The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_011660	Listeria monocytogenes HCC23, complete sequence	2976212	116605	124433	2976212		Streptococcus_phage(50.0%)	7	NA	NA
WP_003739737.1|116605_117565_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	54.1	1.5e-88
WP_003729208.1|117682_118666_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	1.8e-52
WP_012580769.1|118681_119743_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_012580770.1|119770_121501_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.5	1.1e-174
WP_003729205.1|121608_122484_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	1.9e-08
WP_012580771.1|122485_123454_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	42.9	8.8e-68
WP_003722604.1|123461_124433_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
>prophage 2
NC_011660	Listeria monocytogenes HCC23, complete sequence	2976212	799030	807316	2976212		Prochlorococcus_phage(33.33%)	8	NA	NA
WP_003729814.1|799030_800323_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	2.5e-17
WP_012581147.1|800403_801117_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	38.3	6.1e-42
WP_003722248.1|801128_801374_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_012581148.1|801377_802061_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_012581149.1|802053_804273_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.2	2.6e-160
WP_003722245.1|804257_805685_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
WP_012581150.1|805703_806753_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.1	3.2e-63
WP_012581151.1|806749_807316_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	39.1	1.7e-26
>prophage 3
NC_011660	Listeria monocytogenes HCC23, complete sequence	2976212	1351756	1399268	2976212	protease,holin,plate,tail	Listeria_phage(71.43%)	55	NA	NA
WP_003723886.1|1351756_1353016_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
WP_003730674.1|1353200_1354484_-	trigger factor	NA	NA	NA	NA	NA
WP_012581416.1|1354599_1355538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014589059.1|1356066_1356282_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003730316.1|1356432_1356828_+	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.7e-14
WP_012581417.1|1356909_1358049_+|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003736436.1|1358196_1359027_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	1.2e-46
WP_012581418.1|1359010_1360258_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	52.3	5.5e-107
WP_012581419.1|1360282_1361197_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003726717.1|1361385_1361850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012581420.1|1361888_1362350_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003727531.1|1362467_1363952_+	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_012581421.1|1363970_1365617_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_003736429.1|1365647_1366361_-	trehalose operon repressor	NA	NA	NA	NA	NA
WP_003723553.1|1366511_1366649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003730323.1|1366979_1367828_+	YitT family protein	NA	NA	NA	NA	NA
