The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_011663	Shewanella baltica OS223, complete sequence	5145902	676431	751741	5145902	integrase,transposase	Cedratvirus(33.33%)	34	675780:675793	682338:682351
675780:675793	attL	CTTGAAGGTAAACT	NA	NA	NA	NA
WP_006083191.1|676431_677754_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_006083190.1|677737_679291_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_006083189.1|679283_681365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006083188.1|681364_681892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006083187.1|681971_682409_+	hypothetical protein	NA	NA	NA	NA	NA
682338:682351	attR	CTTGAAGGTAAACT	NA	NA	NA	NA
WP_006083186.1|682405_684559_+	AAA family ATPase	NA	A0A285PXL3	Cedratvirus	27.7	1.3e-26
WP_006083185.1|685323_685602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006079577.1|685598_686708_-|transposase	ISAs1-like element ISSba2 family transposase	transposase	NA	NA	NA	NA
WP_006083183.1|692590_693760_+	nucleotide sugar dehydrogenase	NA	O41091	Paramecium_bursaria_Chlorella_virus	41.6	1.6e-79
WP_006083180.1|695777_696455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006083179.1|696574_697432_+	DUF1835 domain-containing protein	NA	NA	NA	NA	NA
WP_006083178.1|697539_698649_+|transposase	ISAs1-like element ISSba2 family transposase	transposase	NA	NA	NA	NA
WP_006083177.1|699106_699361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006083176.1|699702_700104_+	DUF4354 family protein	NA	NA	NA	NA	NA
WP_006083175.1|700476_702765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012586714.1|703818_710409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006083173.1|710501_715124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006083172.1|715428_718305_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_006083171.1|719122_721987_+	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_006083170.1|722150_722711_+	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	41.4	3.8e-31
WP_006083169.1|726122_726569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006083168.1|726555_727179_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012586715.1|727513_730456_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_012586716.1|731332_734239_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_006083165.1|735585_736155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006083164.1|736218_736668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012586717.1|736670_739517_+	TcfC E-set like domain-containing protein	NA	NA	NA	NA	NA
WP_006083162.1|739509_740244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006083161.1|740245_741253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006083160.1|742095_742647_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_006083112.1|743283_744384_-|transposase	ISAs1-like element ISSba1 family transposase	transposase	NA	NA	NA	NA
WP_012586718.1|745080_748020_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_006083157.1|748717_749290_+	porin family protein	NA	NA	NA	NA	NA
WP_006079577.1|750631_751741_+|transposase	ISAs1-like element ISSba2 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_011663	Shewanella baltica OS223, complete sequence	5145902	859526	925861	5145902	portal,terminase,transposase,protease,integrase	Vibrio_phage(33.33%)	76	863765:863779	926903:926917
WP_012586765.1|859526_860879_-|protease	DegQ family serine endoprotease	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	27.6	4.4e-09
WP_012586766.1|861292_862405_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_006083053.1|862695_863124_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_006083052.1|863138_863531_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_012586767.1|863684_863873_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
863765:863779	attL	GTGGCGTCGTTATTT	NA	NA	NA	NA
WP_012586768.1|863945_865241_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	36.7	1.6e-64
WP_011847814.1|865353_866010_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_006083048.1|866049_868473_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.3	8.1e-62
WP_012586769.1|868473_869214_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_012586770.1|869362_870805_-	MFS transporter	NA	NA	NA	NA	NA
WP_006083045.1|871028_871772_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_006083044.1|871985_872381_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_006083043.1|872389_872695_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_006083042.1|872707_872935_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_006086059.1|872971_873424_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_012586771.1|873691_875890_-	S46 family peptidase	NA	NA	NA	NA	NA
