The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_011365	Gluconacetobacter diazotrophicus PA1 5, complete sequence	3887492	576230	631264	3887492	portal,capsid,integrase,tRNA,terminase,plate,tail	uncultured_Mediterranean_phage(21.43%)	55	600121:600166	640103:640148
WP_012226193.1|576230_577493_-|tRNA	tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))- methylthiotransferase MtaB	tRNA	NA	NA	NA	NA
WP_012553178.1|577489_578329_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_012226195.1|578380_578782_-	VOC family protein	NA	NA	NA	NA	NA
WP_041249781.1|578880_579528_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_012553180.1|579747_581655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144880127.1|581755_582073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012226199.1|582159_582897_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.9	1.9e-14
WP_012226200.1|582893_583922_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_144880126.1|583918_584863_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012226202.1|585051_585246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012553183.1|585441_588324_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.3	1.7e-260
WP_012226206.1|588361_588727_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_012553184.1|588749_589883_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_012226209.1|590290_590596_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_012553185.1|590647_591517_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_012553186.1|591638_592097_-	adenosylmethionine decarboxylase	NA	A0A1D7SEZ2	Cyanophage	42.6	1.2e-14
WP_012553187.1|592255_595168_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	60.3	0.0e+00
WP_012553188.1|595462_596017_+	single-stranded DNA-binding protein	NA	A0A0U2C0X4	Paracoccus_phage	64.3	3.2e-38
WP_012226218.1|596184_598977_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.8	2.1e-93
WP_012226220.1|598969_599479_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	45.2	1.3e-30
WP_012226222.1|599537_600023_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	50.0	1.4e-34
600121:600166	attL	TCGACTTTTAATCGAATGGTCGTGGGTTCGAATCCCACCCGGCTCA	NA	NA	NA	NA
WP_012553189.1|600273_601515_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012553190.1|601710_603342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012553192.1|604742_605525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012553193.1|605713_606181_+	hypothetical protein	NA	A0A2H4J2P5	uncultured_Caudovirales_phage	51.5	3.2e-23
WP_043458628.1|606880_607378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012553196.1|607649_607859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012553197.1|607975_608656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012553198.1|608905_609340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012553199.1|609402_609909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012553200.1|610267_610858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157864097.1|611065_611431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012553201.1|611461_612808_-|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	22.7	4.9e-16
WP_043458629.1|613227_613803_+	HNH endonuclease	NA	A0A142K975	Gordonia_phage	45.6	5.3e-12
WP_157864099.1|614093_614447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012553202.1|614458_615238_-	DNA circularization N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_049762851.1|615273_615735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012553203.1|615754_616948_-	hypothetical protein	NA	A0A222YWB9	Escherichia_phage	45.7	9.0e-06
WP_157864101.1|617176_617362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157864103.1|617420_617801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012553204.1|617922_619062_-|tail	Mu-like protein prophage tail sheath protein gpL-like protein	tail	NA	NA	NA	NA
WP_157864105.1|619139_619697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157864107.1|619683_620073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012553205.1|620461_621109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157864109.1|621108_621264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012553206.1|621302_623486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012553207.1|623580_624999_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_157864111.1|625233_625563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157864113.1|625585_625825_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_081434692.1|625973_626423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157864115.1|626422_626845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012553208.1|626864_628619_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	28.6	1.7e-48
WP_157864117.1|628699_629011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157864119.1|629423_629816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012553209.1|630172_631264_+|plate	baseplate J/gp47 family protein	plate	A0A2P9JZK6	Alteromonadaceae_phage	29.1	5.5e-26
640103:640148	attR	TCGACTTTTAATCGAATGGTCGTGGGTTCGAATCCCACCCGGCTCA	NA	NA	NA	NA
>prophage 2
NC_011365	Gluconacetobacter diazotrophicus PA1 5, complete sequence	3887492	715955	787581	3887492	transposase,tRNA	Staphylococcus_phage(20.0%)	51	NA	NA
WP_012553257.1|715955_718571_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	36.3	9.4e-141
WP_012226362.1|718575_719304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012226364.1|719300_720314_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_012553258.1|721015_728074_+	type I polyketide synthase	NA	NA	NA	NA	NA