WP_003726053.1|1367894_1368089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003726052.1|1368128_1368788_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_012581422.1|1368992_1370198_+	MFS transporter	NA	NA	NA	NA	NA
WP_003730327.1|1370194_1370440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012581423.1|1370476_1370953_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_003730329.1|1371118_1371382_-	DUF3116 family protein	NA	NA	NA	NA	NA
WP_012581424.1|1371406_1372819_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.1	2.2e-51
WP_003723543.1|1372942_1373203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003723542.1|1373235_1373835_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	40.5	2.9e-29
WP_012581425.1|1373999_1374407_+	VOC family protein	NA	NA	NA	NA	NA
WP_003723540.1|1374543_1375137_+	YdeI family protein	NA	NA	NA	NA	NA
WP_012581426.1|1375178_1376537_-	DUF1254 domain-containing protein	NA	NA	NA	NA	NA
WP_012581427.1|1376659_1380349_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_012581428.1|1381016_1381379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014589058.1|1381593_1382049_-	SUKH-3 domain-containing protein	NA	NA	NA	NA	NA
WP_012581430.1|1382117_1382486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003736407.1|1382992_1383235_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003736406.1|1383237_1383657_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_014589057.1|1383969_1385643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012581432.1|1385685_1386096_-	Cys-Gln thioester bond-forming surface protein	NA	NA	NA	NA	NA
WP_012581433.1|1386548_1386989_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_012581435.1|1387862_1388072_+	hypothetical protein	NA	A0A059T7Z0	Listeria_phage	95.7	8.0e-27
WP_012581436.1|1388177_1388555_+	anti-CRISPR protein AcrIIA3	NA	Q9T194	Listeria_phage	99.2	1.3e-67
WP_012581437.1|1388586_1388937_+	AcrIIA2 family anti-CRISPR protein	NA	Q9T195	Listeria_phage	98.3	1.2e-56
WP_012581438.1|1388941_1389391_+	anti-CRISPR protein AcrIIA1	NA	Q9T196	Listeria_phage	97.3	3.8e-74
WP_012581439.1|1389461_1390031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041176506.1|1390023_1390353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012581441.1|1390345_1390612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012581442.1|1390991_1391822_-	M15 family metallopeptidase	NA	A8ATB8	Listeria_phage	89.1	2.3e-149
WP_012581443.1|1391821_1392070_-|holin	phage holin	holin	A8ATB7	Listeria_phage	100.0	1.4e-38
WP_012581444.1|1392082_1392478_-	hypothetical protein	NA	A8ATB6	Listeria_phage	100.0	2.4e-64
WP_012581445.1|1392444_1392900_-	hypothetical protein	NA	A8ATB5	Listeria_phage	100.0	1.2e-67
WP_012581446.1|1392925_1393072_-	XkdX family protein	NA	A0A059T6D9	Listeria_phage	100.0	1.1e-19
WP_012581447.1|1393072_1393393_-	hypothetical protein	NA	A8ATB3	Listeria_phage	81.1	5.5e-27
WP_012581448.1|1393409_1394681_-|plate	BppU family phage baseplate upper protein	plate	A8ATB2	Listeria_phage	95.8	2.4e-214
WP_012581449.1|1394692_1396612_-	hypothetical protein	NA	A8ATB1	Listeria_phage	99.8	0.0e+00