WP_006083039.1|876015_877422_+	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	70.8	2.1e-179
WP_012586772.1|877525_878602_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.2	3.5e-25
WP_006083037.1|879141_879606_-	chemotaxis protein CheX	NA	NA	NA	NA	NA
WP_012586773.1|880450_882643_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_012586774.1|882743_883418_+	Fe2+-dependent dioxygenase	NA	A0A127KM56	Cyanophage	32.5	1.2e-15
WP_012586775.1|883855_884341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012586776.1|884532_884946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012586777.1|885172_885814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012586779.1|886000_886270_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_011847801.1|886266_886797_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_041408338.1|887143_887686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012586781.1|887850_888132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012586783.1|888396_888534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012586784.1|888530_888761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012586785.1|888757_889036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012089044.1|889036_889330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012586786.1|889326_890025_-	hypothetical protein	NA	Q5QF31	Pseudomonas_virus	36.3	8.6e-17
WP_012586787.1|890021_890612_-	ead/Ea22-like family protein	NA	NA	NA	NA	NA
WP_006083880.1|890622_890787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011847795.1|890823_891171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012586788.1|891196_891457_-	pyocin activator PrtN family protein	NA	NA	NA	NA	NA
WP_012586789.1|891453_891807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041408576.1|891994_892849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_190273083.1|893379_893796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012586792.1|893941_894283_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_012586793.1|894275_894620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041408342.1|894649_895000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006079577.1|894996_896106_-|transposase	ISAs1-like element ISSba2 family transposase	transposase	NA	NA	NA	NA
WP_012586794.1|896654_897356_-	helix-turn-helix transcriptional regulator	NA	R9TNM0	Vibrio_phage	48.5	7.5e-61
WP_012586795.1|897435_897639_+	Cro/Cl family transcriptional regulator	NA	NA	NA	NA	NA
WP_012586796.1|897670_898279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041408346.1|898443_899193_+	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	45.7	7.1e-33
WP_012586798.1|899189_899876_+	replication protein P	NA	I6PBN0	Cronobacter_phage	29.5	1.6e-10
WP_012586799.1|899865_901122_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A067ZJC5	Vibrio_phage	33.9	8.5e-47
WP_012586800.1|901177_901396_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_190273084.1|901442_901760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012586802.1|901768_902383_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	63.0	2.2e-64
WP_012586803.1|903303_903828_+	lysozyme	NA	A0A2H4P869	Pseudomonas_phage	38.7	5.9e-18
WP_012586804.1|903817_904321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012586805.1|904431_904767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012088279.1|904720_905254_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	49.1	3.1e-35
WP_012586806.1|905228_907226_+|terminase	phage terminase large subunit family protein	terminase	A0A1B0Z2K0	Pseudomonas_phage	49.8	2.6e-191
WP_012586807.1|907268_907475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012586808.1|907524_909099_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	48.2	3.3e-125
WP_012586809.1|909070_911080_+|protease	Clp protease ClpP	protease	A0A1B0YZU0	Pseudomonas_phage	63.2	4.9e-222
WP_012586810.1|911160_911484_+	DUF2190 family protein	NA	A0A076G9K1	Pseudoalteromonas_phage	37.4	7.5e-08
WP_012586811.1|911476_911821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012586812.1|911824_912382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012586813.1|912415_912841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012586814.1|912837_913560_+	hypothetical protein	NA	A0A2I7S8N4	Vibrio_phage	34.3	4.7e-26
WP_012586815.1|913652_917573_+	tape measure protein	NA	A0A2I7S9D9	Vibrio_phage	36.1	1.0e-37
WP_012586816.1|917611_917983_+	hypothetical protein	NA	A0A2I7QS24	Vibrio_phage	51.4	1.7e-24
WP_012586817.1|917990_920465_+	hypothetical protein	NA	A0A2I7S8M8	Vibrio_phage	52.2	2.0e-233
