUF1833 family protein	NA	NA	NA	NA	NA
WP_015950269.1|1655480_1655858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015950270.1|1655861_1659719_-|tail	phage tail length tape measure family protein	tail	A5H1M1	Xanthomonas_virus	30.8	3.8e-13
WP_015950271.1|1659725_1659986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015950272.1|1660060_1660486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015950273.1|1660482_1660677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015950274.1|1660673_1661606_-	hypothetical protein	NA	A0A0S0N8B7	Pseudomonas_phage	35.1	1.3e-36
WP_015950275.1|1661644_1662055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015950276.1|1662056_1662740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015950277.1|1662739_1663066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015950278.1|1663062_1663743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080515597.1|1663739_1664495_-	collagen-like protein	NA	NA	NA	NA	NA
WP_015950281.1|1664575_1665082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015950282.1|1665087_1665348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_193373772.1|1665411_1666707_-|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	63.9	5.9e-136
WP_041929213.1|1666724_1667420_-|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	65.4	6.5e-65
WP_015950285.1|1667449_1668754_-|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	46.6	1.7e-95
WP_015950286.1|1668773_1670447_-|terminase	terminase large subunit	terminase	S4TSQ6	Salmonella_phage	46.2	3.8e-135
>prophage 5
NC_011757	Methylorubrum extorquens CM4, complete sequence	5777908	1692506	1753139	5777908	protease,head,tail,integrase	Paracoccus_phage(27.27%)	58	1687908:1687923	1706349:1706364
1687908:1687923	attL	CGGCTCAGCGACGCCG	NA	NA	NA	NA
WP_041928965.1|1692506_1693679_+|integrase	site-specific integrase	integrase	A0A076G7B8	Sinorhizobium_phage	38.9	3.4e-66
WP_041928966.1|1694403_1694778_+	toprim domain-containing protein	NA	A0A060BKV1	Podovirus	42.3	3.8e-19
WP_158020072.1|1694811_1695207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015822017.1|1695538_1696309_-	anti-sigma factor	NA	NA	NA	NA	NA
WP_015950331.1|1696394_1696958_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_012253006.1|1697195_1698500_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_015950332.1|1698784_1699198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015950333.1|1699247_1700321_+	DUF1775 domain-containing protein	NA	NA	NA	NA	NA
WP_015950334.1|1700436_1700961_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_015950335.1|1700950_1701598_+	SCO family protein	NA	NA	NA	NA	NA
WP_015950336.1|1701740_1702097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015950337.1|1702139_1704287_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_015950338.1|1704531_1706379_+	caspase family protein	NA	NA	NA	NA	NA
1706349:1706364	attR	CGGCTCAGCGACGCCG	NA	NA	NA	NA
WP_015950339.1|1706529_1708002_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_012752438.1|1708106_1708766_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015950340.1|1708941_1709964_+	TRAP transporter substrate-binding protein DctP	NA	NA	NA	NA	NA
WP_015950341.1|1709960_1710686_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_012253016.1|1710682_1712035_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_015950342.1|1712202_1712400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015950343.1|1713192_1713426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015950344.1|1713493_1714540_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	36.4	2.8e-43
WP_003603329.1|1714652_1714808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041929221.1|1714823_1716314_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_041928968.1|1716493_1716940_+	DMT family transporter	NA	NA	NA	NA	NA
WP_015950347.1|1717052_1722371_+	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_015950348.1|1722375_1724577_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_003607143.1|1724714_1725035_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_015950349.1|1725039_1725840_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015950350.1|1725891_1726515_-	class GN sortase	NA	NA	NA	NA	NA
WP_015950351.1|1726511_1728728_-	marine proteobacterial sortase target protein	NA	A0A2K9L1L0	Tupanvirus	21.1	4.1e-12
WP_015950352.1|1728972_1729584_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_041929222.1|1729671_1730412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015950354.1|1730522_1731536_-	nickel transporter	NA	NA	NA	NA	NA
WP_015950355.1|1731526_1732204_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_015950356.1|1732318_1732780_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_015950357.1|1732776_1734777_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_015950358.1|1734823_1735345_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_015950359.1|1735507_1737079_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_003606556.1|1737225_1738641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003606557.1|1739027_1739705_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_015950360.1|1739743_1740283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015950361.1|1740296_1740545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012253038.1|1740567_1740921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015950362.1|1740970_1741573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015950363.1|1741606_1742170_-	lysozyme	NA	W6E9Q2	Rhizobium_phage	38.7	6.3e-26
