The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_011662	Thauera sp. MZ1T, complete sequence	4496212	239372	298210	4496212	transposase,integrase,tRNA	Bacillus_phage(25.0%)	57	236839:236855	300234:300250
236839:236855	attL	GCTTGCCGCCGCCGAAG	NA	NA	NA	NA
WP_004301618.1|239372_241331_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_004301620.1|241410_242064_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_004301621.1|242171_242942_+	ParA family protein	NA	Q8JL10	Natrialba_phage	37.6	1.3e-21
WP_004301623.1|242956_243808_+	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	40.0	1.2e-15
WP_004301624.1|244089_244431_+	ATP synthase subunit I	NA	NA	NA	NA	NA
WP_004301627.1|244433_245285_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_002925444.1|245351_245597_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_012584301.1|245644_246118_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_004301629.1|246121_246655_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_004301630.1|246669_248208_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_004301632.1|248229_249099_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_004301634.1|249125_250526_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_004301635.1|250580_251006_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_004301636.1|251138_251720_-	SCP2 sterol-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004301637.1|251889_252774_-	Tim44 domain-containing protein	NA	NA	NA	NA	NA
WP_004301638.1|252792_253530_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_004301640.1|253537_253960_-	DUF971 domain-containing protein	NA	NA	NA	NA	NA
WP_012584303.1|253999_255868_-	cobalt chelatase	NA	J9Q7G6	Salmonella_phage	27.8	3.1e-13
WP_012584304.1|255878_256871_-	cobaltochelatase subunit CobS	NA	L7TKP0	Rhizobium_phage	31.1	9.7e-38
WP_012584305.1|256991_257501_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004301648.1|257497_257983_+	4-hydroxybenzoyl-CoA reductase subunit gamma	NA	NA	NA	NA	NA
WP_012584306.1|257979_260289_+	4-hydroxybenzoyl-CoA reductase subunit alpha	NA	NA	NA	NA	NA
WP_004301651.1|260285_261260_+	4-hydroxybenzoyl-CoA reductase subunit beta	NA	NA	NA	NA	NA
WP_004301653.1|261492_262203_+	phosphate regulon transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	39.9	7.6e-37
WP_004301655.1|262237_263554_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	36.0	1.4e-31
WP_004301661.1|263540_265160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004301666.1|265174_265594_-	HIT family protein	NA	NA	NA	NA	NA
WP_004301668.1|265671_266505_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_004301670.1|266538_267999_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_004301672.1|268036_268552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004301674.1|268562_270035_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_012584307.1|270120_270408_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_004301678.1|270577_271621_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_012584308.1|271692_272571_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_004301680.1|272574_273096_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_012584309.1|273108_275154_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_004328740.1|275150_276293_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_012584310.1|276310_277456_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	50.6	8.3e-17
WP_004322953.1|277564_278692_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.2	1.1e-64
WP_004322951.1|278734_279019_+	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_012584311.1|279015_279684_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_012584312.1|279806_280754_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_012584313.1|281306_281954_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004322943.1|281974_282472_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_012584314.1|282686_283127_+	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_012584315.1|283267_285259_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	37.8	5.9e-111
WP_012584316.1|285397_285844_-	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_004357365.1|286221_286440_-	helix-turn-helix transcriptional regulator	NA	A0A0E3U244	Fusobacterium_phage	49.3	8.1e-14
WP_012584317.1|286588_286822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012584318.1|286814_288122_+|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	29.4	2.9e-34
WP_004303625.1|288114_289077_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004357889.1|290990_292352_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_012584320.1|292437_293661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012584321.1|294214_295252_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012584322.1|295365_295893_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004265662.1|296121_296997_+|integrase	site-specific integrase	integrase	S5W9T9	Leptospira_phage	31.9	1.3e-30
WP_012584323.1|297004_298210_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
300234:300250	attR	GCTTGCCGCCGCCGAAG	NA	NA	NA	NA
>prophage 2
NC_011662	Thauera sp. MZ1T, complete sequence	4496212	302330	359752	4496212	protease,transposase	Leptospira_phage(18.18%)	47	NA	NA
WP_012584327.1|302330_303206_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_012584328.1|303231_304323_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_012584329.1|304353_304653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144312132.1|304920_307653_+	HAD-IC family P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	28.8	1.7e-79