WP_012586818.1|920476_921424_+	hypothetical protein	NA	A0A088C4T9	Shewanella_sp._phage	31.9	9.9e-32
WP_012586819.1|921416_921716_+	hypothetical protein	NA	A0A2I7QRU3	Vibrio_phage	36.4	5.0e-06
WP_012586820.1|921715_923500_+	hypothetical protein	NA	A0A2I7QS09	Vibrio_phage	45.4	7.6e-150
WP_012586821.1|923525_923738_+	hypothetical protein	NA	A0A088C533	Shewanella_sp._phage	62.9	7.1e-15
WP_012586822.1|923785_924127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012586823.1|924232_924529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012586824.1|924796_925861_-|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	57.5	1.9e-116
926903:926917	attR	GTGGCGTCGTTATTT	NA	NA	NA	NA
>prophage 3
NC_011663	Shewanella baltica OS223, complete sequence	5145902	1425014	1432584	5145902		Staphylococcus_phage(50.0%)	7	NA	NA
WP_006086878.1|1425014_1426682_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	28.0	3.9e-39
WP_012587088.1|1426871_1428125_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.6	3.2e-102
WP_006082643.1|1428385_1428835_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_012587089.1|1428981_1430136_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.7	4.0e-51
WP_006082641.1|1430147_1430804_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	34.0	8.7e-27
WP_006082640.1|1430870_1431974_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.7	4.5e-68
WP_006082639.1|1432104_1432584_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.0	2.7e-30
>prophage 4
NC_011663	Shewanella baltica OS223, complete sequence	5145902	1467872	1478992	5145902	tRNA	uncultured_Mediterranean_phage(33.33%)	8	NA	NA
WP_006086855.1|1467872_1468622_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.2	1.3e-71
WP_006082610.1|1468618_1469254_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.4	5.4e-34
WP_012587106.1|1469354_1470251_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_006086853.1|1470331_1471312_+	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	32.7	8.4e-34
WP_012587107.1|1471515_1474086_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.1	3.3e-29
WP_011847432.1|1474469_1475537_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.9	2.4e-111
WP_080517123.1|1475599_1476025_+	regulatory protein RecX	NA	NA	NA	NA	NA
WP_012587110.1|1476367_1478992_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	36.4	2.2e-65
>prophage 5
NC_011663	Shewanella baltica OS223, complete sequence	5145902	2321438	2331738	5145902		Faustovirus(12.5%)	13	NA	NA
WP_012587530.1|2321438_2322653_+	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	31.5	7.4e-32
WP_006081856.1|2322690_2323074_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	76.6	2.2e-51
WP_006081855.1|2323088_2323412_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	46.3	1.8e-22
WP_012587531.1|2323428_2323953_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_012587532.1|2324020_2325883_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.3	1.2e-102
WP_006081852.1|2325891_2326230_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_006081851.1|2326388_2327294_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	33.6	9.4e-40
WP_006081850.1|2327407_2327605_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_006081849.1|2327822_2327990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006081848.1|2328188_2328620_+	nucleoside-diphosphate kinase	NA	K7YW26	Megavirus	40.2	1.1e-17
WP_006081847.1|2328982_2329426_+	Hsp20 family protein	NA	A0A2L0V0Y9	Agrobacterium_phage	51.5	3.7e-21
WP_006081846.1|2329525_2330020_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_006081845.1|2330019_2331738_-	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.0	1.6e-56
>prophage 6
NC_011663	Shewanella baltica OS223, complete sequence	5145902	2605724	2617252	5145902	tRNA	uncultured_Caudovirales_phage(28.57%)	12	NA	NA
WP_012587685.1|2605724_2608478_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	48.5	1.9e-83
WP_011846837.1|2608534_2609161_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_012587686.1|2609169_2610501_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	39.0	7.5e-78
WP_011846839.1|2610493_2610868_+	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	36.5	1.8e-08
WP_012587687.1|2610886_2612173_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.0	2.6e-99
WP_006081642.1|2612458_2612797_-	TusE/DsrC/DsvC family sulfur relay protein	NA	NA	NA	NA	NA
WP_006081641.1|2612790_2613072_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_012587688.1|2613071_2613428_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_012587689.1|2613442_2613832_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.4	3.9e-19