WP_015950364.1|1742288_1743371_-	DUF2793 domain-containing protein	NA	A0A0K1LM04	Rhodobacter_phage	40.2	2.4e-37
WP_015950365.1|1743395_1747304_-	glycoside hydrolase TIM-barrel-like domain-containing protein	NA	A0A0B5A7K5	Paracoccus_phage	35.7	1.3e-191
WP_015950366.1|1747343_1747808_-	C40 family peptidase	NA	A0A1V0DYB6	Dinoroseobacter_phage	46.8	2.9e-29
WP_015950367.1|1747815_1748709_-	DUF2163 domain-containing protein	NA	A0A0B5A5B8	Paracoccus_phage	42.7	5.1e-62
WP_015950368.1|1748719_1749361_-	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	49.5	1.4e-45
WP_015950369.1|1749372_1749999_-|tail	phage tail tape measure protein	tail	G9JXH3	Shigella_phage	69.0	2.5e-07
WP_015950370.1|1749998_1750229_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_041929223.1|1750225_1750552_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_015950372.1|1750554_1750965_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_041928971.1|1750994_1751414_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_015950374.1|1751410_1751752_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_015950375.1|1751774_1752350_-	phiE125 gp8 family protein	NA	NA	NA	NA	NA
WP_015950376.1|1752383_1753139_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
>prophage 6
NC_011757	Methylorubrum extorquens CM4, complete sequence	5777908	4459710	4486431	5777908	integrase,tRNA,protease,transposase	Bodo_saltans_virus(100.0%)	18	4477779:4477796	4501489:4501506
WP_193373782.1|4459710_4460660_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	25.4	6.9e-09
WP_015952150.1|4461543_4462032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041929084.1|4462190_4463993_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_015952152.1|4464709_4465372_-	sugar transferase	NA	NA	NA	NA	NA
WP_158020129.1|4465972_4466518_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162091623.1|4468063_4469305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158020130.1|4470560_4470881_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015952154.1|4472137_4473457_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_162091624.1|4473482_4474679_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_015952156.1|4474724_4475846_-	DUF1972 domain-containing protein	NA	NA	NA	NA	NA
WP_158020131.1|4475915_4477148_-	glycosyltransferase	NA	NA	NA	NA	NA
4477779:4477796	attL	ACGAGGCGCAGCCCGGCA	NA	NA	NA	NA
WP_080515576.1|4477935_4478457_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_158020132.1|4479315_4479483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080515577.1|4479508_4480132_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_041929319.1|4481037_4481259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015952160.1|4482077_4483502_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_015952161.1|4483795_4485418_+	calcium-binding protein	NA	NA	NA	NA	NA
WP_003599551.1|4485456_4486431_-|protease	serine protease	protease	NA	NA	NA	NA
4501489:4501506	attR	ACGAGGCGCAGCCCGGCA	NA	NA	NA	NA
>prophage 1
NC_011758	Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence	380207	62545	79760	380207	transposase,integrase	uncultured_virus(25.0%)	10	50471:50488	78196:78213
50471:50488	attL	CTGGAGGGCCTGCGCGGC	NA	NA	NA	NA
WP_012606094.1|62545_63961_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012606095.1|64859_66080_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	40.9	5.9e-37
WP_012606097.1|67085_68285_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	47.5	1.8e-94
WP_012606098.1|69468_71268_-	methanol/ethanol family PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_012606099.1|71458_72895_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_012606100.1|72891_73548_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012606101.1|73837_74671_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_085985917.1|74748_75920_-|transposase	IS3-like element ISMch1 family transposase	transposase	S5WIU1	Leptospira_phage	27.5	1.2e-13
WP_076611538.1|76969_78321_-|transposase	IS3-like element ISMch3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	27.5	2.8e-11
78196:78213	attR	GCCGCGCAGGCCCTCCAG	NA	NA	NA	NA
WP_012606106.1|78680_79760_+|transposase	IS110-like element ISMch6 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_011758	Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence	380207	100232	166494	380207	transposase	Leptospira_phage(18.18%)	49	NA	NA
WP_012606126.1|100232_101292_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012606127.1|101485_105400_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_085985918.1|106970_108141_+|transposase	IS3-like element ISMch1 family transposase	transposase	S5WIU1	Leptospira_phage	28.4	5.7e-13
WP_012606131.1|108476_109943_-	DUF4263 domain-containing protein	NA	NA	NA	NA	NA
WP_012606132.1|110277_112821_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_012606133.1|112873_113884_-	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	30.0	1.1e-15