WP_012553259.1|728070_729357_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_144880124.1|729299_730520_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_012553261.1|730516_731758_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_144880123.1|731754_733410_-	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_012553263.1|733567_734737_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_012553265.1|736855_737860_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	31.4	4.8e-45
WP_012553266.1|738320_739787_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_157864127.1|739815_740932_+|transposase	IS3-like element ISGdi11 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	2.9e-54
WP_012224987.1|741037_741817_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.3	7.9e-35
WP_157864088.1|742495_743553_-|transposase	IS630-like element ISGdi4 family transposase	transposase	NA	NA	NA	NA
WP_144880476.1|743821_745861_-	dextranase	NA	NA	NA	NA	NA
WP_012553269.1|745760_745982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012553270.1|746123_747059_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012553272.1|747523_749131_-	hypothetical protein	NA	V5L4U5	Insectomime_virus	29.7	7.8e-13
WP_012553273.1|749167_750727_-	hypothetical protein	NA	A0A2N9QVU4	Dishui_lake_phycodnavirus	30.5	2.4e-27
WP_012553275.1|751519_752167_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.4	4.5e-12
WP_144880477.1|752163_752913_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012553277.1|752960_754136_-	capsule polysaccharide transporter	NA	NA	NA	NA	NA
WP_049762853.1|754314_755640_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_012553279.1|755824_756985_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_012553280.1|757061_758015_-	K channel inward rectifier domain-containing protein	NA	NA	NA	NA	NA
WP_012553281.1|758166_758388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012226407.1|758463_758880_+	VOC family protein	NA	NA	NA	NA	NA
WP_012226408.1|758903_759191_+	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_012226409.1|759213_759423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157864129.1|759558_760425_-	CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_041249417.1|760562_761006_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012226415.1|761193_762345_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	26.0	4.0e-19
WP_012553284.1|762364_763618_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_012553061.1|763754_764525_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	36.9	2.1e-32
WP_012226833.1|764514_766038_-|transposase	IS21-like element ISGdi17 family transposase	transposase	NA	NA	NA	NA
WP_012226420.1|767201_767666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012226421.1|767888_768929_+	low specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_012226422.1|768925_769549_+	LysE family translocator	NA	NA	NA	NA	NA
WP_012553287.1|769559_770411_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_012553288.1|770458_770890_-	UrcA family protein	NA	NA	NA	NA	NA
WP_012226425.1|771037_772462_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_012226426.1|772490_773117_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_012553289.1|773124_774312_-	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_049762991.1|774343_776263_-	M61 family metallopeptidase	NA	NA	NA	NA	NA
WP_012226433.1|777079_778222_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012226434.1|778214_781316_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_012226435.1|781312_782830_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_012553291.1|782947_784471_+	sugar ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	22.9	2.0e-05
WP_012226437.1|784467_785514_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012226441.1|785510_786518_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012553292.1|786588_787581_+|transposase	IS481-like element ISGdi9 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_011365	Gluconacetobacter diazotrophicus PA1 5, complete sequence	3887492	1016686	1060886	3887492	transposase	Leptospira_phage(28.57%)	37	NA	NA
WP_157864127.1|1016686_1017803_+|transposase	IS3-like element ISGdi11 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	2.9e-54
WP_012222646.1|1018027_1019086_-|transposase	IS481-like element ISGdi10 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	63.9	1.2e-126
WP_012226804.1|1020846_1021611_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_012553417.1|1021978_1022809_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012226806.1|1022774_1023767_+	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012226807.1|1023763_1025236_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	6.1e-12
WP_012226808.1|1025232_1026267_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012226809.1|1026263_1027151_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012226810.1|1027147_1027711_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_012553418.1|1027707_1028586_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_012226816.1|1028591_1029374_+	nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_012553419.1|1029370_1030138_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_012553420.1|1030152_1031604_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_043458689.1|1031657_1034054_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012553422.1|1034275_1035511_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_012553423.1|1035543_1038072_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	38.5	4.1e-16
WP_012553424.1|1038147_1039419_-	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_012553425.1|1039576_1040299_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	7.8e-29