WP_012587690.1|2613901_2614561_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	43.9	4.3e-34
WP_011846842.1|2614962_2615865_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012587691.1|2615980_2617252_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	24.8	3.9e-15
>prophage 7
NC_011663	Shewanella baltica OS223, complete sequence	5145902	3046936	3105737	5145902	tail,portal,terminase,capsid,head,integrase,protease,transposase	Vibrio_phage(36.36%)	64	3058347:3058362	3109096:3109111
WP_006079577.1|3046936_3048046_+|transposase	ISAs1-like element ISSba2 family transposase	transposase	NA	NA	NA	NA
WP_041408507.1|3048042_3048885_-	DUF1444 family protein	NA	NA	NA	NA	NA
WP_041408508.1|3049120_3051367_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012587902.1|3051761_3053552_-	acyl-CoA dehydrogenase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012587903.1|3053798_3054647_+	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_012587904.1|3054901_3055777_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006087464.1|3056085_3056565_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_012088890.1|3056683_3057052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011846537.1|3057286_3058525_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
3058347:3058362	attL	TCAACATCGAAATCTT	NA	NA	NA	NA
WP_006081231.1|3058762_3058996_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	4.4e-10
WP_006081230.1|3059160_3059907_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.7	6.0e-16
WP_012587905.1|3059916_3060843_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_006081228.1|3060905_3061865_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_012587907.1|3067641_3068280_-|tail	tail assembly protein	tail	A0A1V0E8A0	Vibrio_phage	65.5	2.3e-61
WP_012587908.1|3068396_3069125_-	C40 family peptidase	NA	A0A1V1FD38	Vibrio_phage	53.6	5.7e-72
WP_012587909.1|3069278_3070004_-|tail	phage minor tail protein L	tail	A0A1V0E876	Vibrio_phage	62.9	3.1e-94
WP_086014900.1|3069996_3070656_-	hypothetical protein	NA	A0A1B1ITJ0	uncultured_Mediterranean_phage	27.8	4.5e-07
WP_012587911.1|3070670_3072920_-	hypothetical protein	NA	A0A1B1ITM8	uncultured_Mediterranean_phage	33.8	6.5e-98
WP_012587912.1|3072944_3073280_-|tail	phage tail protein	tail	A0A1V1FDP8	Vibrio_phage	57.9	1.0e-31
WP_012587913.1|3073279_3076648_-|tail	phage tail tape measure protein	tail	A0A1V0E821	Vibrio_phage	46.5	7.5e-199
WP_012587914.1|3076728_3076872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012587915.1|3076910_3077405_-|tail	phage tail assembly chaperone family protein, TAC	tail	A0A1V0E823	Vibrio_phage	47.6	5.3e-29
WP_012587916.1|3077493_3077967_-|tail	tail protein	tail	A0A1V0E8B3	Vibrio_phage	68.6	6.6e-53
WP_012587917.1|3078058_3078427_-	DUF3168 domain-containing protein	NA	A0A1V0E8A7	Vibrio_phage	57.4	4.8e-35
WP_012587918.1|3078423_3078888_-	HK97 gp10 family phage protein	NA	A0A1V0E895	Vibrio_phage	59.7	6.9e-47
WP_012587919.1|3078889_3079252_-|head,tail	head-tail adaptor protein	head,tail	Q9XJT0	Pseudomonas_phage	56.3	1.5e-33
WP_012587920.1|3079251_3079548_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9XJT1	Pseudomonas_phage	60.4	4.8e-25
WP_012587921.1|3079569_3079869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012587922.1|3079965_3081156_-|capsid	phage major capsid protein	capsid	H2BDB0	Pseudomonas_virus	63.2	3.2e-128
WP_012587923.1|3081168_3082023_-|protease	Clp protease ClpP	protease	A0A1V0E8B8	Vibrio_phage	59.7	2.9e-83
WP_012587924.1|3082026_3083331_-|portal	phage portal protein	portal	A0A0U4IIV7	Pseudomonas_phage	61.6	1.8e-137
WP_012587925.1|3083327_3083489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041408510.1|3083488_3085237_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.3	2.0e-139
WP_012587927.1|3085190_3085703_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	54.5	5.3e-40
WP_012587928.1|3085711_3086050_-	HNH endonuclease	NA	B5WZZ4	Pseudomonas_phage	58.1	1.0e-31
WP_012587929.1|3086046_3086415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012587930.1|3086407_3086677_-	hypothetical protein	NA	A0A1B1ITN8	uncultured_Mediterranean_phage	45.5	4.8e-08
WP_012587931.1|3086793_3087318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012587933.1|3087567_3088080_-	lysozyme	NA	Q6V7L5	Burkholderia_virus	53.5	4.4e-42
WP_012587934.1|3088264_3088711_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_012587935.1|3088770_3090027_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	42.8	3.4e-88
WP_012587936.1|3090014_3090443_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1B1ITQ0	uncultured_Mediterranean_phage	48.6	7.1e-22