WP_012584331.1|307975_308389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012584332.1|308517_309594_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_012584333.1|310120_311716_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_012584334.1|311745_312105_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	33.7	1.6e-11
WP_012584335.1|312104_312413_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_187283016.1|312553_312922_+|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	37.0	3.0e-08
WP_012584337.1|313321_314848_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	58.0	8.5e-150
WP_144312133.1|315426_316026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012584333.1|316203_317799_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_012584334.1|317828_318188_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	33.7	1.6e-11
WP_012584335.1|318187_318496_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012584340.1|319156_319888_+	SOS response-associated peptidase	NA	V9IQW7	Stenotrophomonas_phage	38.9	1.1e-35
WP_012584341.1|319984_321607_+	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_041589740.1|321719_323042_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	42.8	1.8e-95
WP_012584343.1|323361_325185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012584344.1|325209_328323_-	DEAD/DEAH box helicase family protein	NA	A0A2H4J643	uncultured_Caudovirales_phage	24.9	1.2e-36
WP_012584345.1|328448_329336_+	WYL domain-containing transcriptional regulator	NA	NA	NA	NA	NA
WP_012584346.1|329332_329932_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_012584347.1|329934_330519_+	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_012584348.1|330562_334174_+	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_012584349.1|334227_334845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012584350.1|334831_335821_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_012584351.1|335824_339328_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_012584352.1|339388_339559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012584353.1|339572_340439_+	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
WP_012584354.1|340482_341310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012584355.1|341306_342701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012584356.1|342895_345514_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_012584357.1|345521_347552_+|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_144312134.1|347689_348223_+	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_012584359.1|348379_348577_-	DUF4926 domain-containing protein	NA	NA	NA	NA	NA
WP_012584360.1|349287_350010_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_012584361.1|350019_350298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187283017.1|350272_352636_+	DEAD/DEAH box helicase family protein	NA	A0A0P0YML3	Yellowstone_lake_phycodnavirus	28.4	8.5e-32
WP_012584363.1|352778_353480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012584364.1|353613_354018_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_012584365.1|354032_354326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012584366.1|354386_355298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012584367.1|355422_356427_+	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	27.5	9.5e-17
WP_012584368.1|356438_356717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004359146.1|357307_357520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012584369.1|357516_358275_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	32.1	8.2e-29
WP_012584370.1|358261_359752_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_011662	Thauera sp. MZ1T, complete sequence	4496212	378643	431291	4496212	transposase,integrase	Burkholderia_virus(16.67%)	38	383935:383949	431054:431068
WP_004265459.1|378643_379969_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.7	5.0e-05
WP_012584386.1|381854_382892_-|transposase	IS5-like element ISAzo41 family transposase	transposase	NA	NA	NA	NA
WP_187283018.1|382910_384650_-	sigma-70 family RNA polymerase sigma factor	NA	F4YCU2	Synechococcus_phage	45.6	6.5e-21
383935:383949	attL	TCGCCAATCAGCCGC	NA	NA	NA	NA
WP_144312137.1|384729_385056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049766889.1|385285_385558_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041589595.1|385556_386144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012584390.1|386159_388505_+	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	37.1	1.6e-30
WP_012584391.1|388501_388657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012584392.1|388732_390247_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_012584393.1|390430_391189_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_012584394.1|391304_392330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187283019.1|392346_392829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012584395.1|392859_394560_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_049766891.1|394676_395216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012584396.1|395598_396225_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_012584397.1|396604_398062_+	protein kinase	NA	A0A1V0SH95	Hokovirus	26.9	2.1e-09