WP_012553426.1|1040295_1043178_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012553427.1|1043177_1043909_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_144880564.1|1043926_1044736_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_144880565.1|1044768_1045659_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_012553430.1|1045690_1046413_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	6.2e-26
WP_012553431.1|1046399_1047053_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_012553432.1|1047049_1047709_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_012553433.1|1047705_1048551_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012553434.1|1048774_1048990_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_157864206.1|1049006_1050401_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_043459193.1|1050430_1051549_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012226850.1|1051545_1052493_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_012226852.1|1052497_1053139_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012226854.1|1053177_1054572_+	dihydropyrimidinase	NA	NA	NA	NA	NA
WP_157864088.1|1054742_1055800_-|transposase	IS630-like element ISGdi4 family transposase	transposase	NA	NA	NA	NA
WP_157864088.1|1056765_1057823_-|transposase	IS630-like element ISGdi4 family transposase	transposase	NA	NA	NA	NA
WP_012553437.1|1058282_1059107_-|transposase	IS5-like element ISGdi2 family transposase	transposase	NA	NA	NA	NA
WP_043458697.1|1059148_1059331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157864127.1|1059768_1060886_-|transposase	IS3-like element ISGdi11 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	2.9e-54
>prophage 4
NC_011365	Gluconacetobacter diazotrophicus PA1 5, complete sequence	3887492	1808299	1874829	3887492	transposase,tRNA	Bacillus_phage(11.11%)	54	NA	NA
WP_012222312.1|1808299_1808710_-|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_012222311.1|1808709_1808934_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012553886.1|1809187_1809859_+	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_012553887.1|1809855_1811679_+	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_012553888.1|1811671_1812610_+	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_012222307.1|1812618_1813275_+	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_012553889.1|1813274_1814315_+	type I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_012222305.1|1814318_1814609_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_043459250.1|1820209_1822075_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.0	1.2e-33
WP_012553891.1|1822298_1822985_+	endonuclease III	NA	NA	NA	NA	NA
WP_012222299.1|1822988_1825112_-	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_012222298.1|1825294_1826695_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012222297.1|1826691_1827657_+	aspartate carbamoyltransferase catalytic subunit	NA	M1I6M4	Paramecium_bursaria_Chlorella_virus	32.2	3.0e-28
WP_012553893.1|1827653_1828946_+	dihydroorotase	NA	NA	NA	NA	NA
WP_012553894.1|1828942_1829581_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_012553895.1|1829577_1830765_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	41.2	4.3e-24
WP_012553896.1|1830786_1833561_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	28.5	9.2e-78
WP_012222292.1|1833563_1835909_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.2	3.9e-53
WP_012553897.1|1835908_1837699_+	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	26.9	2.0e-09
WP_012553898.1|1837717_1838056_+	DUF1491 family protein	NA	NA	NA	NA	NA
WP_012222289.1|1838268_1839411_+	OmpA family protein	NA	NA	NA	NA	NA
WP_012222288.1|1839439_1840345_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144880369.1|1840393_1841368_-	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_041249210.1|1841528_1843496_+	FUSC family protein	NA	NA	NA	NA	NA
WP_012222285.1|1843516_1844809_-	MFS transporter	NA	NA	NA	NA	NA
WP_012222284.1|1845087_1845627_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_012222283.1|1845623_1846640_-	threonine-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_012222282.1|1846775_1848254_-	cobyric acid synthase	NA	NA	NA	NA	NA
WP_012222281.1|1848253_1848877_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_012222279.1|1849947_1850451_+	glycine zipper family protein	NA	NA	NA	NA	NA
WP_012553902.1|1851748_1852888_-|transposase	IS110-like element ISGdi7 family transposase	transposase	NA	NA	NA	NA
WP_157864168.1|1854835_1855054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012553903.1|1855107_1856451_+|transposase	IS1182-like element ISGdi13 family transposase	transposase	NA	NA	NA	NA
WP_012222260.1|1856528_1857365_-|transposase	IS5-like element ISGdi1 family transposase	transposase	NA	NA	NA	NA
WP_012553292.1|1858186_1859179_+|transposase	IS481-like element ISGdi9 family transposase	transposase	NA	NA	NA	NA
WP_144880567.1|1859247_1859496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012553904.1|1859655_1860141_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012553905.1|1860337_1860766_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_012553906.1|1860836_1861223_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_012553907.1|1861809_1862424_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012553908.1|1862497_1863481_+	oxidoreductase	NA	NA	NA	NA	NA
WP_012553909.1|1863890_1864526_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_012553910.1|1864760_1865531_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	36.9	1.6e-32
WP_012222646.1|1865686_1866745_-|transposase	IS481-like element ISGdi10 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	63.9	1.2e-126