WP_012587937.1|3090621_3091206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006079577.1|3091475_3092585_-|transposase	ISAs1-like element ISSba2 family transposase	transposase	NA	NA	NA	NA
WP_041408512.1|3092619_3093564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012587938.1|3093908_3095144_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A067ZJC5	Vibrio_phage	36.3	1.6e-66
WP_012587939.1|3095143_3095743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012587940.1|3095742_3096312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012587941.1|3096308_3096752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012587942.1|3096751_3097258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012587943.1|3097254_3097635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012587944.1|3097618_3098179_-	hypothetical protein	NA	A0A2D1GNB3	Pseudomonas_phage	29.4	3.8e-07
WP_012587945.1|3098150_3099218_-	replication protein	NA	A0A1I9KG10	Aeromonas_phage	44.4	8.8e-53
WP_012587946.1|3099291_3099549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012587947.1|3099548_3099743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012587948.1|3099735_3100314_-	phage regulatory CII family protein	NA	NA	NA	NA	NA
WP_012587949.1|3100348_3100552_-	Cro/Cl family transcriptional regulator	NA	NA	NA	NA	NA
WP_012587950.1|3100690_3101422_+	helix-turn-helix transcriptional regulator	NA	W6MVG5	Pseudomonas_phage	48.5	4.7e-58
WP_012587951.1|3101449_3101872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012587952.1|3101897_3102326_+	superinfection immunity protein	NA	A0A0S2SY85	Pseudomonas_phage	40.7	8.7e-12
WP_012587953.1|3102350_3103253_+	DNA polymerase III subunit epsilon	NA	X2KQX9	Campylobacter_phage	29.0	2.5e-16
WP_012587954.1|3103377_3104478_+	hypothetical protein	NA	A0A0P0IRH5	Acinetobacter_phage	26.7	9.1e-21
WP_012587955.1|3104545_3105025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041408513.1|3105065_3105737_-|tail	tail assembly protein	tail	A0A1V0E8A0	Vibrio_phage	72.5	5.9e-71
3109096:3109111	attR	AAGATTTCGATGTTGA	NA	NA	NA	NA
>prophage 8
NC_011663	Shewanella baltica OS223, complete sequence	5145902	3512352	3596228	5145902	tRNA,holin,transposase	Bacillus_phage(21.43%)	57	NA	NA
WP_086014843.1|3512352_3513568_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	30.9	2.3e-25
WP_012588183.1|3514457_3516329_-	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_006080906.1|3517109_3518081_-	phosphate ABC transporter substrate-binding protein PstS family protein	NA	NA	NA	NA	NA
WP_006080905.1|3518309_3519608_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	33.5	5.3e-28
WP_006080904.1|3519688_3520378_-	phosphate regulon transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	38.5	1.7e-36
WP_041408521.1|3520564_3521509_-	porin	NA	NA	NA	NA	NA
WP_006080902.1|3521800_3522715_+	recombination-associated protein RdgC	NA	A0A088C419	Shewanella_sp._phage	58.7	2.7e-87
WP_012588186.1|3522998_3524816_-	M61 family metallopeptidase	NA	NA	NA	NA	NA
WP_012588187.1|3524950_3527113_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012588188.1|3527264_3528821_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.7	1.0e-17
WP_006080898.1|3528877_3530233_+	LOG family protein	NA	NA	NA	NA	NA
WP_012588189.1|3530254_3531043_+	flap endonuclease Xni	NA	L7TSA2	Rhizobium_phage	29.1	1.8e-15
WP_012588190.1|3531153_3531576_+	DUF3192 domain-containing protein	NA	NA	NA	NA	NA
WP_012588191.1|3531707_3534542_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_006080893.1|3534796_3535804_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_011846285.1|3536068_3537154_-	23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM	NA	NA	NA	NA	NA
WP_006080891.1|3537332_3537725_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_012588192.1|3537783_3538428_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_006080889.1|3538408_3539320_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_006080888.1|3539531_3539774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006080887.1|3539905_3541360_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_006080886.1|3541888_3542821_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_006080885.1|3542824_3543592_-	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_012588193.1|3543906_3544146_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_006085153.1|3544148_3545030_+	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
WP_006080882.1|3545051_3546920_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_086014843.1|3547056_3548273_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	30.9	2.3e-25