WP_012581450.1|1396611_1396836_-	hypothetical protein	NA	A8ATB0	Listeria_phage	100.0	1.5e-34
WP_012581451.1|1396835_1398428_-|tail	phage tail protein	tail	A8ATA9	Listeria_phage	100.0	1.2e-303
WP_012581452.1|1398437_1399268_-|tail	phage tail family protein	tail	A8ATA8	Listeria_phage	100.0	1.7e-157
>prophage 4
NC_011660	Listeria monocytogenes HCC23, complete sequence	2976212	1404200	1431218	2976212	integrase,tail,terminase,portal,protease,capsid	Listeria_phage(95.12%)	45	1427594:1427609	1432676:1432691
WP_014589052.1|1404200_1404383_-	hypothetical protein	NA	A8ATA6	Listeria_phage	100.0	2.8e-20
WP_009917698.1|1404400_1404733_-	hypothetical protein	NA	A8ATA5	Listeria_phage	99.1	1.8e-52
WP_012581455.1|1404803_1405391_-|tail	phage tail protein	tail	A8ATA4	Listeria_phage	100.0	4.0e-108
WP_012581456.1|1405412_1405796_-	hypothetical protein	NA	A8ATA3	Listeria_phage	100.0	3.8e-67
WP_003731643.1|1405792_1406194_-	hypothetical protein	NA	A8ATA2	Listeria_phage	100.0	2.1e-68
WP_003731644.1|1406190_1406556_-	hypothetical protein	NA	A8ATA1	Listeria_phage	100.0	1.3e-64
WP_003731645.1|1406539_1406839_-	hypothetical protein	NA	A8ATA0	Listeria_phage	100.0	5.3e-48
WP_012581457.1|1406848_1407019_-	hypothetical protein	NA	A8AT99	Listeria_phage	92.9	1.2e-20
WP_012581458.1|1407025_1408177_-|capsid	phage major capsid protein	capsid	A8AT98	Listeria_phage	98.7	4.1e-213
WP_012581459.1|1408203_1408920_-|protease	Clp protease ClpP	protease	A0A1S5SFF8	Streptococcus_phage	57.0	1.0e-65
WP_012581460.1|1408916_1410047_-|portal	phage portal protein	portal	A8AT96	Listeria_phage	92.8	9.8e-204
WP_012581461.1|1410058_1411699_-|terminase	terminase large subunit	terminase	A0A059T7Q8	Listeria_phage	76.2	2.7e-250
WP_012581462.1|1411695_1411995_-|terminase	P27 family phage terminase small subunit	terminase	A8AT94	Listeria_phage	83.8	5.8e-39
WP_012581463.1|1412100_1412415_-	HNH endonuclease	NA	A8ATF8	Listeria_phage	98.1	8.5e-57
WP_010991275.1|1412889_1413633_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_009917712.1|1413730_1414156_-	DUF722 domain-containing protein	NA	A0A059T6H4	Listeria_phage	100.0	8.0e-74
WP_012581464.1|1414156_1414690_-	DUF3310 domain-containing protein	NA	A8ATF5	Listeria_phage	80.6	8.7e-78
WP_003731659.1|1415279_1415492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012581465.1|1415493_1415811_-	VRR-NUC domain-containing protein	NA	A8ATF4	Listeria_phage	94.2	2.1e-50
WP_012581466.1|1416144_1418433_-	primase	NA	A8ATF3	Listeria_phage	91.3	0.0e+00
WP_012581467.1|1418455_1418941_-	DUF669 domain-containing protein	NA	R4ICE5	Listeria_phage	96.3	5.1e-85
WP_014589050.1|1418963_1420220_-	DEAD/DEAH box helicase	NA	R4IBK4	Listeria_phage	95.0	4.9e-220
WP_010991282.1|1420283_1420973_-	AAA family ATPase	NA	R4IDY8	Listeria_phage	100.0	1.2e-130
WP_012581469.1|1420992_1421472_-	siphovirus Gp157 family protein	NA	R4IBM0	Listeria_phage	96.9	7.4e-76
WP_012581470.1|1421473_1421857_-	hypothetical protein	NA	A8ATE8	Listeria_phage	98.4	1.6e-65
WP_012581471.1|1421853_1422027_-	hypothetical protein	NA	A0A059T5G3	Listeria_phage	96.5	3.4e-23
WP_012581472.1|1422023_1422203_-	hypothetical protein	NA	A8ATE3	Listeria_phage	100.0	5.8e-26