WP_049762892.1|1866759_1867389_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_012553911.1|1867504_1867954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012553912.1|1867911_1868847_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012553913.1|1868850_1869726_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_012553914.1|1869768_1870746_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_012553915.1|1870897_1871842_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012553916.1|1872218_1872584_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_012553917.1|1872580_1873099_+	RES domain-containing protein	NA	NA	NA	NA	NA
WP_043458825.1|1873359_1873692_+	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_157864127.1|1873711_1874829_-|transposase	IS3-like element ISGdi11 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	2.9e-54
>prophage 5
NC_011365	Gluconacetobacter diazotrophicus PA1 5, complete sequence	3887492	1896917	1994595	3887492	integrase,transposase,tRNA	Leptospira_phage(17.65%)	81	1962289:1962310	1994662:1994683
WP_157864088.1|1896917_1897974_+|transposase	IS630-like element ISGdi4 family transposase	transposase	NA	NA	NA	NA
WP_144880580.1|1898383_1899322_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144880579.1|1899474_1900674_+	arabinose transporter	NA	NA	NA	NA	NA
WP_157864127.1|1900983_1902100_+|transposase	IS3-like element ISGdi11 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	2.9e-54
WP_081434714.1|1902123_1902363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012553061.1|1902443_1903214_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	36.9	2.1e-32
WP_157864088.1|1903277_1904335_-|transposase	IS630-like element ISGdi4 family transposase	transposase	NA	NA	NA	NA
WP_012222646.1|1905117_1906176_-|transposase	IS481-like element ISGdi10 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	63.9	1.2e-126
WP_157864170.1|1907207_1907591_+	SMEK domain-containing protein	NA	NA	NA	NA	NA
WP_157864088.1|1907587_1908645_-|transposase	IS630-like element ISGdi4 family transposase	transposase	NA	NA	NA	NA
WP_012222260.1|1908823_1909660_+|transposase	IS5-like element ISGdi1 family transposase	transposase	NA	NA	NA	NA
WP_012553139.1|1909798_1911049_-|transposase	IS701-like element ISGdi12 family transposase	transposase	NA	NA	NA	NA
WP_162013726.1|1911121_1911583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081434715.1|1911807_1913463_+	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_157864088.1|1913524_1914581_+|transposase	IS630-like element ISGdi4 family transposase	transposase	NA	NA	NA	NA
WP_012553949.1|1914839_1915265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012553950.1|1915270_1917253_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_012553951.1|1917410_1917701_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_012553952.1|1917693_1917942_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_012553953.1|1918038_1918902_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_169307523.1|1918977_1919649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012553139.1|1919626_1920877_+|transposase	IS701-like element ISGdi12 family transposase	transposase	NA	NA	NA	NA
WP_012553954.1|1921393_1922074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012553955.1|1922088_1922451_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_012553956.1|1922509_1924264_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_012222184.1|1924828_1925917_-|transposase	IS110-like element ISGdi15 family transposase	transposase	NA	NA	NA	NA
WP_012224920.1|1926595_1927078_-	DUF2840 domain-containing protein	NA	NA	NA	NA	NA
WP_041249340.1|1927160_1927733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012553958.1|1928132_1928402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041249339.1|1928478_1929111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012224911.1|1929684_1930764_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012553959.1|1931050_1931875_+|transposase	IS5-like element ISGdi2 family transposase	transposase	NA	NA	NA	NA
WP_012222646.1|1932239_1933298_+|transposase	IS481-like element ISGdi10 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	63.9	1.2e-126
WP_012223947.1|1933934_1934492_+	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_157864211.1|1934873_1936101_+|transposase	IS3-like element ISGdi14 family transposase	transposase	Q8W6R2	Burkholderia_virus	63.9	7.1e-99
WP_012223951.1|1936279_1936762_-	Hsp20 family protein	NA	M4QDX9	Cyanophage	37.2	2.0e-17
WP_012553437.1|1937084_1937909_+|transposase	IS5-like element ISGdi2 family transposase	transposase	NA	NA	NA	NA
WP_102324447.1|1937963_1938227_+	YXWGXW repeat-containing protein	NA	NA	NA	NA	NA
WP_010511782.1|1938747_1938996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010511780.1|1939104_1939368_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_012223960.1|1939360_1939705_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	48.4	5.9e-19
WP_012553962.1|1940467_1941664_-|transposase	IS256-like element ISGdi8 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	44.4	8.5e-89
WP_157864127.1|1941887_1943005_-|transposase	IS3-like element ISGdi11 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	2.9e-54
WP_012553963.1|1949023_1951627_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	35.8	1.4e-115
WP_012225064.1|1951819_1952338_-	heme-binding protein	NA	NA	NA	NA	NA
WP_012225063.1|1952344_1953409_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_012553964.1|1953513_1954410_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012553965.1|1954452_1955277_+|transposase	IS5-like element ISGdi2 family transposase	transposase	NA	NA	NA	NA