WP_006080881.1|3548401_3549022_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_012588194.1|3549122_3550001_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_012588195.1|3551037_3552681_+	L-lactate permease	NA	NA	NA	NA	NA
WP_012588196.1|3552745_3555550_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_006080877.1|3555860_3556604_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_012588197.1|3556614_3558009_+	lactate utilization protein	NA	NA	NA	NA	NA
WP_006080875.1|3558010_3558580_+	LUD domain-containing protein	NA	NA	NA	NA	NA
WP_012588198.1|3559242_3560421_+	AAA family ATPase	NA	A0A1Y0SVM5	Pseudomonas_phage	29.9	2.6e-34
WP_006079577.1|3560682_3561792_+|transposase	ISAs1-like element ISSba2 family transposase	transposase	NA	NA	NA	NA
WP_049768944.1|3561788_3562346_-	hypothetical protein	NA	A0A141GF23	Brucella_phage	27.3	2.2e-07
WP_006085141.1|3562832_3564344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012588199.1|3564814_3566170_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_012588200.1|3566570_3568112_+	MFS transporter	NA	NA	NA	NA	NA
WP_006085138.1|3568212_3568737_-	DUF3087 domain-containing protein	NA	NA	NA	NA	NA
WP_012588201.1|3569137_3569899_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012588202.1|3570032_3571139_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_012588203.1|3571358_3572777_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	9.5e-55
WP_012588204.1|3572906_3575954_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	37.5	3.2e-23
WP_012588205.1|3576084_3577704_-	glycogen synthase	NA	NA	NA	NA	NA
WP_012088651.1|3577888_3579151_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_012588207.1|3579334_3581866_-	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	43.7	1.4e-16
WP_012588208.1|3581877_3584079_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_012588209.1|3584080_3586312_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_012588210.1|3586426_3588853_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_012588211.1|3589458_3590088_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	33.7	3.1e-13
WP_012587370.1|3590236_3591559_+|transposase	IS4-like element ISSba6 family transposase	transposase	NA	NA	NA	NA
WP_006080852.1|3591648_3592125_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012588212.1|3592216_3592921_-	membrane protein	NA	NA	NA	NA	NA
WP_006080850.1|3592935_3594153_-|holin	choline transporter	holin	NA	NA	NA	NA
WP_006080849.1|3594542_3596228_-|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	27.7	5.6e-46
>prophage 9
NC_011663	Shewanella baltica OS223, complete sequence	5145902	4904065	4917802	5145902		Bacillus_phage(42.86%)	9	NA	NA
WP_012588849.1|4904065_4908955_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	31.3	4.3e-70
WP_006079507.1|4909313_4910039_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	1.7e-31
WP_012588850.1|4910081_4911398_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	22.7	1.9e-09
WP_012588851.1|4911527_4913510_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.9	4.6e-15
WP_006079504.1|4913587_4914061_-	peroxiredoxin	NA	M1I839	Pelagibacter_phage	47.4	5.5e-23
WP_006084639.1|4914141_4915098_-	choice-of-anchor H family protein	NA	NA	NA	NA	NA
WP_012588852.1|4915456_4915747_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_006079500.1|4915749_4916445_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	25.7	4.0e-06
WP_012588853.1|4916437_4917802_+	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	23.3	8.4e-08
>prophage 10
NC_011663	Shewanella baltica OS223, complete sequence	5145902	4950778	5023681	5145902	integrase,transposase	Vibrio_phage(28.57%)	47	5022198:5022219	5028049:5028070
WP_006079577.1|4950778_4951888_-|transposase	ISAs1-like element ISSba2 family transposase	transposase	NA	NA	NA	NA
WP_041408550.1|4951917_4952922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012588879.1|4953926_4954133_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_012588880.1|4954928_4956299_+	Fic family protein	NA	NA	NA	NA	NA
WP_012588881.1|4956638_4956953_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012588882.1|4957052_4957601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006083112.1|4959586_4960687_-|transposase	ISAs1-like element ISSba1 family transposase	transposase	NA	NA	NA	NA
WP_041408552.1|4964600_4965497_+	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_006084679.1|4965521_4965938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011979493.1|4967838_4968762_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	81.8	1.3e-148
WP_012588884.1|4969141_4970191_-	type I-F CRISPR-associated protein Csy3	NA	A0A2I7RCY7	Vibrio_phage	22.9	3.1e-10
WP_012588885.1|4970200_4972306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012588886.1|4972299_4973532_-	TniQ family protein	NA	NA	NA	NA	NA