WP_003769971.1|1422199_1422490_-	hypothetical protein	NA	Q8W5X0	Listeria_phage	88.5	2.2e-43
WP_003727764.1|1422486_1422672_-	hypothetical protein	NA	A0A059T5G1	Listeria_phage	100.0	4.1e-27
WP_012581473.1|1422668_1423124_-	pentapeptide repeat-containing protein	NA	A0A060AFJ6	Listeria_phage	85.9	6.2e-40
WP_012581474.1|1423120_1423309_-	hypothetical protein	NA	D7RWG4	Brochothrix_phage	45.0	8.8e-09
WP_012581475.1|1423308_1423479_-	hypothetical protein	NA	A0A059T7N2	Listeria_phage	94.4	6.7e-24
WP_012581476.1|1423479_1423878_-	hypothetical protein	NA	A0A0B5CYR4	Listeria_phage	56.4	6.8e-35
WP_012581477.1|1423894_1424188_-	hypothetical protein	NA	A8ATM4	Listeria_phage	78.4	8.9e-32
WP_010991288.1|1424184_1424373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012581481.1|1426350_1426638_-	hypothetical protein	NA	A0A059T7V3	Listeria_phage	94.7	1.2e-44
WP_009929542.1|1426775_1426928_-	hypothetical protein	NA	A8ATD4	Listeria_phage	100.0	1.5e-19
WP_003730997.1|1427162_1427348_-	hypothetical protein	NA	A8ATD3	Listeria_phage	98.4	3.7e-28
WP_003730996.1|1427350_1427593_-	hypothetical protein	NA	A8ATD2	Listeria_phage	93.8	3.9e-41
1427594:1427609	attL	TTTCTTATTCTCCTTT	NA	NA	NA	NA
WP_012581482.1|1427614_1427806_-	helix-turn-helix transcriptional regulator	NA	Q8W5X9	Listeria_phage	86.9	4.6e-21
WP_003730994.1|1427872_1428076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012581483.1|1428474_1428798_+	helix-turn-helix transcriptional regulator	NA	A0A059T6G1	Listeria_phage	71.0	8.5e-36
WP_012581484.1|1428814_1429267_+	ImmA/IrrE family metallo-endopeptidase	NA	R4IBK9	Listeria_phage	90.0	8.2e-77
WP_003730990.1|1429317_1429932_+	hypothetical protein	NA	A0A059T7Z1	Listeria_phage	77.0	7.7e-78
WP_012581485.1|1430063_1431218_+|integrase	site-specific integrase	integrase	Q8W5Y3	Listeria_phage	94.8	6.7e-208
1432676:1432691	attR	TTTCTTATTCTCCTTT	NA	NA	NA	NA
>prophage 5
NC_011660	Listeria monocytogenes HCC23, complete sequence	2976212	2543216	2583809	2976212	holin,tail,integrase,terminase,portal,protease,capsid	Listeria_phage(89.13%)	60	2544289:2544333	2582691:2582735
WP_003728958.1|2543216_2543720_+	TM2 domain-containing protein	NA	A0A060AN66	Enterococcus_phage	42.9	6.9e-08
WP_041176476.1|2543755_2544082_-	hypothetical protein	NA	NA	NA	NA	NA
2544289:2544333	attL	TATGGGTTGTGAGGGTTTCGAACCCCCGACCCGCTGATTAAGAGT	NA	NA	NA	NA
WP_012582155.1|2544661_2544865_+	hypothetical protein	NA	A8ATJ3	Listeria_phage	77.3	2.0e-22
WP_012582156.1|2544896_2545085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012582157.1|2545309_2545573_+	AcrIIA4 family anti-CRISPR protein	NA	A0A2D0TCG7	unidentified_phage	81.6	4.2e-33
WP_014588984.1|2545621_2546041_-	hypothetical protein	NA	A0A0B5CTT3	Listeria_phage	47.9	1.2e-29
WP_012582158.1|2546064_2546991_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	R4ICC5	Listeria_phage	86.0	1.0e-158
WP_012582159.1|2546993_2547227_-	hypothetical protein	NA	R4IBI3	Listeria_phage	88.3	7.8e-31
WP_014588983.1|2547226_2547481_-|holin	phage holin	holin	Q8W5Y9	Listeria_phage	90.4	5.1e-36