WP_041589754.1|398061_399225_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012584399.1|399221_400667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012584400.1|400990_402478_-	Fic family protein	NA	NA	NA	NA	NA
WP_012584401.1|402829_403825_-	TerB family tellurite resistance protein	NA	NA	NA	NA	NA
WP_144312138.1|403830_404316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012584403.1|404499_405120_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	31.2	3.6e-06
WP_012584404.1|405700_407041_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_012584405.1|407037_408897_-	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	26.1	3.2e-10
WP_012584406.1|408917_409619_-	molecular chaperone TorD family protein	NA	NA	NA	NA	NA
WP_012584407.1|409611_410280_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	38.9	2.0e-42
WP_041589598.1|410290_412885_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	33.3	2.0e-103
WP_012584409.1|412881_413964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144312140.1|414037_414760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004355067.1|414889_415198_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012584411.1|415197_415557_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	37.0	7.3e-12
WP_012584412.1|416873_418199_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.3	2.4e-07
WP_012584413.1|419037_420036_-|integrase	site-specific integrase	integrase	A0A142F1N9	Bacillus_phage	26.8	3.5e-19
WP_012584414.1|420032_420965_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012584415.1|420961_422197_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012584417.1|423322_424279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012584418.1|424275_429099_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_004299421.1|430070_431291_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	32.7	1.8e-38
431054:431068	attR	GCGGCTGATTGGCGA	NA	NA	NA	NA
>prophage 4
NC_011662	Thauera sp. MZ1T, complete sequence	4496212	1383020	1389815	4496212	protease	Agrobacterium_phage(16.67%)	9	NA	NA
WP_004321251.1|1383020_1385294_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.4	1.4e-169
WP_004321249.1|1385294_1385603_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	46.1	3.3e-13
WP_004321247.1|1385991_1386195_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.8	4.9e-21
WP_004321245.1|1386336_1386504_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002924478.1|1386529_1386766_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_004321243.1|1386913_1387591_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_012584936.1|1387669_1388866_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.3	4.1e-43
WP_004310222.1|1388925_1389375_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	62.3	1.5e-46
WP_012584937.1|1389374_1389815_+	NUDIX domain-containing protein	NA	A0A1L2CUR5	Pectobacterium_phage	35.4	8.1e-05
>prophage 5
NC_011662	Thauera sp. MZ1T, complete sequence	4496212	1521940	1531582	4496212		Ectocarpus_siliculosus_virus(16.67%)	8	NA	NA
WP_049766900.1|1521940_1524160_-	transporter substrate-binding domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	36.7	1.5e-30
WP_012584995.1|1524531_1525086_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_012584996.1|1525216_1526851_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.5	3.9e-20
WP_004321400.1|1526940_1528884_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	39.7	1.6e-121
WP_004321398.1|1529039_1529402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004321396.1|1529533_1529737_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	71.2	4.1e-20
WP_004321394.1|1530072_1530840_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.3	4.9e-13
WP_004321392.1|1530859_1531582_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.0	6.4e-07
>prophage 6
NC_011662	Thauera sp. MZ1T, complete sequence	4496212	2325294	2389897	4496212	transposase,integrase	Enterobacteria_phage(27.27%)	53	2323955:2323974	2386398:2386417
2323955:2323974	attL	CGACGCGCTGCTCGCCGCCG	NA	NA	NA	NA
WP_020691084.1|2325294_2325612_+|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	34.5	1.0e-04
WP_144312155.1|2325726_2325909_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012585330.1|2327560_2329588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012585331.1|2330363_2331353_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_012585332.1|2331358_2332801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012585333.1|2333315_2333591_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_012585334.1|2333663_2334119_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	42.9	7.8e-19
WP_012585335.1|2335401_2335665_-	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_012584383.1|2335686_2336607_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012585336.1|2336743_2337193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012584381.1|2337223_2337505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012584380.1|2337614_2338322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012584379.1|2338370_2338979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144312193.1|2339015_2339654_-	CerR family C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012585337.1|2339766_2342502_-	UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase	NA	NA	NA	NA	NA
WP_012585338.1|2342498_2344244_-	ubiquinone biosynthesis protein UbiB	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.1	2.1e-40
WP_012585339.1|2344253_2345741_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_012585340.1|2345733_2349042_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.3	8.5e-46