WP_012588887.1|4973807_4975430_+	SAM-dependent DNA methyltransferase	NA	A0A1V0SLK8	Klosneuvirus	31.6	7.9e-29
WP_012588888.1|4975426_4976632_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_049768957.1|4976728_4980352_+	DEAD/DEAH box helicase family protein	NA	Q6NDX2	Leptospira_phage	23.5	1.8e-12
WP_150102357.1|4980517_4981048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086012318.1|4981102_4982261_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	35.2	7.1e-48
WP_041408554.1|4982463_4986066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012588890.1|4986195_4986453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012588891.1|4986560_4986845_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	59.3	5.0e-24
WP_012588892.1|4986855_4988061_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0P0ZCT8	Stx2-converting_phage	57.4	2.2e-28
WP_012588893.1|4988220_4988532_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012588894.1|4988752_4989274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150102365.1|4990670_4991633_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_012588897.1|4991689_4993543_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_012588898.1|4993539_4994169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012588899.1|4994406_4995153_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_012588900.1|4995419_4997684_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_006079458.1|4997776_4998622_+	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_012588901.1|4999445_5000483_-	DUF3137 domain-containing protein	NA	NA	NA	NA	NA
WP_006079455.1|5000532_5001099_-	LemA family protein	NA	NA	NA	NA	NA
WP_172481254.1|5001736_5003293_+	AbgT family transporter	NA	NA	NA	NA	NA
WP_006079453.1|5003367_5003691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012588903.1|5003728_5003992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012588904.1|5004125_5007260_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_012090603.1|5007269_5008415_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011845425.1|5009312_5010059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012588905.1|5010192_5010882_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_006079447.1|5011089_5011737_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_011845423.1|5011762_5012293_-	thioesterase family protein	NA	NA	NA	NA	NA
WP_012588906.1|5012477_5014517_-	oligopeptidase A	NA	NA	NA	NA	NA
WP_012588907.1|5014785_5015577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012588908.1|5015744_5016308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012588909.1|5016487_5017846_+	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_041408654.1|5018383_5021932_+	hypothetical protein	NA	NA	NA	NA	NA
5022198:5022219	attL	AAAACTTTCACATGTGAAAGTT	NA	NA	NA	NA
WP_012588911.1|5022343_5023681_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_012588911.1|5022343_5023681_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
5028049:5028070	attR	AAAACTTTCACATGTGAAAGTT	NA	NA	NA	NA
>prophage 1
NC_011664	Shewanella baltica OS223 plasmid pS22301, complete sequence	88311	2280	74377	88311	integrase,transposase	Escherichia_phage(16.67%)	56	46638:46653	81443:81458
WP_011979493.1|2280_3204_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	81.8	1.3e-148
WP_011979494.1|3407_4436_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_086012321.1|4659_5837_-|transposase	IS3-like element ISSba5 family transposase	transposase	Q716C2	Shigella_phage	65.5	1.2e-119
WP_011979497.1|7507_8380_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.1	1.4e-40
WP_011979498.1|8516_10472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011979499.1|11325_12018_+|transposase	IS6-like element ISSba18 family transposase	transposase	A0A077SL39	Escherichia_phage	43.7	4.7e-39
WP_011979500.1|12179_13043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011979501.1|13276_13885_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.9	1.2e-09
WP_011979499.1|14467_15160_-|transposase	IS6-like element ISSba18 family transposase	transposase	A0A077SL39	Escherichia_phage	43.7	4.7e-39
WP_012198005.1|15909_16269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012198006.1|16261_16948_-	ParA family protein	NA	A0A0A8IL09	Aurantimonas_phage	42.0	4.5e-34
WP_006087334.1|18332_20990_-	peptidase M66	NA	NA	NA	NA	NA
WP_006087333.1|21271_21832_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	83.1	7.6e-48
WP_006087332.1|21835_24868_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_012588976.1|25320_25923_+	recombinase family protein	NA	A0A0A8WJD4	Clostridium_phage	28.2	2.7e-06