WP_003768869.1|2547490_2547901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014588982.1|2547902_2548124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012582161.1|2548153_2548315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003768842.1|2548311_2548611_-	hypothetical protein	NA	A0A1S7FZ19	Listeria_phage	56.3	1.4e-24
WP_012582162.1|2548610_2549381_-	hypothetical protein	NA	A0A1S7FZ03	Listeria_phage	74.2	4.9e-114
WP_012582163.1|2549383_2550409_-	hypothetical protein	NA	A0A1S7FZ49	Listeria_phage	78.0	2.5e-158
WP_012582164.1|2550408_2551317_-	hypothetical protein	NA	A0A1S7FZ36	Listeria_phage	80.3	8.3e-137
WP_012582165.1|2551313_2555708_-|tail	phage tail tape measure protein	tail	A0A1S7FYZ4	Listeria_phage	69.7	0.0e+00
WP_012582166.1|2555887_2556259_-	hypothetical protein	NA	A0A1S7FZ84	Listeria_phage	69.9	5.7e-44
WP_012582167.1|2556321_2556573_-	plasmid partitioning protein	NA	NA	NA	NA	NA
WP_012582168.1|2556583_2557171_-	hypothetical protein	NA	A0A1S7FZ79	Listeria_phage	73.8	9.3e-81
WP_012582169.1|2557186_2557612_-	hypothetical protein	NA	A0A1S7FZ20	Listeria_phage	82.1	3.6e-58
WP_041176475.1|2557598_2558000_-	hypothetical protein	NA	A0A1S7FYZ7	Listeria_phage	66.4	2.8e-44
WP_094153171.1|2558001_2558208_-	hypothetical protein	NA	A0A1S7FZ08	Listeria_phage	79.1	2.8e-24
WP_012582170.1|2558317_2558614_-	hypothetical protein	NA	A0A1S7FYY9	Listeria_phage	68.4	3.4e-31
WP_012582171.1|2558751_2559897_-|capsid	phage major capsid protein	capsid	A0A1S7FZ31	Listeria_phage	86.3	9.4e-186
WP_012582172.1|2559930_2560761_-|protease	Clp protease ClpP	protease	A0A1S7FZ23	Listeria_phage	71.4	2.5e-103
WP_012582173.1|2560757_2561966_-|portal	phage portal protein	portal	A0A1S7FYX7	Listeria_phage	84.9	1.7e-193
WP_012582174.1|2561977_2563624_-|terminase	terminase large subunit	terminase	A0A1S7FZ68	Listeria_phage	87.4	1.4e-291
WP_003768814.1|2563610_2563964_-|terminase	P27 family phage terminase small subunit	terminase	A0A1S7FYW6	Listeria_phage	80.3	1.7e-45
WP_041176474.1|2564086_2564395_-	HNH endonuclease	NA	A0A1S7FZ53	Listeria_phage	85.3	2.5e-45
WP_041176473.1|2564395_2564728_-	hypothetical protein	NA	A0A060AG27	Listeria_phage	65.8	2.5e-38
WP_012582175.1|2564865_2565408_-	hypothetical protein	NA	A0A1S7FZ07	Listeria_phage	71.6	1.8e-62
WP_012582176.1|2565407_2565773_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A1S7FYY8	Listeria_phage	58.7	1.0e-29
WP_012582177.1|2565756_2567148_-	DEAD/DEAH box helicase	NA	A0A1S7FYY5	Listeria_phage	80.2	2.8e-216
WP_012582178.1|2567147_2567426_-	VRR-NUC domain-containing protein	NA	A0A1S7FZ22	Listeria_phage	74.2	6.0e-30
WP_012582179.1|2567731_2570170_-	virulence-associated E family protein	NA	A0A1S7FZ15	Listeria_phage	85.4	0.0e+00
WP_012582180.1|2570203_2570386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012582182.1|2570602_2571037_-	hypothetical protein	NA	A8ATD9	Listeria_phage	56.3	7.0e-33
WP_041176601.1|2571033_2571201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012582184.1|2571398_2571770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012582185.1|2571770_2572040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012582186.1|2572039_2572426_-	hypothetical protein	NA	M1PLH5	Streptococcus_phage	32.8	2.4e-08