WP_012222257.1|1955340_1955565_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157864176.1|1955596_1956004_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_157864127.1|1956023_1957141_-|transposase	IS3-like element ISGdi11 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	2.9e-54
WP_012222259.1|1958714_1960271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012553966.1|1960820_1961933_+	Fic family protein	NA	NA	NA	NA	NA
1962289:1962310	attL	GGTTCGAGTCCCGCAGTTCGCA	NA	NA	NA	NA
WP_012553967.1|1962456_1963608_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_012222266.1|1963780_1964638_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_049763010.1|1964754_1966155_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	27.0	1.9e-23
WP_012222268.1|1966157_1966961_-	NAD kinase	NA	NA	NA	NA	NA
WP_012553969.1|1967010_1967862_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_012553970.1|1968215_1969211_+	cation transporter	NA	NA	NA	NA	NA
WP_012222271.1|1969197_1970094_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_012553971.1|1970124_1971123_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_012553972.1|1971195_1973022_+	biosynthetic-type acetolactate synthase large subunit	NA	G8DDL3	Micromonas_pusilla_virus	28.3	2.1e-46
WP_012222274.1|1973127_1973643_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_012222275.1|1973685_1974705_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_012223140.1|1974887_1976231_+|transposase	IS1182-like element ISGdi13 family transposase	transposase	NA	NA	NA	NA
WP_012553965.1|1976303_1977128_-|transposase	IS5-like element ISGdi2 family transposase	transposase	NA	NA	NA	NA
WP_081434717.1|1977753_1977963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144880566.1|1978003_1981561_-	helicase	NA	NA	NA	NA	NA
WP_157864212.1|1981927_1983289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012222260.1|1983625_1984462_+|transposase	IS5-like element ISGdi1 family transposase	transposase	NA	NA	NA	NA
WP_144880578.1|1984390_1985077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012553975.1|1985091_1985859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012553976.1|1985982_1986366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012553977.1|1986786_1987755_+	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_012226833.1|1987861_1989385_+|transposase	IS21-like element ISGdi17 family transposase	transposase	NA	NA	NA	NA
WP_012224987.1|1989374_1990154_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.3	7.9e-35
WP_012553978.1|1990455_1991280_+|transposase	IS5-like element ISGdi2 family transposase	transposase	NA	NA	NA	NA
WP_012553979.1|1991217_1991595_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	51.5	4.1e-21
WP_011253145.1|1991591_1991915_-|transposase	transposase	transposase	B6ETC4	Enterobacteria_phage	50.5	7.8e-21
WP_169307524.1|1991883_1992306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012224988.1|1992999_1994595_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U4JNS1	Bacillus_phage	29.9	2.1e-05
1994662:1994683	attR	TGCGAACTGCGGGACTCGAACC	NA	NA	NA	NA
>prophage 6
NC_011365	Gluconacetobacter diazotrophicus PA1 5, complete sequence	3887492	2651242	2697044	3887492	transposase	Burkholderia_virus(20.0%)	39	NA	NA
WP_012222260.1|2651242_2652079_+|transposase	IS5-like element ISGdi1 family transposase	transposase	NA	NA	NA	NA
WP_012554287.1|2652709_2653960_-	MFS transporter	NA	NA	NA	NA	NA
WP_012222621.1|2653997_2654918_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012554288.1|2655055_2655970_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_012222625.1|2655966_2656776_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_012554289.1|2656824_2657931_+	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_012222627.1|2658307_2659483_+	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_012222628.1|2659479_2659836_+	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_012222629.1|2659832_2661260_+	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_012554290.1|2661628_2663020_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_012554291.1|2663058_2664351_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.1	7.1e-57
WP_012222633.1|2664433_2664886_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012222634.1|2664904_2665462_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_012554292.1|2665458_2666856_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_012554293.1|2666863_2667964_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_012554294.1|2668055_2669252_+	phytanoyl-CoA dioxygenase family protein	NA	NA	NA	NA	NA
WP_012554295.1|2669259_2670096_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012222639.1|2670122_2671265_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_012554296.1|2671361_2672306_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_043459308.1|2672351_2673140_-	sugar ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.1	6.8e-10
WP_012554298.1|2673203_2674379_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012554299.1|2674544_2675402_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012554300.1|2675662_2677591_+	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_012222660.1|2679459_2680362_+	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_012554302.1|2680343_2681144_+	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_012554303.1|2681178_2682672_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_012554304.1|2682717_2683731_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_012222669.1|2683785_2684316_-	RcnB family protein	NA	NA	NA	NA	NA
WP_012222184.1|2684596_2685685_+|transposase	IS110-like element ISGdi15 family transposase	transposase	NA	NA	NA	NA
