The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_011761	Acidithiobacillus ferrooxidans ATCC 23270, complete sequence	2982397	265258	274044	2982397		Staphylococcus_phage(66.67%)	11	NA	NA
WP_012536070.1|265258_266503_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.6	1.5e-99
WP_012536071.1|266509_267001_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_111122540.1|266987_268091_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	34.0	3.8e-43
WP_009560911.1|268094_268751_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	35.2	8.4e-30
WP_012536073.1|268747_269881_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	36.3	9.3e-53
WP_009568607.1|269877_270342_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	51.0	3.6e-35
WP_012536074.1|270352_270796_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_012536075.1|270923_271205_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_012536076.1|271363_271936_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_012536077.1|271953_272307_-	LapA family protein	NA	NA	NA	NA	NA
WP_012536078.1|272361_274044_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	G9E5W0	Micromonas_pusilla_virus	29.3	2.2e-34
>prophage 2
NC_011761	Acidithiobacillus ferrooxidans ATCC 23270, complete sequence	2982397	441198	488691	2982397	protease,integrase,transposase	uncultured_virus(15.38%)	40	441055:441086	444437:444468
441055:441086	attL	GTACCATTATGTGGCGCTTTAAAATATGTGGC	NA	NA	NA	NA
WP_012535982.1|441198_442443_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012535983.1|442439_443381_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_009561339.1|443373_444372_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	26.5	1.5e-17
WP_012535981.1|444546_445074_+	hypothetical protein	NA	NA	NA	NA	NA
444437:444468	attR	GCCACATATTTTAAAGCGCCACATAATGGTAC	NA	NA	NA	NA
WP_012535980.1|445077_445917_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_009567530.1|445927_446131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012536173.1|446271_446436_+	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_049756714.1|446390_446723_+	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_080513172.1|447350_447692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606575.1|448642_449236_+	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_012536176.1|449302_450778_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	31.6	2.6e-47
WP_012536177.1|450781_453040_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.3	4.9e-170
WP_012536178.1|453043_453352_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	37.8	3.9e-14
WP_012536179.1|453528_454305_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_012536180.1|454320_454932_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_012536181.1|455069_456518_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	29.6	1.8e-29
WP_012536182.1|456581_458000_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_009563800.1|458003_459533_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_012536183.1|459600_462087_-	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	41.4	3.8e-14
WP_009569165.1|462231_462681_+	host attachment protein	NA	NA	NA	NA	NA
WP_012536184.1|462714_463101_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_012536185.1|463113_464055_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_012536186.1|464175_464781_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_012536187.1|464924_466094_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	59.1	3.0e-123
WP_009567191.1|466281_467688_+	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	30.7	4.9e-43
WP_012536188.1|467687_468506_+	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_012536189.1|468610_469483_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_012536190.1|469625_470297_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_012536191.1|470322_471849_-	fibronectin/fibrinogen-binding protein	NA	M1H1U8	Paramecium_bursaria_Chlorella_virus	40.6	2.4e-11
WP_012536192.1|471884_473558_-	sulfate adenylyltransferase	NA	A0A2K9L0F0	Tupanvirus	35.0	2.6e-91
WP_012536193.1|473568_474138_-	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_012536194.1|474398_476054_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	61.2	2.3e-177
WP_009567579.1|476100_476391_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	45.7	5.5e-18
WP_009567578.1|476518_477349_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_012536195.1|477662_479513_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_009567466.1|479532_479745_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_009567465.1|479749_480673_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_012536196.1|480685_483550_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_080513173.1|483798_487395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606582.1|487464_488691_-|transposase	IS110-like element ISAfe3 family transposase	transposase	Q9JMN8	Wolbachia_phage	30.0	1.8e-41
>prophage 3
NC_011761	Acidithiobacillus ferrooxidans ATCC 23270, complete sequence	2982397	996621	1023042	2982397	protease,transposase,integrase	Wolbachia_phage(25.0%)	42	1005931:1005944	1023923:1023936
WP_012606815.1|996621_997212_+|transposase	IS607 family transposase	transposase	F9VHY9	Thermus_phage	42.2	5.2e-31
WP_012606816.1|997208_998858_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_041645466.1|998961_999168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606817.1|999218_999761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049759422.1|999757_1000096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041645471.1|1000098_1000308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606819.1|1000304_1000982_+	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_012606582.1|1001067_1002294_-|transposase	IS110-like element ISAfe3 family transposase	transposase	Q9JMN8	Wolbachia_phage	30.0	1.8e-41
WP_041645475.1|1002566_1002755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606821.1|1002754_1003066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606822.1|1003062_1003296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041645480.1|1003282_1003525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606823.1|1003536_1004358_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_012606824.1|1004469_1005354_+	metallophosphoesterase	NA	A0A291L9W7	Bordetella_phage	54.5	2.8e-20
WP_012606825.1|1005350_1005590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041645486.1|1005777_1006014_+	hypothetical protein	NA	NA	NA	NA	NA
1005931:1005944	attL	TTTCTTGCTGGTGG	NA	NA	NA	NA
WP_012606827.1|1006006_1006258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162467496.1|1006217_1006487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148208606.1|1006446_1007487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606830.1|1007483_1008092_+	hypothetical protein	NA	S4TRF9	Salmonella_phage	33.9	3.2e-07
WP_012606831.1|1008141_1008399_+	DUF4031 domain-containing protein	NA	A0A0M7QF68	Escherichia_phage	45.5	4.9e-10
WP_041645491.1|1008422_1008851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041645496.1|1008847_1009216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606833.1|1009215_1009458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606834.1|1009463_1009790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606835.1|1009810_1010182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606836.1|1010178_1010730_+	nucleoside 2-deoxyribosyltransferase	NA	NA	NA	NA	NA
WP_012606837.1|1010760_1011288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148208634.1|1011363_1011603_+	hypothetical protein	NA	J7I0T4	Pseudomonas_phage	52.7	3.6e-07
WP_148208607.1|1012157_1012523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606841.1|1012628_1013108_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_080513182.1|1013094_1013463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041645534.1|1013494_1014070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606844.1|1014069_1014771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606845.1|1014752_1015283_+	DedA family protein	NA	NA	NA	NA	NA
WP_012606846.1|1015351_1017589_+	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	25.7	8.3e-37
WP_041647200.1|1018228_1019098_+	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_012606582.1|1019377_1020604_+|transposase	IS110-like element ISAfe3 family transposase	transposase	Q9JMN8	Wolbachia_phage	30.0	1.8e-41
WP_041645546.1|1020635_1021208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148208608.1|1021320_1021683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041645555.1|1021693_1021924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012606853.1|1022136_1023042_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1023923:1023936	attR	TTTCTTGCTGGTGG	NA	NA	NA	NA
>prophage 4
NC_011761	Acidithiobacillus ferrooxidans ATCC 23270, complete sequence	2982397	1535548	1543835	2982397	tRNA	Paramecium_bursaria_Chlorella_virus(16.67%)	6	NA	NA
WP_012536745.1|1535548_1536160_-	deoxynucleoside kinase	NA	M1H1I8	Paramecium_bursaria_Chlorella_virus	25.8	1.0e-05
WP_012536747.1|1536681_1538034_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	B8QTX7	Erwinia_phage	29.9	6.6e-13
WP_012607229.1|1538055_1539489_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	36.5	1.7e-27
WP_012536749.1|1539683_1540688_-	glycosyltransferase family 2 protein	NA	F1C5B0	Cronobacter_phage	49.7	1.6e-80
WP_012536750.1|1540826_1542287_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.7	1.7e-91
WP_012536751.1|1542290_1543835_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.4	8.0e-15