WP_041196750.1|2572422_2572620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012582188.1|2572871_2573096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012582189.1|2573108_2574746_-	DNA polymerase	NA	A0A1S7FZ18	Listeria_phage	80.2	5.3e-259
WP_012582190.1|2575039_2575621_-	DUF2815 family protein	NA	A0A1S7FZ05	Listeria_phage	73.1	2.7e-64
WP_012582191.1|2575704_2576886_-	DUF2800 domain-containing protein	NA	A0A1S7FYX0	Listeria_phage	75.6	1.1e-173
WP_012582192.1|2576887_2577640_-	hypothetical protein	NA	A0A1S7FZ47	Listeria_phage	34.3	1.1e-09
WP_012582193.1|2577636_2577852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012582194.1|2577848_2578079_-	hypothetical protein	NA	A0A1S7FYX1	Listeria_phage	57.9	1.7e-14
WP_014588976.1|2578071_2578410_-	DUF3310 domain-containing protein	NA	E2GLY2	Acinetobacter_phage	52.0	5.6e-14
WP_012582196.1|2578427_2578685_-	hypothetical protein	NA	Q8W5X5	Listeria_phage	87.7	3.9e-31
WP_012582197.1|2578690_2578957_-	hypothetical protein	NA	A0A1S7FYW4	Listeria_phage	74.4	1.5e-25
WP_012582198.1|2579223_2579409_-	helix-turn-helix domain-containing protein	NA	A0A1S7FYV9	Listeria_phage	71.9	1.0e-17
WP_012582199.1|2579409_2579613_-	helix-turn-helix domain-containing protein	NA	A0A1S7FZ40	Listeria_phage	68.8	5.6e-17
WP_012582200.1|2579884_2580220_+	helix-turn-helix transcriptional regulator	NA	A0A1S7FZ25	Listeria_phage	64.2	2.0e-32
WP_014588975.1|2580243_2580756_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1S7FYX8	Listeria_phage	73.2	1.5e-66
WP_012582201.1|2580775_2581324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012582202.1|2581406_2582585_+|integrase	site-specific integrase	integrase	A0A0B5CTW8	Listeria_phage	55.3	6.2e-116
WP_012582203.1|2582852_2583809_-	NAD(P)-binding domain-containing protein	NA	M1H502	Paramecium_bursaria_Chlorella_virus	29.9	6.5e-31
2582691:2582735	attR	TATGGGTTGTGAGGGTTTCGAACCCCCGACCCGCTGATTAAGAGT	NA	NA	NA	NA
>prophage 6
NC_011660	Listeria monocytogenes HCC23, complete sequence	2976212	2919585	2967797	2976212	integrase,tail,holin,tRNA,terminase,portal,capsid,plate	Listeria_phage(90.32%)	73	2918452:2918466	2926923:2926937
2918452:2918466	attL	CGATACATTTTGTAT	NA	NA	NA	NA
WP_003727701.1|2919585_2920452_+	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.5	1.5e-10
WP_003728530.1|2920454_2921252_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_012582370.1|2921257_2922004_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_003727703.1|2922198_2922636_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_003726075.1|2922657_2923050_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_012582371.1|2923135_2924329_-|integrase	site-specific integrase	integrase	A0A0B5CTZ4	Listeria_phage	100.0	2.2e-217
WP_003770015.1|2924396_2925272_-	hypothetical protein	NA	A0A0B5D0D1	Listeria_phage	94.5	2.2e-150
WP_012582372.1|2925333_2925939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012582373.1|2925993_2926161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012582374.1|2926316_2926793_-	helix-turn-helix transcriptional regulator	NA	A8ASM2	Listeria_phage	78.9	2.2e-56