WP_012554305.1|2686889_2687882_-|transposase	IS481-like element ISGdi9 family transposase	transposase	NA	NA	NA	NA
WP_012554306.1|2688369_2689218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012222673.1|2689329_2689620_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_012554307.1|2689609_2689909_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_012222646.1|2690617_2691676_+|transposase	IS481-like element ISGdi10 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	63.9	1.2e-126
WP_012554308.1|2691995_2692178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144880585.1|2692562_2692859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144880586.1|2692869_2693211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157864127.1|2693608_2694726_-|transposase	IS3-like element ISGdi11 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	2.9e-54
WP_012554312.1|2695817_2697044_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.8	1.8e-41
>prophage 7
NC_011365	Gluconacetobacter diazotrophicus PA1 5, complete sequence	3887492	2741920	2748620	3887492		Bordetella_phage(16.67%)	10	NA	NA
WP_012554362.1|2741920_2743324_+	S-antigen family protein	NA	Q775A9	Bordetella_phage	67.5	3.3e-07
WP_012554363.1|2743391_2744510_+	hypothetical protein	NA	Q9MC69	Pseudomonas_phage	41.8	7.6e-07
WP_012554364.1|2744585_2744885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157864188.1|2744881_2745160_+	hypothetical protein	NA	A0A2I7QVW8	Vibrio_phage	55.6	1.4e-05
WP_012554365.1|2745156_2745369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012554366.1|2745365_2746250_+	hypothetical protein	NA	A0A0R8VB90	Thermobifida_phage	30.4	9.5e-29
WP_012554367.1|2746246_2747281_+	AAA family ATPase	NA	A0A141GF08	Brucella_phage	43.0	4.8e-40
WP_012554368.1|2747277_2747538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012554369.1|2747534_2747765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043459339.1|2747864_2748620_+	phage Gp37/Gp68 family protein	NA	M4R142	Tetraselmis_viridis_virus	58.7	1.3e-74
>prophage 8
NC_011365	Gluconacetobacter diazotrophicus PA1 5, complete sequence	3887492	2794638	2855515	3887492	protease,tRNA,terminase,tail,transposase	Bacillus_virus(15.38%)	54	NA	NA
WP_012554401.1|2794638_2795061_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_012228349.1|2795097_2795262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012554402.1|2795353_2796223_-|protease	protease	protease	NA	NA	NA	NA
WP_012228352.1|2796554_2796830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012554404.1|2796834_2799351_+	topoisomerase	NA	Q9JMN6	Wolbachia_phage	38.5	3.7e-09
WP_012554405.1|2799643_2802568_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	30.0	6.2e-16
WP_043458964.1|2802731_2803889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144880236.1|2804300_2804795_+|terminase	terminase small subunit	terminase	I6NV32	Burkholderia_virus	42.5	3.7e-14
WP_012554408.1|2804875_2805100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012228361.1|2805125_2806619_+	hypothetical protein	NA	A0A1B1IVN4	uncultured_Mediterranean_phage	41.9	7.1e-101
WP_012554409.1|2806620_2806866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012554410.1|2806862_2808986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144880235.1|2808957_2809137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012554412.1|2809136_2809550_+	co-chaperone GroES	NA	NA	NA	NA	NA
WP_012554415.1|2811097_2811694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012228365.1|2811706_2812615_+	hypothetical protein	NA	A0A218MME7	uncultured_virus	40.5	2.0e-58
WP_043458967.1|2812679_2812907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012228367.1|2812971_2813388_+	hypothetical protein	NA	A0A218MLF9	uncultured_virus	37.0	2.7e-10
WP_012554417.1|2813398_2813875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012228369.1|2813871_2815758_+	hypothetical protein	NA	A0A0E3M2T0	Rhodoferax_phage	40.9	1.7e-06
WP_012554418.1|2815764_2819397_+	hypothetical protein	NA	A0A2I7RQ21	Vibrio_phage	35.9	4.6e-61
WP_012554419.1|2819396_2820032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012554420.1|2820031_2820490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043458969.1|2820474_2821488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012554422.1|2821594_2823127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144880228.1|2823167_2823623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012228379.1|2823619_2824096_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012554424.1|2824092_2824809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012228384.1|2824857_2825607_-	YfdX family protein	NA	NA	NA	NA	NA
WP_144880234.1|2825963_2826806_+|tail	tail fiber protein	tail	V5YTB8	Pseudomonas_phage	65.6	1.7e-22
WP_012228387.1|2826802_2827276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012554426.1|2827275_2827758_+	hypothetical protein	NA	A0A2I7S7C4	Vibrio_phage	35.4	1.4e-10
WP_012554427.1|2827980_2828760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144880233.1|2829005_2829770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012228391.1|2829708_2830551_-	DUF3667 domain-containing protein	NA	NA	NA	NA	NA
WP_012228393.1|2830762_2831251_+	bacterioferritin	NA	NA	NA	NA	NA
WP_012554429.1|2831304_2831991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012554430.1|2832263_2833241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012554431.1|2833312_2834596_-	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.5	3.1e-44
WP_012554432.1|2834923_2835961_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_162013727.1|2835953_2836388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012222260.1|2836356_2837193_+|transposase	IS5-like element ISGdi1 family transposase	transposase	NA	NA	NA	NA