WP_158020185.1|115158_115701_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012606134.1|116384_118322_-	squalene--hopene cyclase	NA	NA	NA	NA	NA
WP_012606135.1|118427_118961_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012606136.1|119116_119461_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_012606138.1|120080_121235_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012606139.1|121254_124416_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_012606140.1|125325_127356_-	cache domain-containing protein	NA	A0A1B0VMK3	Pseudomonas_phage	29.2	9.6e-08
WP_012606141.1|127343_128714_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_193373788.1|128843_130499_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_012606143.1|130966_133162_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_085985919.1|133326_134092_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_017487497.1|134105_134600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611538.1|135542_136894_-|transposase	IS3-like element ISMch3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	27.5	2.8e-11
WP_158020186.1|137285_137627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606148.1|137679_138192_-	DUF2478 domain-containing protein	NA	NA	NA	NA	NA
WP_012606149.1|138596_139586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012455564.1|139687_140941_-	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_012455565.1|141033_141378_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049832754.1|141473_142724_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_012606151.1|142861_143917_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.2	1.7e-80
WP_012606152.1|143953_144751_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012606153.1|144747_145440_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_012606154.1|145467_146544_+	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.8	3.9e-16
WP_012606155.1|146703_146913_+	TOBE domain-containing protein	NA	NA	NA	NA	NA
WP_012606156.1|147417_148011_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	42.3	4.1e-28
WP_158020187.1|148124_148997_-	transporter	NA	NA	NA	NA	NA
WP_012606158.1|149202_149712_-	acetone carboxylase subunit gamma	NA	NA	NA	NA	NA
WP_012606159.1|149800_152131_-	hydantoinase B/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_012606160.1|152168_154322_-	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_012606161.1|154557_156480_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_080515619.1|156830_157451_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_085985478.1|157558_158658_-|transposase	IS3-like element ISMex11 family transposase	transposase	S5WIU1	Leptospira_phage	43.2	4.1e-53
WP_012606162.1|158723_159278_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.8	1.4e-14
WP_012606163.1|159274_159697_-	hypothetical protein	NA	G1DAN9	Mycobacterium_virus	36.9	1.6e-10
WP_012606164.1|159974_160145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041929427.1|160368_160872_+	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	38.2	3.1e-16
WP_012606166.1|161422_161740_+	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_012606167.1|161809_162067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606168.1|162216_162936_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_012606169.1|163022_163418_+	RidA family protein	NA	NA	NA	NA	NA
WP_080515626.1|163530_163923_-	DUF3291 domain-containing protein	NA	NA	NA	NA	NA
WP_158020188.1|164033_164183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012606173.1|165414_166494_+|transposase	IS110-like element ISMch6 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_011758	Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence	380207	206018	290303	380207	transposase,integrase	Mycobacterium_phage(15.0%)	73	244369:244386	278293:278310
WP_012606213.1|206018_206824_-|transposase	IS5-like element ISMch2 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	33.7	1.6e-22
WP_012606214.1|207107_208283_-	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	25.7	7.2e-08
WP_080515621.1|210404_210803_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	52.3	1.3e-30
WP_012606215.1|210799_211429_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_012606216.1|213467_214121_+	ParA family protein	NA	A0A0M3ULE3	Mycobacterium_phage	32.4	3.9e-11
WP_012606217.1|214120_214453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606213.1|214585_215391_-|transposase	IS5-like element ISMch2 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	33.7	1.6e-22
WP_158020209.1|215440_215851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012606219.1|215853_218841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012606220.1|218837_219308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012606221.1|219319_219574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012606222.1|219570_220854_-	DotG/IcmE/VirB10 family protein	NA	NA	NA	NA	NA
WP_012606223.1|220865_222053_-	type IV secretion system protein IcmK	NA	NA	NA	NA	NA
WP_012606224.1|222049_222706_-	DotI/IcmL/TraM family protein	NA	NA	NA	NA	NA