WP_012582375.1|2926954_2927188_+	helix-turn-helix transcriptional regulator	NA	A8ASM3	Listeria_phage	95.9	1.6e-31
2926923:2926937	attR	ATACAAAATGTATCG	NA	NA	NA	NA
WP_003727743.1|2927208_2927475_+	hypothetical protein	NA	A0A059T7Q1	Listeria_phage	100.0	2.5e-41
WP_003735007.1|2927698_2927893_+	hypothetical protein	NA	A0A059T6E5	Listeria_phage	100.0	1.3e-26
WP_012582376.1|2927904_2928186_+	hypothetical protein	NA	A0A0B5D168	Listeria_phage	97.8	1.2e-46
WP_012582377.1|2928214_2928490_+	hypothetical protein	NA	A8ASM5	Listeria_phage	83.0	2.7e-38
WP_012582378.1|2928501_2929290_+	phage antirepressor Ant	NA	Q9T178	Listeria_phage	93.1	1.4e-135
WP_012582379.1|2929415_2929949_+	hypothetical protein	NA	A0A0B5CU01	Listeria_phage	93.2	1.2e-82
WP_003734955.1|2929973_2930264_+	hypothetical protein	NA	A0A0B5CYM2	Listeria_phage	100.0	1.0e-48
WP_003731815.1|2930279_2930468_+	hypothetical protein	NA	A0A0B5CU43	Listeria_phage	98.4	1.7e-28
WP_010991174.1|2930700_2931660_+	YqaJ viral recombinase family protein	NA	A8ATY5	Listeria_phage	99.4	1.3e-177
WP_012582380.1|2931659_2932475_+	recombinase RecT	NA	A0A0B5CTU3	Listeria_phage	99.3	5.9e-150
WP_012582381.1|2932495_2933416_+	DnaD domain-containing protein	NA	A0A0B5D175	Listeria_phage	90.5	2.1e-140
WP_012582382.1|2933412_2933700_+	hypothetical protein	NA	A0A059T7V3	Listeria_phage	93.7	4.4e-44
WP_014589047.1|2934006_2935287_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1X9I6Y5	Streptococcus_phage	54.6	8.4e-119
WP_010991289.1|2935283_2935682_+	hypothetical protein	NA	A0A0B5CYQ9	Listeria_phage	92.9	3.4e-66
WP_010991288.1|2935674_2935863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012581477.1|2935859_2936153_+	hypothetical protein	NA	A8ATM4	Listeria_phage	78.4	8.9e-32
WP_012582385.1|2936169_2936559_+	hypothetical protein	NA	A0A0B5CYR4	Listeria_phage	54.6	3.8e-30
WP_012582386.1|2936559_2936733_+	hypothetical protein	NA	A0A059T7N2	Listeria_phage	93.0	4.7e-25
WP_012582387.1|2936729_2937191_+	hypothetical protein	NA	D9J0I6	Brochothrix_phage	33.1	8.2e-16
WP_012582388.1|2937187_2937571_+	hypothetical protein	NA	A8ATZ3	Listeria_phage	90.6	1.5e-55
WP_012582389.1|2937592_2937793_+	hypothetical protein	NA	A8ASP4	Listeria_phage	74.6	6.5e-18
WP_012582390.1|2937789_2937990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012582391.1|2937982_2938210_+	DUF3850 domain-containing protein	NA	A0A059T7N3	Listeria_phage	97.3	3.9e-35
WP_012582392.1|2938221_2938623_+	hypothetical protein	NA	A8ATZ6	Listeria_phage	82.0	3.9e-54
WP_012582393.1|2938619_2939099_+	single-stranded DNA-binding protein	NA	A0A059T5E0	Listeria_phage	89.4	4.8e-75
WP_012582394.1|2939114_2939657_+	HNH endonuclease	NA	A0A1W6JNP0	Staphylococcus_phage	52.7	7.1e-43
WP_033533856.1|2939674_2939857_+	hypothetical protein	NA	A8ASP6	Listeria_phage	79.4	8.5e-17
WP_014589139.1|2939801_2940206_+	DUF1064 domain-containing protein	NA	A8ASP7	Listeria_phage	88.8	1.6e-60
WP_012582397.1|2940209_2940593_+	DUF2481 family protein	NA	A0A0B5CYS3	Listeria_phage	98.4	4.4e-63
WP_012582398.1|2940721_2940886_+	hypothetical protein	NA	A8ASQ0	Listeria_phage	94.4	2.5e-20
WP_003735131.1|2940904_2941339_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	99.3	4.3e-75