WP_157864190.1|2837189_2837480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012554433.1|2837804_2838917_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_012554434.1|2839010_2843108_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	32.7	8.7e-16
WP_012222260.1|2843183_2844020_+|transposase	IS5-like element ISGdi1 family transposase	transposase	NA	NA	NA	NA
WP_012228417.1|2844313_2844634_-	DUF3325 family protein	NA	NA	NA	NA	NA
WP_012228418.1|2844609_2846040_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_012554436.1|2846060_2846333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012554437.1|2846340_2848734_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_012554438.1|2849275_2851933_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	39.2	5.1e-17
WP_012554439.1|2852129_2852348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012228430.1|2852353_2852728_-	VOC family protein	NA	NA	NA	NA	NA
WP_157864192.1|2854458_2855515_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NC_011365	Gluconacetobacter diazotrophicus PA1 5, complete sequence	3887492	2921265	3037290	3887492	integrase,transposase	Leptospira_phage(11.11%)	111	3026065:3026080	3045750:3045765
WP_157864127.1|2921265_2922382_+|transposase	IS3-like element ISGdi11 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	2.9e-54
WP_012228537.1|2922637_2924953_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_012228546.1|2925138_2925600_+	DNA mismatch endonuclease Vsr	NA	E5E3X5	Burkholderia_phage	49.3	3.1e-31
WP_012223140.1|2926026_2927370_+|transposase	IS1182-like element ISGdi13 family transposase	transposase	NA	NA	NA	NA
WP_012222260.1|2927673_2928510_+|transposase	IS5-like element ISGdi1 family transposase	transposase	NA	NA	NA	NA
WP_012228554.1|2928674_2929103_-	DUF1810 domain-containing protein	NA	A0A2H4UVK5	Bodo_saltans_virus	37.1	1.5e-11
WP_012228561.1|2929172_2930075_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012228563.1|2930257_2931031_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012554485.1|2931161_2932508_+	amino acid permease	NA	NA	NA	NA	NA
WP_012228567.1|2932484_2933315_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_012228569.1|2933357_2933936_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012554486.1|2933974_2935999_-	AsmA family protein	NA	NA	NA	NA	NA
WP_043459369.1|2936009_2938532_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_012228575.1|2938884_2939793_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_012554488.1|2939823_2940006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012228581.1|2940288_2940969_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144880527.1|2941152_2942754_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_012228583.1|2942929_2943343_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_012228584.1|2943520_2943847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043458994.1|2943840_2944221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012554491.1|2944322_2944505_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_012554492.1|2944522_2944918_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	44.1	6.6e-22
WP_012226833.1|2945993_2947517_+|transposase	IS21-like element ISGdi17 family transposase	transposase	NA	NA	NA	NA
WP_012222757.1|2947506_2948286_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.3	7.9e-35
WP_012554494.1|2948550_2948760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012228610.1|2949032_2949239_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	50.0	2.7e-11
WP_012554495.1|2949620_2949773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144880568.1|2950213_2952793_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_043458995.1|2952843_2953911_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_043459373.1|2953933_2954818_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_157864217.1|2954867_2955650_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	31.4	2.6e-22
WP_012228615.1|2955675_2956371_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_012228616.1|2956395_2957115_+	phosphate regulon transcriptional regulator PhoB	NA	A0A220YL79	Alteromonas_virus	31.8	4.3e-11
WP_012228617.1|2957152_2958361_+	histidine kinase	NA	W8CYF6	Bacillus_phage	25.5	1.2e-18
WP_012228618.1|2958524_2959529_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A222YW41	Synechococcus_phage	36.8	3.0e-39
WP_012554501.1|2960048_2961806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012554502.1|2962015_2963371_+	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_012228623.1|2963428_2963707_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_012228624.1|2963723_2964005_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_012553437.1|2964140_2964965_+|transposase	IS5-like element ISGdi2 family transposase	transposase	NA	NA	NA	NA
WP_012228625.1|2964981_2965707_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	6.0e-29
WP_012554504.1|2965703_2967257_-	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_012228627.1|2967482_2968223_+	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_012228628.1|2968230_2968659_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_144880426.1|2968655_2969264_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_012228630.1|2969459_2970422_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_012228631.1|2970432_2971248_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_012228632.1|2971347_2971608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012228633.1|2971664_2972141_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_012228634.1|2972262_2972961_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_081434740.1|2972962_2974288_-	erythromycin esterase family protein	NA	NA	NA	NA	NA