WP_012606225.1|222702_222978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_193373785.1|222979_223489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158020191.1|224032_224329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158020210.1|224412_224904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158020192.1|224920_225451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012606229.1|225685_226840_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_012606230.1|226843_228025_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_041929436.1|227993_228644_+	DUF882 domain-containing protein	NA	A0A1X9Q111	Human_gut_gokushovirus	34.3	8.3e-06
WP_012606232.1|228640_228886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606233.1|228870_229548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606234.1|229544_229943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606235.1|229939_230890_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_012606236.1|230886_231651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606237.1|231647_232670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606238.1|232666_233653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606239.1|233661_235920_+	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_012606240.1|235923_237246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158020193.1|237959_239216_+	plasmid partitioning protein RepA	NA	A0A240F4U1	Ochrobactrum_phage	49.7	1.2e-96
WP_158020194.1|239368_240217_+	plasmid partitioning protein RepB	NA	A0A240F4U0	Ochrobactrum_phage	35.7	6.3e-38
WP_012606244.1|240421_241633_+	replication initiation protein RepC	NA	L7TKN6	Rhizobium_phage	30.3	6.7e-25
WP_012778769.1|242519_242882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606126.1|243535_244595_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
244369:244386	attL	CTCGTCGTGCCCGACAAC	NA	NA	NA	NA
WP_080515622.1|244702_244954_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	47.3	2.5e-06
WP_193373789.1|245164_246649_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_012606246.1|246645_247470_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	33.9	1.8e-29
WP_012606247.1|247665_248919_+|transposase	IS701-like element ISMch7 family transposase	transposase	NA	NA	NA	NA
WP_085985920.1|249081_249847_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012606249.1|249896_250493_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	40.3	6.7e-26
WP_012606250.1|250576_250867_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_012606251.1|250850_251105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606252.1|252844_253649_+|transposase	IS5-like element ISMch9 family transposase	transposase	NA	NA	NA	NA
WP_012606253.1|253764_254808_-	phospholipase D family protein	NA	NA	NA	NA	NA
WP_012606254.1|254816_257630_-	class I SAM-dependent DNA methyltransferase	NA	Q6NE04	Leptospira_phage	43.2	4.0e-222
WP_012606255.1|257809_258550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085985411.1|258608_259366_-|transposase	IS5-like element ISMpo7 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	35.0	1.2e-08
WP_158020211.1|259398_259638_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041929389.1|259641_259833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003607500.1|259869_261075_+	PD40 domain-containing protein	NA	NA	NA	NA	NA
WP_012606256.1|261915_263193_+|transposase	IS110-like element ISMex12 family transposase	transposase	A0A1S7J231	Thermus_phage	35.4	2.6e-11
WP_085985917.1|263325_264496_+|transposase	IS3-like element ISMch1 family transposase	transposase	S5WIU1	Leptospira_phage	27.5	1.2e-13
WP_111772158.1|264706_265099_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_158020196.1|265088_265328_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012606259.1|265576_266638_+|integrase	tyrosine-type recombinase/integrase	integrase	Q5QBN6	Enterobacteria_phage	28.6	1.7e-19
WP_049832756.1|267082_268051_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_012606261.1|268466_270011_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_012606262.1|270014_270800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606263.1|270810_271713_+	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_012606264.1|272001_273888_+	S8 family peptidase	NA	A0A217EQY2	Bacillus_phage	29.2	1.2e-12
WP_012606265.1|273900_275142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041929391.1|275554_275764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012606266.1|276004_277591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142582431.1|277689_279204_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.2	7.9e-124
278293:278310	attR	CTCGTCGTGCCCGACAAC	NA	NA	NA	NA
WP_012606268.1|279215_279959_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	47.5	3.7e-58
WP_041929392.1|280024_280222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012606269.1|280708_282358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606270.1|282360_284340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158020197.1|284336_285119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606272.1|285216_289176_-	SIR2 family protein	NA	NA	NA	NA	NA
WP_012606273.1|289205_290303_+|transposase	IS5-like element ISMch8 family transposase	transposase	NA	NA	NA	NA