WP_049768959.1|26331_26979_+	RES domain-containing protein	NA	NA	NA	NA	NA
WP_012588978.1|27002_27632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012588979.1|28211_28886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012588980.1|29060_29834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012588981.1|30449_31013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150102367.1|31090_31900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012588983.1|32052_32889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012588984.1|33027_33261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012588985.1|33405_33780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012588986.1|34229_35327_-	chromosome partitioning protein ParB	NA	A0A1B0V750	Salmonella_phage	39.3	2.4e-45
WP_012588987.1|35326_36526_-	AAA family ATPase	NA	A0A240F4U1	Ochrobactrum_phage	25.9	2.6e-21
WP_190273090.1|36691_36922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012197907.1|37582_38314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012197906.1|38760_38943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012197905.1|39062_39320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012588990.1|39421_39610_+	TraY domain-containing protein	NA	NA	NA	NA	NA
WP_012588991.1|39673_40048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012588992.1|40051_40354_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_012197903.1|40394_40961_+	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_006087324.1|40960_41779_+	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_012197902.1|41775_43302_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_190273091.1|43334_43778_+	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_012588994.1|43781_46370_+	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_012197899.1|46371_46743_+	TrbI F-type domain-containing protein	NA	NA	NA	NA	NA
46638:46653	attL	TGGCGCGGTGAATGTC	NA	NA	NA	NA
WP_012197898.1|46739_47444_+	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_012197897.1|47430_48444_+	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_012588995.1|48466_49207_+	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_012588996.1|49203_51006_+	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_012588997.1|51002_51878_+	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_012197893.1|51891_52329_+	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_012588999.1|52501_53890_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_012197891.1|53892_56706_+	conjugal transfer mating pair stabilization protein TraG	NA	NA	NA	NA	NA
WP_012197888.1|56743_57277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012589000.1|57279_59406_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_012589001.1|59419_59599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012589002.1|59657_65618_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_012589003.1|65638_65998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012589004.1|67488_68313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006079577.1|69044_70154_-|transposase	ISAs1-like element ISSba2 family transposase	transposase	NA	NA	NA	NA
WP_012589005.1|71844_72816_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_012589006.1|73021_74377_-|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	25.8	2.3e-18
81443:81458	attR	GACATTCACCGCGCCA	NA	NA	NA	NA
>prophage 1
NC_011668	Shewanella baltica OS223 plasmid pS22302, complete sequence	65448	43178	54864	65448		uncultured_Caudovirales_phage(28.57%)	12	NA	NA
WP_012592961.1|43178_45494_-	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	27.9	2.6e-25
WP_005458449.1|45515_45731_-	helix-turn-helix transcriptional regulator	NA	A0A0E3U244	Fusobacterium_phage	41.4	2.4e-10
WP_012592962.1|46134_46311_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_012592963.1|46424_47054_-	recombinase family protein	NA	A0A0A8WJD4	Clostridium_phage	30.0	7.3e-07
WP_011979484.1|47296_47566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150102369.1|47886_48225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012592966.1|48329_49004_-	ParA family protein	NA	A0A222YXS3	Escherichia_phage	24.9	3.0e-06
WP_012592968.1|49440_50061_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_012592969.1|50153_50426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011979491.1|50805_51048_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	60.0	8.4e-20
WP_011979492.1|51037_51322_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	67.0	6.2e-30
WP_012592970.1|51609_54864_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	25.4	8.0e-65