WP_049766937.1|2349038_2350199_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_041589648.1|2351377_2352160_+	2-oxopent-4-enoate hydratase	NA	NA	NA	NA	NA
WP_012585343.1|2352284_2353208_+	acetaldehyde dehydrogenase (acetylating)	NA	G8DDL4	Micromonas_pusilla_virus	35.2	1.7e-36
WP_012585344.1|2353234_2354272_+	4-hydroxy-2-oxovalerate aldolase	NA	NA	NA	NA	NA
WP_004254645.1|2354529_2354973_+	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_187283047.1|2355183_2356329_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012585346.1|2356331_2357000_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_012585347.1|2357812_2359117_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_041589842.1|2359138_2359747_-	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_012585350.1|2360271_2361873_-	RNA-directed DNA polymerase	NA	Q2P9X6	Enterobacteria_phage	31.1	2.4e-14
WP_004359146.1|2361979_2362192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011254920.1|2362188_2362947_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	36.3	5.5e-33
WP_012585351.1|2362933_2364424_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_012585352.1|2365383_2366472_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004355824.1|2366739_2367297_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_012585353.1|2367381_2367759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004355830.1|2367824_2368211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012585354.1|2368252_2371372_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	24.6	9.1e-74
WP_012585355.1|2371387_2372500_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012585356.1|2372496_2373060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012585357.1|2373077_2374343_-	TolC family protein	NA	NA	NA	NA	NA
WP_012585358.1|2374476_2374824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012585359.1|2374952_2375291_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_012585360.1|2375459_2376146_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.3	3.2e-32
WP_012585361.1|2376148_2377486_+	heavy metal sensor histidine kinase	NA	NA	NA	NA	NA
WP_012585362.1|2377504_2379907_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	47.1	2.1e-147
WP_004355852.1|2380017_2380473_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_012585363.1|2380527_2381469_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_012585364.1|2381456_2381813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012585365.1|2381815_2384839_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_083768697.1|2384981_2385113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012585366.1|2385537_2385822_-	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_012585367.1|2385818_2386097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020651377.1|2386335_2386926_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	49.2	2.8e-40
2386398:2386417	attR	CGACGCGCTGCTCGCCGCCG	NA	NA	NA	NA
WP_012585369.1|2386930_2389897_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NC_011662	Thauera sp. MZ1T, complete sequence	4496212	3410788	3453744	4496212	transposase	Liberibacter_phage(22.22%)	25	NA	NA
WP_004265615.1|3410788_3411907_-|transposase	ISAs1-like element ISTha1 family transposase	transposase	NA	NA	NA	NA
WP_012585830.1|3412439_3414275_-	putative DNA binding domain-containing protein	NA	NA	NA	NA	NA
WP_012585831.1|3414267_3415794_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	57.2	3.0e-139
WP_012585832.1|3415790_3417287_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	56.0	3.6e-145
WP_144312228.1|3417351_3419157_-	UvrD-helicase domain-containing protein	NA	A0A1V0SAC2	Catovirus	32.3	2.7e-09
WP_004359146.1|3419066_3419279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011254920.1|3419275_3420034_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	36.3	5.5e-33
WP_012585351.1|3420020_3421511_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_041589887.1|3426347_3427100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144312229.1|3427582_3428767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012585835.1|3428753_3432128_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012585836.1|3432120_3432831_-	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_012585837.1|3432856_3434320_-	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
WP_012585838.1|3434555_3435437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012585839.1|3435768_3440727_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_012585840.1|3440732_3442841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012585841.1|3442837_3443890_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	28.0	1.4e-10
WP_144312230.1|3443886_3444201_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012585843.1|3444421_3444997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012585844.1|3445156_3445579_+	MBL fold metallo-hydrolase	NA	Q331V3	Clostridium_botulinum_C_phage	35.9	2.0e-08
WP_004265643.1|3445738_3446536_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	36.5	8.3e-32
WP_012585845.1|3446528_3448019_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_083768705.1|3448085_3448679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012585846.1|3448900_3452248_-	DEAD/DEAH box helicase family protein	NA	Q6NDX2	Leptospira_phage	26.1	2.8e-12
WP_004265459.1|3452418_3453744_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.7	5.0e-05