WP_012582399.1|2941912_2942212_+	hypothetical protein	NA	A0A2H4JBC0	uncultured_Caudovirales_phage	38.4	6.5e-14
WP_012582400.1|2942250_2942793_+|terminase	terminase small subunit	terminase	A8ASJ1	Listeria_phage	98.9	5.4e-91
WP_012582401.1|2942761_2944093_+|terminase	PBSX family phage terminase large subunit	terminase	A8ASJ2	Listeria_phage	94.4	3.1e-249
WP_012582402.1|2944105_2945875_+|portal	phage portal protein	portal	A0A059T657	Listeria_phage	95.5	1.8e-265
WP_012582403.1|2945875_2947015_+|capsid	phage minor capsid protein	capsid	A0A0B5D147	Listeria_phage	96.6	3.8e-203
WP_012582404.1|2947093_2947684_+	phage scaffolding protein	NA	Q9T1B8	Listeria_phage	92.0	9.1e-76
WP_012582405.1|2947683_2948685_+	hypothetical protein	NA	A0A059T6D4	Listeria_phage	99.4	1.4e-185
WP_010990219.1|2948703_2949099_+	hypothetical protein	NA	A0A059T5E3	Listeria_phage	99.2	6.7e-67
WP_012582406.1|2949098_2949461_+	hypothetical protein	NA	Q9T1B4	Listeria_phage	94.2	1.5e-60
WP_012582407.1|2949460_2949799_+|capsid	minor capsid protein	capsid	A8ASK0	Listeria_phage	98.2	3.2e-57
WP_012582408.1|2949798_2950206_+|capsid	minor capsid protein	capsid	A8ASK1	Listeria_phage	98.5	5.9e-66
WP_012582409.1|2950208_2950646_+	hypothetical protein	NA	A0A0B5CYN3	Listeria_phage	98.6	4.2e-78
WP_012582410.1|2950668_2950908_+	Ig-like domain-containing protein	NA	A0A059T5E4	Listeria_phage	75.9	5.2e-22
WP_003769943.1|2950962_2951385_+|tail	phage tail assembly chaperone	tail	Q9T1A9	Listeria_phage	97.9	5.9e-69
WP_003735024.1|2951390_2951990_+	bacteriophage Gp15 family protein	NA	A0A0B5CTW0	Listeria_phage	72.0	1.9e-76
WP_012582411.1|2952000_2957367_+	tape measure protein	NA	Q9T1A7	Listeria_phage	95.6	0.0e+00
WP_012582412.1|2957363_2958191_+|tail	phage tail family protein	tail	A0A059T6D8	Listeria_phage	96.7	1.1e-154
WP_012582413.1|2958205_2959228_+|tail	phage tail protein	tail	A0A0B5D0G3	Listeria_phage	98.5	5.4e-193
WP_012582414.1|2959228_2960254_+	hypothetical protein	NA	A0A0B5D157	Listeria_phage	90.9	1.3e-173
WP_012582415.1|2960250_2961336_+|plate	BppU family phage baseplate upper protein	plate	A0A059T7W9	Listeria_phage	95.7	2.4e-82
WP_012582416.1|2961332_2961611_+	hypothetical protein	NA	A8ATB3	Listeria_phage	56.8	7.6e-17
WP_012582417.1|2961615_2961774_+	hypothetical protein	NA	Q9T1A1	Listeria_phage	78.8	2.5e-12
WP_003743972.1|2961810_2962254_+	hypothetical protein	NA	Q8W5Z1	Listeria_phage	100.0	8.0e-77
WP_012582418.1|2962232_2962637_+	hypothetical protein	NA	Q8W5Z0	Listeria_phage	90.3	2.8e-44
WP_012582419.1|2962657_2962918_+|holin	phage holin	holin	Q8W5Y9	Listeria_phage	100.0	1.6e-40
WP_012582420.1|2962910_2963855_+	N-acetylmuramoyl-L-alanine amidase	NA	Q8W5Y8	Listeria_phage	91.7	9.5e-168
WP_012582421.1|2963873_2964308_+	hypothetical protein	NA	A0A0B5CTT3	Listeria_phage	100.0	1.2e-80
WP_012582422.1|2964904_2965774_-	DUF4969 domain-containing protein	NA	NA	NA	NA	NA
WP_012582423.1|2966017_2966380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012582424.1|2966501_2966924_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012582425.1|2966945_2967797_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	37.6	6.8e-48