WP_012554507.1|2974561_2975548_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_162013729.1|2975556_2977620_+	ABC transporter permease	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	1.3e-15
WP_157864194.1|2977914_2979102_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_012223140.1|2981134_2982478_+|transposase	IS1182-like element ISGdi13 family transposase	transposase	NA	NA	NA	NA
WP_012553437.1|2982576_2983401_+|transposase	IS5-like element ISGdi2 family transposase	transposase	NA	NA	NA	NA
WP_012554510.1|2983524_2983812_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_012554511.1|2983808_2985176_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_012554512.1|2985279_2987133_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_012554513.1|2987637_2990811_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.8	2.4e-53
WP_012554514.1|2990810_2991992_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012228649.1|2991988_2993584_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_012554515.1|2993647_2994550_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012554517.1|2994936_2995929_-|transposase	IS481-like element ISGdi9 family transposase	transposase	NA	NA	NA	NA
WP_012228657.1|2996185_2996491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012554518.1|2996487_2997141_-	AAA family ATPase	NA	D4HTX7	Vibrio_phage	30.9	6.2e-17
WP_012554519.1|2997279_2998225_-|transposase	IS630-like element ISGdi6 family transposase	transposase	A0A1V0SCG6	Indivirus	26.2	8.1e-10
WP_012554521.1|2999103_2999400_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_144880588.1|2999548_2999917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012222260.1|2999992_3000829_-|transposase	IS5-like element ISGdi1 family transposase	transposase	NA	NA	NA	NA
WP_012553437.1|3000947_3001772_+|transposase	IS5-like element ISGdi2 family transposase	transposase	NA	NA	NA	NA
WP_157864088.1|3001807_3002865_-|transposase	IS630-like element ISGdi4 family transposase	transposase	NA	NA	NA	NA
WP_012223140.1|3003024_3004368_+|transposase	IS1182-like element ISGdi13 family transposase	transposase	NA	NA	NA	NA
WP_012553139.1|3004541_3005792_-|transposase	IS701-like element ISGdi12 family transposase	transposase	NA	NA	NA	NA
WP_012554522.1|3005959_3006400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144880583.1|3006358_3007021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144880582.1|3007330_3007513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081434743.1|3007664_3007847_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157864088.1|3007962_3009019_+|transposase	IS630-like element ISGdi4 family transposase	transposase	NA	NA	NA	NA
WP_081434744.1|3008993_3009668_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012554524.1|3010104_3010818_+	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_012554525.1|3010831_3011860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157864195.1|3012426_3013483_+|transposase	IS630-like element ISGdi4 family transposase	transposase	NA	NA	NA	NA
WP_012222260.1|3013523_3014360_-|transposase	IS5-like element ISGdi1 family transposase	transposase	NA	NA	NA	NA
WP_157864196.1|3014523_3014739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012222646.1|3015409_3016468_-|transposase	IS481-like element ISGdi10 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	63.9	1.2e-126
WP_012554528.1|3016587_3017304_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	64.8	1.3e-87
WP_012553962.1|3017639_3018836_+|transposase	IS256-like element ISGdi8 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	44.4	8.5e-89
WP_012228320.1|3018960_3020382_+	adenylosuccinate lyase family protein	NA	NA	NA	NA	NA
WP_012228319.1|3022193_3022898_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_012554529.1|3023076_3023541_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_012228317.1|3023693_3024317_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_012554530.1|3024313_3025063_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012228315.1|3025169_3025466_+	pentapeptide MXKDX repeat protein	NA	NA	NA	NA	NA
WP_012228314.1|3025719_3026601_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
3026065:3026080	attL	GATGCCGCCAGCGCGC	NA	NA	NA	NA
WP_043459385.1|3026678_3028199_+	amidase	NA	NA	NA	NA	NA
WP_012554532.1|3028217_3028661_-	GFA family protein	NA	NA	NA	NA	NA
WP_012554533.1|3028685_3029129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144880311.1|3029210_3029912_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_012228205.1|3030400_3030724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012554535.1|3030780_3031248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081434746.1|3031513_3032641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043459001.1|3032633_3032867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012228196.1|3032919_3033111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012554539.1|3033447_3033585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012554540.1|3033599_3034319_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_012228188.1|3034412_3034652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012554541.1|3034679_3034958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012228183.1|3035089_3035395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012554542.1|3035513_3035681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012554543.1|3035931_3037290_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	NA	NA	NA	NA
3045750:3045765	attR	GCGCGCTGGCGGCATC	NA	NA	NA	NA
